| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Endocrine Division (L.H.C., C.C., J.M.D., E.L.S.M., M.S.W., J.L.G., A.L.M.), Hospital de Clínicas de Porto Alegre, Universidade Federal do Rio Grande do Sul, 90035-003 Porto Alegre, RS, Brazil; and Division of Endocrinology (J.W.H., P.R.L., A.C.B.), Diabetes and Hypertension, Brigham and Womens Hospital and Harvard Medical School, Boston, Massachusetts 02115
Address all correspondence and requests for reprints to: Ana Luiza Maia, M.D., Ph.D., Serviço de Endocrinologia, Hospital de Clínicas de Porto Alegre, Rua Ramiro Barcelos 2350, 90035-003 Porto Alegre, RS, Brazil. E-mail: almaia{at}ufrgs.br.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
A role for D2 in human thermogenesis has been largely ignored because adult humans do not have substantial amounts of BAT. However, after cloning the human D2 cDNA, it has become clear that, unlike small mammals, D2 mRNA and activity are present in human heart and skeletal muscle (9, 10). Indirect clinical evidence supports the exciting possibility that D2 might play a previously unrecognized role in determining the thyroid status and metabolic activity of skeletal muscle, analogous to its role in BAT (11, 12). Chronic terbutaline treatment in adult humans was found to increase both resting energy expenditure (13) and the serum T3 to T4 ratio (11), suggesting the existence of an adrenergic-dependent T4 to T3 conversion pathway. That this pathway is predominantly through D2 is supported by the fact that its gene is up-regulated severalfold by adrenergic stimulators and cAMP (14). In addition, in patients receiving T4 replacement at varying dosages, resting energy expenditure correlated directly with free T4 and inversely with serum TSH but, interestingly, not with serum T3 (12). These data are consistent with a role for T4 via D2-dependent intracellular T3 production in skeletal muscle as a significant physiological determinant of energy expenditure in humans.
Although it is difficult to investigate the role of D2 in controlling fuel use and energy expenditure in healthy individuals, clinical studies with type 2 diabetes mellitus (DM2) patients offer a practical approach because these individuals require intense metabolic monitoring and are subjected to detailed scrutiny of fuel use. DM2 is a heterogeneous group of disorders usually characterized by varying degrees of insulin resistance and increased blood glucose concentrations. Ultimately, insulin resistance results either from uninhibited hepatic gluconeogenesis or decreased glucose disposal rate in tissues such as skeletal muscle and adipose tissue. GLUT4, the insulin-responsive glucose transporter, mediates the rate-limiting step of glucose metabolism in skeletal muscle and adipose tissue (15). GLUT4 expression is up-regulated by thyroid hormone, and its overexpression in insulin-resistant db/db mice fed a high-fat diet dramatically improves glycemic control (15, 16).
Recent studies have shown that specific polymorphisms in the deiodinase genes may have pathophysiological effects, interfering in the phenotypic expression of these enzymes (17). Of particular interest was a study describing a Dio2 single nucleotide polymorphism A/G polymorphism in humans, in which a threonine (Thr) change to alanine (Ala) at codon 92 (D2 Thr92Ala) was associated with an approximately 20% lower glucose disposal rate (18). The frequency of the variant allele was also found to be increased in some ethnic groups, such as Pima Indians and Mexican-Americans, who also have a higher prevalence of insulin resistance (18).
In the present study, we demonstrate that although D2 activity in vitro is not affected by the Thr92Ala mutation per se, the Ala allele variant was associated with lower D2 velocity in human thyroid and skeletal muscle samples. Furthermore, the Ala/Ala genotype was associated with more severe insulin resistance in a sample population of DM2 patients. This suggests that D2 catalyzed conversion of T4 to T3 might play a role in determining insulin sensitivity, glucose use, and, hence, obesity in humans.
| Patients and Methods |
|---|
|
|
|---|
The type 2 deiodinase Thr92Ala polymorphism was analyzed in blood samples from 183 DM2 patients attending the Endocrine Divisions outpatient clinic at Hospital de Clínicas de Porto Alegre (Brazil). A standard questionnaire was used to collect information about age, age at DM diagnosis, and drug treatment. All patients underwent a complete physical examination and laboratory tests. They were weighed without shoes and in light outdoor clothes and had their height measured. Body mass index (BMI) was calculated as weight (kilograms) divided by the square of height (meters squared). To calculate waist to hip ratio (WHR), waist circumference was measured at the narrowest point, as viewed from the front, and hip circumference was measured at the widest point. Blood pressure was measured twice in the sitting position after a 10-min rest by means of a mercury sphygmomanometer (Korotkoff phases I and V). Hypertension was confirmed with blood pressure more than 140/90 mm Hg, or if the patient was taking antihypertensive drugs. Patients with elevated serum creatinine [>1.5 mg/dl (132.6 mmol/liter)], and those receiving insulin therapy were excluded.
Samples of thyroid tissues were obtained from patients attending the Endocrine or the Head and Neck Surgery Divisions at Hospital de Clínicas de Porto Alegre who had thyroidectomy because of benign or malignant thyroid nodules. The samples were collected from normal contralateral thyroid lobe or from tissue of focal thyroid neoplasm. Attending physicians not involved in the study had independently indicated surgery, and the tissues obtained were immediately frozen and stored until analysis.
Skeletal muscle sample biopsies (sternocleidomastoid and rectus abdomenus) were obtained during routine surgery procedures performed by the same general surgery team. Exclusion criteria were a diagnosis of diabetes mellitus or impaired glucose intolerance, metastatic cancer, and hyper- or hypothyroidism. Samples collected were immediately snap-frozen in liquid nitrogen and stored at 70 C until analysis.
The information obtained from the study did not influence the patients diagnosis or treatment. The local Ethics Committee approved both protocols, and all patients signed an informed consent form.
Laboratory analysis
A serum sample was collected after a 12-h fast. Glucose levels were determined by a glucose oxidase method, creatinine by the Jaffé reaction, glycosylated hemoglobin by an ion-exchange HPLC procedure (Merck-Hitachi L-9100 glycated hemoglobin analyzer, Merck, Darmstadt, Germany; reference range: 2.74.3%), and triglyceride and cholesterol levels by enzymatic methods. Serum insulin was measured by radioassay (ElecsysR Systems 1010/2010/modular analytics E170, Roche Diagnostics, Indianapolis, IN). Low-density lipoprotein-cholesterol was calculated using the Friedewald equation. Insulin sensitivity was estimated by homeostasis model assessment [HOMA = fasting insulin (milliunits per milliliter) x fasting glucose (millimoles per liter)/22.5], as recently described and validated (19). The mean HOMA value of control subjects in our laboratory was 1.84 ± 1.02 (20).
Genotype analysis
Genotyping of the A/G polymorphism was performed by restriction fragment-length polymorphism analyses. Briefly, PCR was carried out in 96-well microtiter plates with a final reaction volume of 25 µl using specific oligonucleotides derived from published sequences of the human Dio2 gene, resulting in a predicted 256-pb fragment (18). Each PCR contained 50100 ng genomic DNA, 1 µmol/liter of each primer, 2 mmol/liter MgCl2, 50 mmol/liter KCl, 20 mmol Tris-HCl, 0.2 mmol/liter dNTPs, and 1 U Taq polymerase (Invitrogen, Carlsbad, CA). The reaction conditions were as follows: an initial denaturation step at 94 C for 2 min, followed by 94 C for 1 min, annealing at 60 C, and extension at 72 C for 2 min. Thirty cycles were used, with a final additional extension step at 72 C for 4 min. Ten microliters of PCR product was then incubated at 37 C for 3 h with 5 U BsgI restriction enzyme. The product of the enzymatic digestion was analyzed on a 1.5% agarose gel stained with ethidium bromide and visualized by optical densitometry (ImageMaster VDS, Amersham Biosciences Inc., Piscataway, NJ). Individuals homozygous for the Thr-encoding allele were displayed as an uncut 256-pb fragment and the Ala allele were shown as a doublet of 186- and 70-pb bands. Patients were classified in groups of Thr/Thr or Ala/Thr and Ala/Ala according to the presence of the alleles. All amplification reactions were performed twice.
5'-Deiodinase assays
D2 assay was performed as previously described (21). Briefly, tissue samples or cell sonicates were homogenized in 0.25 M sucrose in PE buffer (0.1 M potassium phosphate and 1 mM EDTA) with 10 mM dithiothreitol (DTT). The reaction mixtures containing 50300 µg tissue protein were incubated in a total volume of 300 µl with 125I-T4 (Amersham Biosciences Inc.) purified by LH-20 column chromatography (Pfizer, Inc., Täby, Sweden), 1 or 4 nM unlabeled T4, 20 mM DTT, and 1 mM propylthiouracil in PE buffer at 37 C for 2 or 5 h. In kinetic experiments, T4 concentrations of 0.520 nM were used as substrate, and kinetic constants were calculated using double reciprocal plots. Reactions were terminated by the addition of 200 µl horse serum and 100 µl 50% trichloroacetic acid. After centrifugation at 13,000 rpm for 2 min, free 125I in the supernatant was counted with a
-scintillation counter. D1 assay was performed at the same conditions described above using 1 µM unlabeled T4 as substrate, 10 mM DTT, and no propylthiouracil. All reactions were performed in duplicate.
Tissue preparation and RNA isolation
Thyroid tissue samples were immediately snap-frozen in liquid nitrogen and stored at 70 C until RNA preparation. Total RNA was isolated from 50100 mg thyroid nontumor or skeletal muscle tissues using TRIzol reagent (Invitrogen) according to the manufacturers instructions. The purity and integrity of total RNA was assessed by UV spectrophotometer (GeneQuant II, Amersham Biosciences, Inc.) and denaturing agarose gel electrophoresis.
RT-PCR
A semiquantitative RT-PCR technique was used to determine the expression levels of the D2 mRNA in samples of RNA isolated from thyroid tissues. RT-PCR was performed using the Superscript Preamplification System for First Strand cDNA Synthesis (Invitrogen) with 3 µg total RNA as template. Specific oligonucleotides derived from the coding region of published sequences of the human Dio2 gene (5'-ACTCGGTCA TTCTGCTCAAG-3' and 5'-GAGAACTCTTCCACCAGTTTG-3') were used to prime target cDNA, resulting in a predicted 368-bp product (22). Human ß 2-microglobulin primers set (5'-ATCCAGCGTACTCCAAAGATTCAG-3' and 5'-AAATTGAAAGTTAACTTATGCACGC-3'), which generates a 623-bp product, was used as an internal control. Both fragments were coamplified with ß2-microglobulin within the same reaction to evaluate intersample variation in cDNA content and PCR efficiency. A preliminary PCR amplification was performed to determine the range of cDNA concentrations and number of cycles over which the gene expression should be examined before reaching a plateau. The PCR included 1 µl RT product for Dio2 mRNA amplification and were carried with Taq DNA polymerase (Invitrogen) in a final 50-µl volume. The amplification protocol had an initial step at 94 C for 3 min, followed by 94 C for 1 min, annealing at 60 C (D2), and extension at 72 C for 2 min. Thirty cycles were used, with a final additional extension step at 72 C for 4 min. The ß2-microglobulin primers were included after the 10th cycle for D2. RT-PCR without cDNA samples was carried out as negative controls. All reactions were performed in duplicate. After amplification, 10 µl PCR products was analyzed on a 1.5% agarose gel stained with ethidium bromide and the densitometric results of D2 bands (arbitrary units) were normalized against the corresponding values of the ß2-microglobulin band intensities. Densitometric quantification of the ethidium bromide stained bands was carried out using the ImageMaster VDS (Amersham Biosciences Inc.).
Expression studies in mammalian cells
Site-directed mutagenesis was performed to introduce T92A mutation in wild-type D2 (wtD2) cDNA cloned into the D10 mammalian expression vector (23) The mutant construct, named here D2 Thr92Ala, was generated using overlap extension PCR. The fragments obtained with the oligonucleotides Bg84/C33 (5' CATGCCATGGGCATCCTCAGCGTAGACTTGCTGA 3' and 5' ACTGTTGTCACCTCCTTCTGCACTGGAGACATGCAC 3') and C32/C36 (5' GTGCATGTCTCCAGTGCAGAAGGAGGTGACAACAGT 3' and 5' GTTGTAGGAGAAGGGGCCCTTTCCTCCCAG-3') were used as a template for another PCR using only the outer oligonucleotides Bg84/C36, and the resulting fragment was subcloned in NCO1 and APA1 sites of wt D2. The mutations were verified by automated sequencing. Constructs were transfected into HEK-293 cells by calcium phosphate precipitation and transfection efficiencies were monitored by assay of cotransfected human GH in the medium (24). To determine the half-life of both D2 proteins, we used cycloheximide (Sigma-Aldrich, St. Louis, MO) in 100 µM final concentration. At the appropriate times, cells were harvested, and D2 activity was measured in sonicated cells. Each experiment was performed with triplicate dishes for each condition.
Statistical analysis
Results are expressed as mean ± SD or median and range. Clinical and laboratory data from Thr/Thr, Thr/Ala, and Ala/Ala genotype individuals were compared using ANOVA or the Kruskal-Wallis H test. To examine the main effect of the D2 Thr92Ala variant, the three genotypes (Thr/Thr, Thr/Ala, and Ala/Ala) were considered separately, followed by pooling the Thr/Thr and Thr/Ala groups. For comparisons between two groups, Students t test or Mann-Whitney U test was applied. Linear multiple regression analysis was performed with HOMA-r (logarithmic) as dependent variable and age, gender, BMI, use of medication, and genotype as independent variables. The analyses were done using SSPS version 10.0. P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
The characteristics of the 183 DM2 patients analyzed in this study were the following. The mean age was 58 ± 10 yr, and the mean BMI was 29 ± 4.8 kg/m2. Males comprised 42% (n = 79) of the sample, and 64% (n = 117) of all patients had arterial hypertension. Twenty-four patients (13%) were treated by diet alone. Sulfonylureas alone were used by 30.6% (n = 56), metformin alone by 20.2% (n = 37), and the combination of both by 36.1% (n = 66) of the patients.
Thirty-five patients (19.1%) were homozygous for the Ala allele (Ala/Ala), 82 (44.8%) were heterozygous (Ala/Thr), and 66 (36.0%) were homozygous for the Thr allele (Thr/Thr). The Thr allele frequency was 0.59, and Ala frequency was 0.41. Genotypes were in Hardy-Weinberg equilibrium. Table 1
summarizes the clinical and laboratory data of the patients grouped according to the D2 Thr92Ala polymorphism. The mean age, diabetes duration, and the proportion of males and Caucasians were similar among the genotypes. Systolic and diastolic arterial blood pressure, waist to hip ratio, and metabolic control were also similar across the three genotypes.
|
Assuming a recessive model, patients with Ala/Thr and Thr/Thr genotypes were grouped and compared with patients with Ala/Ala genotype (Fig. 1
, A and B). The HOMA index was higher in the Ala/Ala group compared with Ala/Thr-Thr/Thr group [8.50 (0.88144) vs. 4.85 (0.382.7); P = 0.003] (Fig. 1A
). Because insulin sensitivity is known to be influenced by multiple independent factors, a multiple regression linear analysis was performed with the HOMA-r (log10HOMA) as dependent variable. Table 2
shows that the Ala/Ala genotype remains significantly associated with insulin resistance after controlling for gender, age, BMI, and use of medication. Interestingly, the association between the Ala/Ala genotype and the HOMA index was even more pronounced among patients with BMI lower than 30 kg/m2 [9.71 (0.88144) vs. 4.37 (0.382.7); P = 0.006] (Fig. 1B
).
|
|
To determine whether homozygosity for the Ala allele affects D2 expression and/or activity, we obtained fresh human thyroid and skeletal muscle tissue samples and processed them for D2 mRNA and activity. All subjects had normal serum TSH levels at the time the tissues were collected. D2 activity was measured at 1 nM T4 in 21 thyroid samples. In subjects with the Ala/Ala genotype, D2 velocity was half of that found in the subjects with Ala/Thr or Thr/Thr genotypes (Ala/Ala vs. Ala/Thr +Thr/Thr; 0.13 ± 0.06 vs. 0.24 ± 0.09 fmol/min·mg protein; P = 0.05) (Fig. 2A
).
|
Further analyses of the thyroid tissue samples using the Lineweaver-Burk double-reciprocal plots indicated that the Michaelis-Menten constant (Km) (T4) values for D2 in the Ala/Ala and Thr/Thr were similar (Fig. 2B
). However, the D2 Vmax values in the tissues samples with an Ala/Ala genotype were 310-fold lower than in samples with the Thr/Thr genotype (Fig. 2B
). Therefore, a difference in D2 amounts or velocity accounts for the lower enzyme velocity in tissues from patients with Ala/Ala genotypes.
To verify that changes in the D2 mRNA concentrations in tissues with the Ala/Ala genotype would explain the lower D2 activity, we estimated D2 mRNA levels by PCR in thyroid tissue samples from subjects with the three different genotypes. A total of 26 tissue samples were available for analysis, with the following distribution among the three genotypes: AL/Ala, six; AL/Thr,12; and Thr/Thr, eight. No differences in D2 mRNA levels were found among the three genotypes (0.635 ± 0.343, 0.601 ± 0.398, and 0.630 ± 0.255 AU, respectively; P = 0.970).
D1 activity was also measured in some of the thyroid tissue samples to verify that the reduction in D2 activity in the samples with an Ala/Ala genotype was not due to admixture with cellular thyroid tissue. Figure 2B
shows that there were no differences in D1 activities between the Ala/Thr-Thr/Thr and Ala/Ala genotypes, indicating that the differences in D2 were not due to tissue sampling variations.
Functional studies of Thr92Ala D2 transiently expressed in HEK-293 cells
To evaluate whether the substitution of Ala for Thr at position 92 alters the kinetic properties of the enzyme, plasmids encoding either wild-type or D2Thr92Ala constructs were transiently expressed in HEK-293 cells, and D2 velocity was determined in cell sonicates under conditions described in Patients and Methods. We did not detect significant kinetic differences between the two proteins, which display comparable Km (T4), maximal enzyme velocity, half-life, and sensitivity to substrate-induced loss of activity (Fig. 3
, AC).
|
| Discussion |
|---|
|
|
|---|
Insulin resistance plays a major role in the pathogenesis of type 2 diabetes. Although major genetic factors remain to be determined, common polymorphisms in the PC-1, insulin receptor substrates 1 and 2, and PPAR-
2 genes have been linked to insulin resistance and dyslipidemia (25). Recently, the D2 Thr92Ala polymorphism was found to be associated with insulin resistance in nondiabetic women who underwent euglycemic-hyperinsulinemic clamps (18). Here, we demonstrate using HOMA that this association is not only present but also somewhat more pronounced in nonobese DM2 patients. Patients homozygous for the Ala allele were found to have higher fasting plasma insulin levels and HOMA index, and this association was even more pronounced in patients with BMI lower than 30 kg/m2, a generally accepted cutoff for obesity. These findings are particularly relevant because the D2 ThrD2Ala variant might be a novel marker for insulin resistance that is apparently not related to other well-known risk factors such as obesity. Although HOMA index is only an estimate of insulin resistance, it is simple to perform and shows a good correlation with the reference method, the euglycemic clamp (19, 26) and, therefore, is considered a good approach for cohort and epidemiological studies (27).
A major novel observation in these studies is the positive association between the Ala/Ala genotype and lower D2 activity in tissue samples. This provides a potential mechanistic explanation for the association between insulin resistance and the D2 Thr92Ala polymorphism. In humans, skeletal muscle is the primary site of insulin-dependent glucose disposal (28). A lower D2 activity would decrease D2-generated T3 in skeletal muscle and could create a state of relative intracellular hypothyroidism, decreasing the expression of genes involved in energy use, such as GLUT4, leading to insulin resistance.
The mechanism of reduced D2 activity is not clear. In agreement with previous studies (16), we did not detect any significant changes in the biochemical properties of the mutant enzyme (Fig. 3A
), suggesting that although this variant could be a marker for abnormal Dio2 expression, the mutation per se does not explain the reduced D2 velocity. Other D2 properties, such as half-life and sensitivity to substrate exposure, were also unaffected (Fig. 3
, B and C). The single-point mutation (A/G) in the Dio2 gene is a nonconservative variant that predicts a Thr to Ala substitution at codon 92, which is not near the catalytic active site of the enzyme (5). In addition, this region is not phylogenetically conserved. The homologous amino acid is a proline in rodents and a glycine in chicken D2 (29). In contrast, humans and amphibians share a Thr in this position. Thus, it seems likely that the lower D2 activity is the result of linkage disequilibrium between the Thr92Ala polymorphism and a functional polymorphism elsewhere in this allele of the Dio2 gene or in a gene nearby. This is supported by a recent report of a positive association of common single-nucleotide polymorphisms in the Dio2 gene, the D2 Thr92Ala polymorphism, and two others located in the noncoding region of the gene, with mental retardation in iodine-deficient areas of China (30). However, it is intriguing that no differences were observed in D2 mRNA levels among the genotypes. Although the method used here, RT-PCR, is semiquantitative, it provides a reasonable approximation to compare amounts of a given mRNA in different samples. If this is true, an alternative possible explanation is that the Thr92Ala mutation causes a defect in translation or protein stability, which was detected in tissues, but not in the in vitro expression system.
Some factors unrelated to the deiodinase polymorphism could have interfered with the findings of the present investigation. For example, medications for DM2 could have played a role because some are known to affect with insulin sensitivity. However, we minimized such a possibility by excluding insulin-treated patients, and the proportion of patients on metformin and/or sulfonylureas was similar among the genotype groups. Furthermore, the D2 genotype remains significantly associated with HOMA index in a linear regression model analysis that included use of medication as a variable. Regarding the D2 activity in human tissues, even though the number of samples analyzed was small, these subjects were not receiving any medication known to affect insulin secretion and/or sensitivity, or deiodinase function.
In conclusion, the Dio2 single-nucleotide polymorphism A/G is associated with more severe insulin resistance in DM2 patients. This polymorphism is associated with lower D2 velocity in the skeletal muscle and thyroid sample tissues. These findings indicate that the intracellular D2-generated T3 in skeletal muscle may play a role in determining insulin resistance. Thus, skeletal muscle D2 may be a potential pharmacological target for treating patients with insulin resistance.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online March 29, 2005
Abbreviations: BAT, Brown adipose tissue; BMI, body mass index; DM2, type 2 diabetes mellitus; DTT, dithiothreitol; HOMA, homeostasis model assessment; Vmax, maximum velocity; WHR, waist to hip ratio.
Received October 11, 2004.
Accepted March 21, 2005.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
I. Meulenbelt, J. L. Min, S. Bos, N. Riyazi, J. J. Houwing-Duistermaat, H.-J. van der Wijk, H. M. Kroon, M. Nakajima, S. Ikegawa, A. G. Uitterlinden, et al. Identification of DIO2 as a new susceptibility locus for symptomatic osteoarthritis Hum. Mol. Genet., June 15, 2008; 17(12): 1867 - 1875. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Maia, S.-J. Hwang, D. Levy, M. G. Larson, P. R. Larsen, and C. S. Fox Lack of Association Between the Type 2 Deiodinase A/G Polymorphism and Hypertensive Traits: The Framingham Heart Study Hypertension, April 1, 2008; 51(4): e22 - e23. [Full Text] [PDF] |
||||
![]() |
M. Torlontano, C. Durante, I. Torrente, U. Crocetti, G. Augello, G. Ronga, T. Montesano, L. Travascio, A. Verrienti, R. Bruno, et al. Type 2 Deiodinase Polymorphism (Threonine 92 Alanine) Predicts L-Thyroxine Dose to Achieve Target Thyrotropin Levels in Thyroidectomized Patients J. Clin. Endocrinol. Metab., March 1, 2008; 93(3): 910 - 913. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. Canani, M. A. Leie, W. E. Machado, C. Capp, and A. L. Maia Type 2 Deiodinase Thr92Ala Polymorphism Is Not Associated With Arterial Hypertension in Type 2 Diabetes Mellitus Patients Hypertension, June 1, 2007; 49(6): e47 - e47. [Full Text] [PDF] |
||||
![]() |
E. Ortega, N. Pannacciulli, C. Bogardus, and J. Krakoff Plasma concentrations of free triiodothyronine predict weight change in euthyroid persons Am. J. Clinical Nutrition, February 1, 2007; 85(2): 440 - 445. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. de Jong, R. P. Peeters, T. den Heijer, W. M. van der Deure, A. Hofman, A. G. Uitterlinden, T. J. Visser, and M. M. B. Breteler The Association of Polymorphisms in the Type 1 and 2 Deiodinase Genes with Circulating Thyroid Hormone Parameters and Atrophy of the Medial Temporal Lobe J. Clin. Endocrinol. Metab., February 1, 2007; 92(2): 636 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Grarup, M. K. Andersen, C. H. Andreasen, A. Albrechtsen, K. Borch-Johnsen, T. Jorgensen, J. Auwerx, O. Schmitz, T. Hansen, and O. Pedersen Studies of the Common DIO2 Thr92Ala Polymorphism and Metabolic Phenotypes in 7342 Danish White Subjects J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 363 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P Peeters, W. M van der Deure, and T. J Visser Genetic variation in thyroid hormone pathway genes; polymorphisms in the TSH receptor and the iodothyronine deiodinases. Eur. J. Endocrinol., November 1, 2006; 155(5): 655 - 662. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. H. Friesema, G. G. J. M. Kuiper, J. Jansen, T. J. Visser, and M. H. A. Kester Thyroid Hormone Transport by the Human Monocarboxylate Transporter 8 and Its Rate-Limiting Role in Intracellular Metabolism Mol. Endocrinol., November 1, 2006; 20(11): 2761 - 2772. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Fernandez-Real, A. Lopez-Bermejo, A. Castro, R. Casamitjana, and W. Ricart Thyroid Function Is Intrinsically Linked to Insulin Sensitivity and Endothelium-Dependent Vasodilation in Healthy Euthyroid Subjects J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3337 - 3343. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Peeters, S. van der Geyten, P. J. Wouters, V. M. Darras, H. van Toor, E. Kaptein, T. J. Visser, and G. Van den Berghe Tissue Thyroid Hormone Levels in Critical Illness J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6498 - 6507. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Appelhof, R. P. Peeters, W. M. Wiersinga, T. J. Visser, E. M. Wekking, J. Huyser, A. H. Schene, J. G. P. Tijssen, W. J. G. Hoogendijk, and E. Fliers Polymorphisms in Type 2 Deiodinase Are Not Associated with Well-Being, Neurocognitive Functioning, and Preference for Combined Thyroxine/3,5,3'-Triiodothyronine Therapy J. Clin. Endocrinol. Metab., November 1, 2005; 90(11): 6296 - 6299. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |