help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2004-1394
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Porra, V.
Right arrow Articles by Rousset, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Porra, V.
Right arrow Articles by Rousset, B.
Right arrowPubmed/NCBI databases
*OMIM
*Genetics Home Reference
Medline Plus Health Information
*Thyroid Cancer
Related Collections
Right arrow Thyroid
Right arrow Endocrine Oncology
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 5 3028-3035
Copyright © 2005 by The Endocrine Society

Silencing of the Tumor Suppressor Gene SLC5A8 Is Associated with BRAF Mutations in Classical Papillary Thyroid Carcinomas

Valérie Porra1, Carole Ferraro-Peyret1, Christine Durand, Samia Selmi-Ruby, Hélène Giroud, Nicole Berger-Dutrieux, Myriam Decaussin, Jean-Louis Peix, Claire Bournaud, Jacques Orgiazzi, Françoise Borson-Chazot, Robert Dante and Bernard Rousset

Unité Mixte de Recherche 369, Institut National de la Santé et de la Recherche Médicale/Université Claude Bernard Lyon 1 (UCBL), and Institut Fédératif de Recherche 62 (V.P., C.F.-P., C.D., S.S.-R., F.B.-C., B.R.), Faculté de Médecine Lyon-RTH Laennec, 69372 Lyon Cedex 08, France; Unité Fonctionnelle de Biologie Cellulaire (V.P., C.F.-P., H.G., B.R.), Hôpital Edouard-Herriot, 69437 Lyon Cedex 03, France; FRE 2692 Centre National de la Recherche Scientifique/UCBL (R.D.), Faculté de Médecine Grange Blanche, 69373 Lyon Cedex 08, France; and Lyon Thyroid Tumor Bank Organization (N.B.-D., M.D., J.-L.P., C.B., J.O., C.F.-P., F.B.-C., B.R.), 69437 Lyon, France

Address all correspondence and requests for reprints to: Professor Bernard Rousset, Institut National de la Santé et de la Recherche Médicale Unit 369, Faculté de Médecine Lyon-RTH Laennec, Rue Guillaume Paradin, 69372 Lyon Cedex 08, France. E-mail: u369{at}sante.univ-lyon1.fr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SLC5A8, proposed as a thyroid apical iodide transporter, was recently defined as a Na+-coupled transporter of short-chain fatty acid. To document the expression pattern of SLC5A8 in the thyroid, we analyzed the regulation of its expression in normal human thyrocytes in culture and in tissues with distinct functional activity. To determine whether SLC5A8 expression is altered in all thyroid carcinomas or only in particular subtypes, we investigated the level of its expression in a series of 50 hypofunctioning tumors. SLC5A8 expression was studied at the transcript level and compared with that of SLC26A4 or Pendrin and SLC5A5 or Na+/iodide symporter. SLC5A8 expression, unlike that of SLC5A5 and SLC26A4, was not regulated by TSH in normal human thyrocytes in culture and was not related to the functional state of thyroid tissue; toxic adenomas and adjacent resting tissues exhibited the same SLC5A8 transcript content. SLC5A8 expression was selectively down-regulated (40-fold) in papillary thyroid carcinomas of classical form (PTC-cf.). Methylation-specific PCR analyses showed that SLC5A8 was methylated in 90% of PTC-cf. and in about 20% of other papillary thyroid carcinomas. In a series of 52 PTC-cf., a low SLC5A8 expression was highly significantly associated with the presence of BRAF T1796A mutation. These data identify a relationship between the methylation-associated silencing of the tumor-suppressor gene SLC5A8 and the T1796A point mutation of the BRAF gene in the PTC-cf. subtype of thyroid carcinomas.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE IODIDE SUPPLY of the thyroid gland involves a two-step transport process: an active iodide transport across the basolateral plasma membrane of thyrocytes by the Na+/iodide symporter or SLC5A5 (1) and a passive transport across the apical plasma membrane. The protein(s) insuring the second step is not yet identified. Two potential apical iodide transporters belonging to the sodium/glucose cotransporter SLC family have been proposed: pendrin (2) (encoded by the PDS gene or SLC26A4) and a protein named AIT for apical iodide transporter (3) (encoded by the SLC5A8 gene).

Pendrin is expressed in different organs, among which are thyroid, kidney, inner ear, and placenta (4, 5, 6). Pendrin has been described as a chloride/bicarbonate or formate exchanger (7, 8). In the thyroid, pendrin is a 110-kDa protein (9) selectively located at the apical plasma membrane. Its capacity to transport iodide has been documented in different experimental systems (10, 11, 12), but its implication in the efflux of iodide from thyrocytes to the follicle lumen has not been demonstrated yet.

AIT is a 69-kDa protein sharing 46% identity with human Na+/iodide symporter (3, 13). Expressed in mammalian cells, AIT mediates a passive iodide transfer. Because the protein is located at the apical plasma membrane of thyrocytes (3), it was suggested that AIT could be involved in the passive transport of iodide from thyrocytes to the follicle lumen. Information about AIT or SLC5A8 expression in the thyroid is still limited. Lacroix et al. (13) recently reported that the AIT transcript level is decreased in thyroid carcinomas. SLC5A8 is expressed abundantly in the colon (14). Two recent reports assign to it a function of Na+/short-chain fatty acid cotransporter (15, 16). SLC5A8 was found to be silenced and methylated in more than 50% of colon cancer cell lines and primary colon cancers. SLC5A8 appears as a colon cancer suppressor gene, because restoration of its expression in SLC5A8-deficient cell lines led to the suppression of cell growth (14).

In this study, we examined the expression pattern of SLC5A8 in the thyroid by analyzing the changes in SLC5A8 transcript level in response to TSH stimulation using normal human thyrocytes in culture and by comparing the SLC5A8 transcript content of activated [toxic adenomas (TA)] (17, 18) and resting (adjacent parenchyma) thyroid tissues. We report that SLC5A8 expression, unlike that of SLC5A5 and SLC26A4, is not regulated by TSH at the transcriptional level and is independent of the state of activation or functional activity of thyroid tissue. By measuring SLC5A8 transcript levels in a series of 50 hypofunctioning benign or malignant thyroid tumors, we found that SLC5A5 is markedly and selectively under-expressed in a subtype of thyroid cancer, the papillary thyroid carcinomas of classical form (PTC-cf.). Down-regulation of SLC5A8 appeared to be related to hypermethylation of a dense cytidine-phospho-guanosine (CpG) island located in exon 1 of the gene. By screening a series of 52 PTC-cf. for BRAF mutation (hot spot mutation at nucleotide 1796), we identified a highly significant association between SLC5A8 silencing and the presence of the mutation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human thyroid tissues

Thyroid tissue samples were taken from the Lyon Thyroid Tumor Bank, established since 1998, as part of a collaborative clinical research project on differentiated thyroid cancer at the Lyon University Hospital Center (9, 19). This study was approved by the supervision interdisciplinary committee of the Tumor Bank and performed in accordance with protocols previously approved by the local human studies committee. Specimens maintained in the bank consisted of pairs of samples: fragments of tumor and fragments of adjacent normal thyroid tissue collected at the time of extemporaneous examination of surgical pieces from patients undergoing partial or total thyroidectomy. Tissue samples weighing 50–200 mg were frozen in liquid nitrogen and stored at –80 C. Tumors were classified according to World Health Organization (WHO) recommendations (20). Pathological and clinical annotations were anonymously associated to samples maintained in the Tumor Bank. Samples used in this study were follicular adenomas (FA) (n = 10), follicular thyroid carcinomas (FTC) (n = 9), papillary thyroid carcinomas (PTC) (n = 31), and the paired normal tissue (NT) (n = 50). PTC were divided into PTC-cf. (n = 18) and follicular variant of PTC (PTC-fv) (n = 13). A PTC-fv, as defined in the new WHO classification of tumors (20), is composed of small-to-medium-sized, irregularly shaped follicles with virtually no papillary structures. A PTC-cf. contains a variable proportion of follicular architecture and well-formed papillae. The age and gender of patients as well as the size and grading of tumors are reported in Table 1Go. Additional tissue samples such as TA (n = 5) and paired NT, PTC-cf. (n = 36), and anaplastic carcinomas (n = 5) were used in some experiments. Patients with TA showed a hot nodule with functional suppression of the remaining parenchyma at thyroid scintigraphy. At histological examination, TA appeared as 2.5- to 5-cm nodules formed of follicular structures of variable size, often large in the center and small at the periphery. The 36 PTC-cf. samples (used in the last part of the study) were from 33 females and three males (mean age ± SEM, 41.6 ± 3.1 yr); the mean tumor size ± SEM was 2.3 ± 0.2 cm.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Clinical and pathological characteristics of tumors

 
Isolation and culture of human thyroid cells

Fragments of normal human thyroid tissue weighing approximately 1 g were used for cell isolation within 1 h after devascularization. Thyroid cells were dispersed in Earle medium (Life Technologies Inc., Cergy-Pontoise, France) (pH 7.4) containing 12 mg/ml trypsin (Life Technologies) and 0.24 mg/ml collagenase IX (Sigma, St. Louis, MO). The enzyme treatment consisted of a series of 30-min incubations at 37 C. Isolated thyroid cells were cultured in Ham’s F12 medium (Seromed Biochrom KG, Berlin, Germany) containing 5% calf serum, penicillin (200 U/ml; Sigma), and streptomycin (0.2 mg/ml; Sigma) in 6-cm petri dishes. A fraction of the freshly isolated thyroid cell population was frozen in liquid nitrogen for RNA extraction. Cells were cultured at 37 C under a 95% air/5% CO2 atmosphere in the absence or presence of 1 mU/ml TSH (bovine TSH from Sigma) from the onset of culture. The medium was changed after 48 h, and, after 3 d, cells were collected in the RNA extraction solution.

RNA extraction and reverse transcription (RT)

Total RNA was isolated from frozen thyroid tissue samples, frozen aliquots of isolated thyroid cells, and cultured cells using the phenol-chloroform extraction procedure, according to Chomczynski and Sacchi (21), and was subsequently purified on silica column (RNeasy minikit, Qiagen SA, Courtaboeuf, France) according to the manufacturer’s protocol. Potentially contaminating genomic DNA was systematically eliminated by a deoxyribonuclease I treatment (Rnase free Dnase from Qiagen). Control of RNA integrity and RNA quantification were performed by the microfluidic electrophoretic separation on chips using the Agilent 2100 BioAnalyzer, the RNA 6000 nano Lab Chip reagent set (Agilent Technologies, Massy, France), and the RNA ladder (Ambion, Huntington, UK) for calibration. The average value of the 28S/18S ratio obtained for each of the four groups of tumor/paired NT samples was close to or higher than 1.8 (Table 1Go). None of the RNA samples used in this study had a 28S/18S ratio lower than 1.5. The amount of RNA extracted per mass of tissue was significantly higher in tumors than in paired NT samples (Table 1Go). RNA recovery progressively increased from FA to PTC-cf. with intermediate values in FTC and PTC-fv. This is related to the cell density of tumors.

Total RNA (1 µg) was reverse transcribed for 1 h at 37 C in a 20-µl reaction volume containing 200 U Moloney murine leukemia virus reverse transcriptase (Promega Corp., Madison, WI), 10 nmol of each deoxynucleoside triphosphate (Promega Corp.), 24 U ribonuclease inhibitor (Promega Corp.), and 100 pmol of random hexamers (Amersham Pharmacia, Orsay, France). Synthesized cDNAs were then treated for 5 min at 95 C. To minimize potential variation in the efficiency of the RT reaction, the 100 samples were retrotranscribed in two separate experiments. Average PCR values obtained by amplification of SLC26A4 from the cDNA prepared from NT samples in RT1 (n = 24) and RT2 (n = 26) differ by less than 5%.

Real-time PCR

PCR was performed on the LightCycler (Roche Diagnostics, Meylan, France). Amplification of cDNAs corresponding to SLC5A8, SLC26A4, and SLC5A5 mRNAs, and to 18S rRNA was carried out in duplicate in a final volume of 20 µl containing the master mix (Fast start DNA Master SYBR GREEN I kit containing Taq DNA polymerase, deoxydinucleotide triphosphates, and Sybr Green), 2 mM MgCl2, 5 µM of forward and reverse primers, and 5 µl of the diluted cDNA template solution, corresponding to 2.5 ng of retrotranscribed RNA for SLC5A8, SLC26A4, and SLC5A5, and to 25 pg for 18S rRNA. The location and sequence of primers are given in Fig. 1Go. PCR conditions included an initial denaturation of 10 min at 95 C, followed by 40 cycles consisting of 15 sec at 95 C for denaturation, 4 sec at 57, 60, or 64 C (depending on the gene) (Fig. 1Go) for annealing, and 8 sec at 72 C for the final extension step. Fluorescence intensity measurements obtained at the end of each cycle were used to determine the crossing point value, i.e. the cycle number at which fluorescence was significantly greater than the background. The specificity of the PCR amplification was assessed by determination of the melting temperature of amplicons using a fusion program, consisting in a progressive temperature increase of 0.1 C/sec from 60 to 95 C.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 1. Definition of primers used for SLC5A8, SLC26A4, and SLC5A5 transcript assays by real-time RT-PCR. A, Positioning of primers on the coding nucleotide sequence of the genes (numbering is from the first nucleotide of the initiation codon to the last nucleotide of the termination codon). B, Sequence of primers, size of the amplified products, and hybridization temperature. PDS, Pendred syndrome; NIS, Na+/iodide symporter.

 
Cloning of amplicons to generate external standards

Amplicons corresponding to SLC5A8, SLC26A4, SLC5A5, and 18S rRNA were cloned into the pGEMT easy vector (Promega Corp.). The identity of the cDNA insert was controlled by sequencing (Genome Express, Grenoble, France). Amounts of plasmid corresponding to 101 to 106 cDNA copies were included in each PCR assay to generate calibration curves by plotting crossing point values as a function of the cDNA copy number. Results were expressed in mRNA copies per microgram total RNA after normalization using 18S rRNA measurements. The intra-PCR coefficient of variation was less than 5%; the inter-PCR assay reached values from 8–20%, depending on the transcript level.

DNA methylation analysis, bisulfite modification, and methylation-specific PCR

Sodium bisulfite converts unmethylated cytosines to uraciles, whereas the methylated cytosines remain unmodified. In the resultant modified DNA, uraciles are replicated as thymines during PCR amplification. Methylation-specific primers have been designed to amplify a region in exon 1 of the SLC5A8 gene containing a CpG island (14). These primers are complementary either to a sequence containing several C residues (coming from methylated sequences) or to a sequence in which all the C residues have been replaced by T residues (coming from unmethylated sequences).

The sodium bisulfite reaction was carried out on 4 µg DNA (3 µg of unrelated plasmid DNA as a carrier and 1 µg of human genomic DNA). Alkali-denatured DNA was incubated in 3 M NaHSO3 and 5 mM hydroquinone for 16 h at 50 C. Modified DNA was purified using the Wizard DNA Clean-up System (Promega, Lyon, France) and eluted into 50 µl of sterile water. Modification was completed by 0.3 M NaOH, and DNA was purified and concentrated to a final volume of 20 µl using the MinElute Reaction Cleanup kit (Qiagen, Courtaboeuf, France). PCR amplifications were performed from 1-µl aliquots in a 50-µl reaction mixture containing 2 mM MgCl2, 200 µM of each of the four deoxyribonucleoside triphosphates, 0.35 µM of primers, and 1 U of HotStar Taq DNA polymerase from Qiagen. PCRs were carried out by using a hot start at 95 C for 15 min. Methylated sequences were amplified using the AS-meth-442-459s (5'-TCGAACGTATTTCGAGGC) and AS-meth-550as (5'-ACAACGAATCGATTTTCCG) primers (14). Unmethylated sequences were amplified using the AS-unmeth-442s (5'-TTGAATGTATTTTGAGGTG) and AS-unmeth-542as (5'-TCAATTTTCCAAAATCCC) primers (14). PCR parameters were: 35 or 42 cycles of 45 sec at 95 C, 45 sec at 56 C (methylated sequences) or 45 C (unmethylated sequences), and 45 sec at 72 C, followed by a period of 10 min at 72 C. The sizes of the PCR products for methylated and unmethylated SLC5A8 exon 1 CpG island were 108 and 100 bp, respectively. A human placenta DNA was used as a source of unmethylated DNA. A colon cancer cell line HCT116 DNA was used as a control for methylated DNA (14).

Detection of BRAF T1796A mutation

The thymine to adenine transversion at nucleotide 1796 of the BRAF gene was detected by two different methods. The first method, based on fluorescence melting curve analysis after amplification by real-time PCR using the LightCycler from Roche Molecular Biochemical (Mannheim, Germany), was adapted from Nikiforova et al. (22) to detect the mutation from cDNA. Amplification of BRAF cDNA from cDNAs synthesized using random hexamers (see section on reverse transcription, above) was performed using a pair of primers flanking the mutation site: 5'-CTTCATGAAGACCTCACAGTAAA-3' and 5'-TAATGGCAGAGTGCCTCA-3' (Invitrogen, Cergy-Pontoise, France). The mutation was detected by fluorescence resonance energy transfer using two fluorescent probes (sensor: 5'-AGCTACAGTGAAATCTCGATGGAG-fluorescein-3'; and anchor: 5'-LC Red 705-GGTCCCATCAGTTTGAACAGTTGTCTGGA-phosphate-3') (Proligo Inc., Paris, France), with the sensor probe spanning the nucleotide position 1796. Amplification was performed in a glass capillary using 5 µl cDNA corresponding to 25 ng retrotranscribed RNA in a 20-µl volume containing 2 µl 10x LightCycler DNA Master Hybridization probes [containing PCR buffer, deoxynucleotide triphosphates, 10 mM MgCl2, and Taq polymerase (Roche)], 2.4 µl 25 mM MgCl2, 10 pmol of each primer, and 2 pmol of each hybridization probe. PCR conditions included an initial denaturation at 95 C for 10 min followed by 45 cycles (each cycle consisting of denaturation at 95 C for 10 sec, annealing at 52 C for 20 sec, and extension at 72 C for 20 sec). After completion of the cycling process, samples were subjected to a gradual heating at a rate of 0.2 C/sec from 30–85 C, with continuous fluorescence monitoring for melting curve analysis. Tumor and paired NT cDNAs were amplified in parallel, each in duplicate. A tumor sample was considered as positive for the BRAF mutation when PCR products gave a melting temperature value lower than the lower limit of the 99% confidence interval established from NT melting temperature values.

The presence or absence of the BRAF mutation was confirmed by a real-time, allele-specific PCR method adapted from Jarry et al. (23) to detect the mutation from cDNA. Two forward primers with variations in their 3' nucleotides such that each was specific for the wild-type (W: AGGTGATTTTGGTCTAGCTACAGT) or the mutated variant (M: AGGTGATTTTGGTCTAGCTACAGA) and one reverse primer (AS: GATGACTTCTGGTGCCATCC) were used. The sequence-specific forward primer and the reverse primer were then combined in Primer mix W (primers W and AS) and Primer mix M (primers M and AS). PCR amplifications were performed on 5 µl of cDNA template (corresponding to 2.5 ng retrotranscribed RNA) using Fast start DNA Master Sybr Green I kit (Roche) and 3 mM MgCl2. The cycling conditions were as follows: denaturation for 10 min at 95 C; amplification for 35 cycles with denaturation at 95 C for 15 sec; annealing at 62 C for 5 sec; and extension at 72 C for 8 sec. After completion of the cycling process, samples were subjected to a temperature ramp from 60–95 C to obtain the fluorescence melting curves and control the specificity of the amplification. Samples giving amplification products with both W and M forward primers were BRAF mutation-positive samples.

Statistical methods

Comparison of transcript contents of tumors and paired NT samples was done by paired Student’s t test after logarithmic transformation of values (to obtain Gaussian distributions) and by the Wilcoxon nonparametric test using crude values. Association of SLC5A8, SLC26A4, or SLC5A5 transcript levels with age of patients, size, or staging of tumors was analyzed using the Mann-Whitney U test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The average SLC5A8 transcript content of normal human thyroid tissue (n = 10) was 0.40 (0.2–1.2) x 106 mRNA copies per microgram of total RNA (mean and 99% confidence limits of the mean in parentheses). Values of the same order of magnitude were found for the SLC5A5 transcript level: 0.80 (0.30–1.9) x 106 mRNA copies per micrograms of total RNA. SLC26A4 transcripts were more abundant: 7.1 (3.2–15.8) x 106 mRNA copies per micrograms of total RNA.

Regulation of SLC5A8, SLC26A4, and SLC5A5 expression by TSH in human thyrocytes in culture

Normal human thyrocytes were cultured without or with TSH for 3 d. The SLC5A8 transcript content of human thyrocytes cultured in the absence of TSH slightly increased (about 2-fold) compared with that of cells at the onset of culture (freshly isolated thyrocytes) (Fig. 2AGo). By contrast, SLC26A4 and SLC5A5 transcript levels markedly decreased, representing about 20% and less than 5% of the values measured on freshly isolated thyrocytes. The rapid shut-off of SLC5A5 expression, observed here in human thyrocytes, is a common characteristic of thyrocytes cultured in the absence of TSH (24, 25). Human thyrocytes cultured with or without TSH exhibited the same SLC5A8 transcript level. The TSH treatment partly prevented the decrease in SLC26A4 and SLC5A5 expression; after 3 d of culture, SLC26A4 and SLC5A5 transcripts levels were 3-fold and 20-fold higher in TSH-treated than in untreated cells, respectively. The TSH-induced activation of SLC5A5 gene transcription is a well-documented phenomenon (1). The activation of SLC26A4 expression by TSH has not yet been reported. A previous study using FRTL-5 cells (2) did not evidence any regulatory effect of TSH on this gene.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2. Differential regulation of SLC5A8, SLC26A4, and SLC5A5 expression in human thyrocytes. A, Changes in the level of expression of the three genes in response to TSH stimulation of normal human thyrocytes in primary culture. Freshly isolated thyrocytes (gray columns) and thyrocytes cultured without (white columns) or with 1 mU/ml TSH (black columns) for 3 d were assayed for their SLC5A8, SLC26A4, and SLC5A5 transcript contents. The ratios of transcript levels in TSH-treated and untreated cells (in parentheses) and P values are given in the upper part of the panel. B, SLC5A8, SLC26A4, and SLC5A5 transcript contents of TA (black columns) and paired adjacent resting tissues (white columns). The 95% confidence interval of the mean obtained for each transcript in normal (normoactive) thyroid tissue (n = 10) is indicated as a gray rectangle. The ratios of transcript levels in TA and adjacent resting tissue (in parentheses) and P values are given in the upper part of the panel. In both A and B, results are expressed in mRNA copy number per microgram RNA after normalization by 18S RNA and presented as logarithm values. Columns and vertical lines represent the mean and SEM of values from a representative experiment in A and from five paired samples in B. ns, No statistical difference.

 
SLC5A8 expression level in activated vs. resting thyroid tissues

We compared the SLC5A8, SLC26A4, and SLC5A5 transcript contents of TA and paired adjacent resting tissue samples. As shown in Fig. 2BGo, SLC5A8 transcript levels were similar in activated and resting thyroid tissues and within the range of values determined from 10 NT samples (obtained from patients with hypofunctioning benign or malignant tumors). In agreement with previous analyses performed at the protein level (7), the SLC26A4 transcript content of TA was within the range of values obtained in NT, whereas the SLC26A4 transcript content of resting thyroid tissue was significantly decreased. SLC5A5 transcript levels were high in TA and low in adjacent tissues. There was a 25-fold difference in SLC5A5 expression in activated vs. resting thyroid tissues.

SLC5A8 expression in hypofunctioning benign and malignant thyroid tumors

Data obtained from the 50 tumor/NT paired samples are reported in Fig. 3Go. The average SLC5A8 transcript level of FA, FTC, and PTC-fv was not different from that of paired NT. We observed a highly statistically significant 40-fold reduction of SLC5A8 expression in PTC-cf.: 7.9 x 103 vs. 3.2 x 105 mRNA copies per microgram RNA in paired NT (Fig. 3Go). These marked differences between subtypes of thyroid carcinomas probably explained the wide variations (two orders of magnitude) in SLC5A8 transcript content recently reported (24) for thyroid carcinomas considered as a single group of tumors. The SLC26A4 transcript level was not altered in FA and FTC compared with paired NT, but was reduced about 5-fold and 25-fold in PTC-fv and PTC-cf., respectively. The average transcript level of SLC5A5 was low in all types of thyroid carcinomas. The changes in the expression levels of SLC5A8, SLC26A4, or SLC5A5 were not related to age of patients, size, or staging of tumors.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 3. Alterations of SLC5A8 expression in hypofunctioning thyroid tumors. Comparison with SLC26A4 and SLC5A5. Transcripts were assayed from DNA-free RNA extracts prepared from 50 tumor/paired NT samples: 10 FA, 13 PTC-fv, 18 PTC-cf., and nine FTC. Transcript levels expressed in mRNA copy number per microgram total RNA are plotted as logarithm values. •, Tumors; {circ}, paired NT. Bars and vertical lines indicate the mean ± SEM of the values obtained for each group of samples, either tumors or NT. Shaded zones give the 95% confidence interval for NT transcript levels established from the values obtained from the 50 NT samples. (a) and (b) indicate a statistically significant difference between tumors and paired NT at P < 0.001 or P < 0.01, respectively. ns, No statistical difference.

 
The relative changes in the expression of the three genes according to the tumor type are presented in Fig. 4Go, where data are expressed in terms of tumor to NT ratios. None of the three genes was significantly altered in FA. By contrast, the three genes were markedly down-regulated in PTC-cf. FTC and PTC-fv were similarly characterized by a normal expression of SLC5A8, a moderate reduction of SLC26A4 expression, and a low expression of SLC5A5.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 4. SLC5A8 expression is selectively down-regulated in PTC-cf. Similarities in the gene expression profiles of FTC and PTC-fv. The ratios between transcript levels in tumors and paired NT (tumor to NT ratio) were calculated from values reported in Fig. 3Go. Columns and vertical bars represent the mean ± SEM; (a) and (b) indicate that the tumor/NT ratio for a given gene product in a given group of tumors is statistically different from the value of one at P < 0.001 or P < 0.05, respectively.

 
SLC5A8 is methylated with a high frequency in PTC-cf.

In light of the recent report showing that methylation is a probable mechanism for inactivating SLC5A8 in colon cancer (14), we investigated the methylation status of SLC5A8 in PTC. The study, which focused on a dense CpG island located in SLC5A8 exon 1, was conducted by methylation-specific PCR. The primers used led to the selective amplification of either the methylated or the unmethylated SLC5A8 templates. This is shown in Fig. 5AGo using DNA from HTC116 cell line (methylated form) and placenta DNA (unmethylated form) either alone or in various proportions from 10–90%. Methylation-specific PCR assay was performed on 10 of the 18 PTC-cf., six of the 13 PTC-fv, and four of the 10 FA, which were available in duplicate. After 38 PCR cycles, SLC5A8 methylation was observed in six of 10 PTC-cf. and in one of six PTC-fv (Fig. 5BGo). No SLC5A8 methylation was detected in the four FA. By increasing the level of amplification to 42 cycles, SLC5A8 methylation was observed in nine of the 10 PTC-cf. and in one of the six PTC-fv, whereas SLC5A8 methylation remained undetectable in the FA samples (Fig. 5CGo). These data indicate that SLC5A8 methylation is strongly associated with PTC-cf.



View larger version (81K):
[in this window]
[in a new window]
 
FIG. 5. Methylation status of SLC5A8 exon 1 CpG island in PTC. After bisulfite modification, a DNA segment of the SLC5A8 CpG island was amplified using specific primers for the methylated and unmethylated sequences. For each panel, 10 µl of the PCR mixture (total volume, 50 µl) was analyzed on a 2% agarose gel containing ethidium bromide. Panels denominated M-PCR (M) and UM-PCR (UM) present PCR products obtained using primers designed to amplify the methylated (M) sequences (108-bp band) or the unmethylated (UM) sequences (100 bp), respectively. A, Sensitivity of the amplification after bisulfite modification. DNA from the HTC116 cell line, used as a source of methylated SLC5A8, and DNA from placenta, used as a source of unmethylated SLC5A8, separately or mixed in various proportions from 10–90%, were submitted to sodium bisulfite treatment. The DNA segment containing the SLC5A8 CpG island was amplified (35 cycles) from a constant amount of DNA. B and C, PCR products obtained from thyroid tumor samples after 38 (B) or 42 (C) cycles of amplification. Lanes 1 and 18, Molecular mass markers; lane 2, human placenta DNA (unmethylated DNA); lane 3, HTC116 DNA (methylated DNA); lanes 4–7, FA; lanes 8–17, PTC-cf.; and lanes 19–24, PTC-fv.

 
The average SLC5A8 transcript level of SLC5A8-methylated tumors was 15 times lower than that of SLC5A8-unmethylated cases (Fig. 6Go). There were two main exceptions to the association between expression and methylation of SLC5A8. In the group of PTC-fv, one tumor with a normal SLC5A8 transcript level was found methylated, and, on the opposite, one PTC-cf. tumor exhibiting a low SLC5A8 expression level was unmethylated.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 6. Relationship between the methylation state of the SLC5A8 exon 1 CpG island and SLC5A8 expression. SLC5A8 transcript level is expressed in mRNA copy number per microgram RNA after logarithmic transformation. {triangleup}, FA (n = 4); {circ}, PTC-fv (n = 6); and •, PTC-cf. (n = 10). Bars and vertical lines give the mean ± SEM of the SLC5A8 transcript values obtained for unmethylated and methylated tumor samples. The shaded area gives the 95% confidence interval for NT SLC5A8 transcript level.

 
Relationship between down-regulation of SLC5A8 expression and the presence of BRAF T1796A mutation

Thirty-three of the 40 malignant tumors of the study for which cDNA was still available and 41 additional tumors (36 PTC-cf. and five anaplastic carcinomas) were analyzed for the presence of the mutation at nucleotide 1796 (T to A transversion) of the BRAF gene. The two methods used, fluorescence melting curve analysis of amplicons obtained by real-time PCR and mutant allele-specific PCR amplification, gave 100% concordant data. The BRAF T1796A mutation was detected in 36 of 52 PTC-cf. (69%), two of nine PTC-fv (22%), but in none of the eight FTC. Data of Fig. 7Go show that PTC-cf. with the BRAF mutation exhibited an average SLC5A8 transcript content 63-fold lower than the average value obtained for NT samples, whereas the average SLC5A8 transcript level of PTC-cf. with wild-type BRAF was only decreased 5-fold. Thus, there was a highly significant association between the presence of the BRAF T1796A mutation and a low level of expression of SLC5A8; noteworthy, the BRAF mutation was found in three of five anaplastic carcinomas, and tumors with the mutation exhibited a markedly reduced SLC5A8 expression compared to those without the mutation.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 7. Relationship between the presence of the BRAF T1796A mutation and SLC5A8 expression level. Seventy-four thyroid carcinomas (33 of the 40 malignant tumors of the study, plus 41 additional tumors including a series of 36 PTC-cf. and five anaplastic carcinomas) were analyzed for the presence of the BRAF T1796A mutation as described in Materials and Methods. SLC5A8 transcript level is expressed in mRNA copy number per microgram RNA after logarithmic transformation. {triangleup}, FTC (n = 8); {circ}, PTC-fv (n = 9); •, PTC-cf. (n = 52); {diamondsuit}, anaplastic carcinomas (n = 5). The shaded area gives the 95% confidence interval for NT SLC5A8 transcript level. Bars and vertical lines give the mean ± SEM of the SLC5A8 transcript values obtained for PTC-cf. without (BRAF-wt) or with the BRAF T1796A mutation. There was a highly statistically significant difference between SLC5A8 transcript levels in PTC-cf. without (BRAFwt) and PTC-cf. with the BRAF T1796A mutation (P value reported in the figure).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present study documents different aspects of the thyroid expression pattern of SLC5A8 proposed as the AIT encoding gene. We report that SLC5A8 expression is not regulated by TSH and is not related to the functional state of thyroid tissue; it was similar in activated (TA) and resting thyroid tissues (adjacent to TA) and in hypofunctioning benign or malignant thyroid tumors, with the remarkable exception of PTC-cf.

At present, it is not known whether SLC5A8 actually plays a role of iodide transporter in the thyroid. The recent reports demonstrating that SLC5A8 is a Na+/short-chain fatty acid (or monocarboxylate) cotransporter (15, 16) weaken this possibility. It seems very unlikely that the same membrane protein could exert another function in the thyroid. Furthermore, the AIT is expected to be a passive transporter (considering the iodide electrochemical gradient) and not a Na+-dependent symporter or secondary active ion transporter as SLC5A8 probably is. An indirect contribution of SLC5A8 to the thyroid cell to follicle lumen transport of iodide cannot be excluded.

Whatever its actual role in thyroid functioning, SLC5A8 might be involved in thyroid tumorogenesis. We have found that tumors histologically classified as PTC-cf. exhibited a reduced SLC5A8 expression; the average SLC5A8 transcript level in these tumors was 40 times lower than the average values obtained in paired NT. As in colon cancer, SLC5A8 silencing in PTC-cf. appears to be linked to the methylation of exon 1 of the gene. SLC5A8 methylation, which is an early epigenetic event in colon cancer (14), appearing in about 50% of aberrant crypt foci having the potential to progress to adenomas and carcinomas, probably occurs at a later stage in the thyroid. Furthermore, in the thyroid, methylation-associated silencing of SLC5A8 appears specific of a tumor type, indicating that this process could be secondary to another or other genetic alteration(s) occurring selectively in this tumor type.

The two other genes, SLC26A4 and SLC5A5, that are down-regulated to various degrees in thyroid cancers are also subjected to methylation (26, 27). SLC26A4 methylation was detected in all types of thyroid tumors: FA, FTC, PTC, and anaplastic carcinomas, with frequency ranging from 44–71% (26). As far as SLC5A5 is concerned, no specific methylation pattern could be associated with alterations of SLC5A5 expression in thyroid tumors (27). Taken together, these data indicate that each of the three genes, SLC5A8, SLC26A4, and SLC5A5, is independently altered by methylation in the course of thyroid tumorogenesis.

It is now recognized that the most frequent genetic alteration occurring in PTC is a mutation at nucleotide 1796 of the BRAF gene (22, 28, 29, 30, 31, 32, 33, 34), giving rise to an activated form of BRAF, BRAFV599E. This mutation was found in 29–69% of PTC, depending on the tumor series, but was never detected in FTC and benign tumors. More recent studies (35, 36, 37) identify a significantly higher prevalence of the mutation in PTC-cf. compared with PTC-fv, suggesting that PTC-cf. might be genetically different from PTC-fv and that BRAF mutations might drive the development of PTC-cf. In agreement with these data, we found a high prevalence (69%) of the BRAF T1796A mutation in PTC-cf. As was already reported (22, 34), some anaplastic carcinomas (three of five), probably deriving from PTC, harbored the BRAF T1796A mutation. Thus, in our tumor series, SLC5A8 silencing and BRAF mutation discriminate PTC-cf. from other thyroid carcinomas with a rather equal efficiency. This suggests a link between the two events; this is supported by the strong association between the presence of the BRAF mutation and a low level of expression of SLC5A8 (Fig. 7Go). Thus, it is tempting to postulate that the methylation-associated silencing of SLC5A8 might be secondary to the constitutive activation of the MAPK pathway, resulting from the BRAFV599E activating mutation.

The functional importance of the constitutive activation of the MAPK pathway in thyroid oncogenic transformation is still unknown. However, there is compelling evidence (38) for the involvement of this signal transduction pathway in tumorogenesis; in numerous cell types, activation of the MAPK pathway leads to a loss of expression of differentiated functions, to an increase in proliferation, and to a decrease in apoptosis. If SLC5A8 has a tumor suppressor function in thyroid epithelial cells as demonstrated in epithelial cells of colon, its silencing in thyroid might be a determinant of the evolution or progression of PTC-cf. A more complete interpretation of our findings will be possible when the actual function of SLC5A8 in the thyroid is elucidated.


    Acknowledgments
 
We thank the organizing and supervision committees of the Lyon Thyroid Tumor Bank for their contributions to this study and C. Limoge for her contribution in the preparation of the manuscript.


    Footnotes
 
First Published Online February 1, 2005

1 V.P. and C.F.-P. should be considered first coauthors. Back

Abbreviations: AIT, Apical iodide transporter; CpG, cytidine-phospho-guanosine; FA, follicular adenomas; FTC, follicular thyroid carcinomas; NT, normal tissue; PTC, papillary thyroid carcinomas; PTC-cf., PTC of classical form; PTC-fv, follicular variant of PTC; RT, reverse transcription; TA, toxic adenomas.

Received July 16, 2004.

Accepted January 21, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Dohan O, De la Vieja A, Paroder V, Riedel C, Artani M, Reed M, Ginter CS, Carrasco N 2003 The sodium/iodide symporter (NIS): characterization, regulation, and medical significance. Endocr Rev 24:48–77[Abstract/Free Full Text]
  2. Royaux IE, Suzuki K, Mori A, Katoh R, Everett LA, Kohn LD, Green ED 2000 Pendrin, the protein encoded by the Pendred Syndrome Gene (PDS), is an apical porter of iodide in the thyroid and is regulated by thyroglobulin in FRTL-5 cells. Endocrinology 141:839–845[Abstract/Free Full Text]
  3. Rodriguez AM, Perron B, Lacroix L, Caillou B, Leblanc G, Schlumberger M, Bidart JM, Pourcher T 2002 Identification and characterization of a putative human iodide transporter located at the apical membranes of thyrocytes. J Clin Endocrinol Metab 87:3500–3503[Abstract/Free Full Text]
  4. Everett LA, Glaser B, Beck JC, Idol JR, Buchs A, Heyman M, Adawi F, Hazani E, Nassir E, Baxevanis AD, Sheffield VC, Green ED 1997 Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nat Genet 17:411–422[CrossRef][Medline]
  5. Everett LA, Morsli H, Wu DK, Green ED 1999 Expression pattern of the mouse ortholog of the Pendred’s syndrome gene (Pds) suggests a key role for pendrin in the inner ear. Proc Natl Acad Sci USA 96:9727–9732[Abstract/Free Full Text]
  6. Bidart JM, Mian C, Lazar V, Russo D, Filetti S, Caillou B, Schlumberger M 2002 Expression of pendrin and the pendred syndrome (PDS) gene in human thyroid tissues. J Clin Endocrinol Metab 85:2028–2033
  7. Scott DA, Karniski LP 2000 Human pendrin expressed in Xenopus laevis oocytes mediates chloride/formate exchange. Am J Physiol Cell Physiol 278:207–211
  8. Soleimani M, Greeley T, Petrovic S, Wang Z, Amlal H, Kopp P, Burnham CE 2001 Pendrin: an apical Cl-/OH-/HCO3- exchanger in the kidney cortex. Am J Physiol Renal Physiol 280:356–364
  9. Porra V, Bernier-Valentin F, Trouttet-Masson S, Berger-Dutrieux N, Peix JL, Perrin A, Selmi-Ruby S, Rousset B 2002 Characterization and semi-quantitative analyses of pendrin expressed in normal and tumoral human thyroid tissues. J Clin Endocrinol Metab 87:1700–1707[Abstract/Free Full Text]
  10. Scott DA, Wang R, Kreman TM, Sheffield VC, Karniski LP 1999 The Pendred syndrome gene encodes a chloride-iodide transport protein. Nat Genet 21:440–443[CrossRef][Medline]
  11. Yoshida A, Taniguchi S, Hisatome I, Royaux IE, Green ED, Kohn LD, Suzuki K 2002 Pendrin is an iodide-specific apical porter responsible for iodide efflux from thyroid cells. J Clin Endocrinol Metab 87:3356–3361[Abstract/Free Full Text]
  12. Gillam MP, Sidhaye AR, Lee EJ, Rutishauser J, Stephan CW, Kopp P 2004 Functional characterization of pendrin in a polarized cell system. J Biol Chem 26:13004–13010
  13. Lacroix L, Pourcher T, Magnon C, Bellon N, Talbot M, Intaraphairot T, Caillou B, Schlumberger M, Bidart JM 2004 Expression of the apical iodide transporter in human thyroid tissues: a comparison study with other iodide transporters. J Clin Endocrinol Metab 89:1423–1428[Abstract/Free Full Text]
  14. Li H, Myeroff L, Smiraglia D, Romero MF, Pretlow TP, Kasturi L, Lutterbaugh J, Rerko RM, Casey G, Issa JP, Willis J, Willson JK, Plass C, Markowitz SD 2003 SLC5A8, a sodium transporter, is a tumor suppressor gene silenced by methylation in human colon aberrant crypt foci and cancers. Proc Natl Acad Sci USA 100:8412–8417[Abstract/Free Full Text]
  15. Miyauchi S, Gopal E, Fei YJ, Ganapathy V 2004 Functional identification of SLC5A8, a tumor suppressor down-regulated in colon cancer, as a Na+-coupled transporter for short-chain fatty acids. J Biol Chem 279:13293–13296[Abstract/Free Full Text]
  16. Coady MJ, Chang MW, Charron FM, Plata C, Wallendorff B, Sah JF, Markowitz SD, Romero MF, Lapointe JY 2004 The human tumor suppressor gene SLC5A8 expresses a Na+/monocarboxylate cotransporter. J Physiol 557:719–731[Abstract/Free Full Text]
  17. Parma J, Duprez L, Van Sande J, Hermans J, Rocmans P, Van Vliet G, Costagliola S, Rodien P, Dumont JE, Vassart G 1997 Diversity and prevalence of somatic mutations in the thyrotropin receptor and Gs {alpha} genes as a cause of toxic thyroid adenomas. J Clin Endocrinol Metab 82:2695–2701[Abstract/Free Full Text]
  18. Tonacchera M, Chiovato L, Pinchera A, Agretti P, Fiore E, Cetani F, Rocchi R, Viacava P, Miccoli P, Vitti P 1998 Hyperfunctioning thyroid nodules in toxic multinodular goiter share activating thyrotropin receptor mutations with solitary toxic adenoma. J Clin Endocrinol Metab 83:492–498[Abstract/Free Full Text]
  19. Trouttet-Masson S, Selmi-Ruby S, Bernier-Valentin F, Porra V, Berger-Dutrieux N, Decaussin M, Peix JL, Perrin A, Bournaud C, Orgiazzi J, Borson-Chazot F, Franc B, Rousset B 2004 Evidence for transcriptional and posttranscriptional alterations of the sodium/iodide symporter expression in hypofunctioning benign and malignant thyroid tumors. Am J Pathol 165:25–34[Abstract/Free Full Text]
  20. De Lellis RA, Lloyd RV, Heitz PU, Eng C 2004 WHO classification of tumors. Pathology and genetics of tumors of endocrine organs. Lyon, France: IARC Press
  21. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  22. Nikiforova MN, Kimura ET, Gandhi M, Biddinger PW, Knauf JA, Basolo F, Zhu Z, Giannini R, Salvatore G, Fusco A, Santoro M, Fagin JA, Nikiforov YE 2003 BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. J Clin Endocrinol Metab 88:5399–5404[Abstract/Free Full Text]
  23. Jarry A, Masson D, Cassagnau E, Parois S, Laboisse C, Denis MG 2004 Real-time allele-specific amplification for sensitive detection of the BRAF mutation V600E. Mol Cell Probes 18:349–352[CrossRef][Medline]
  24. Paire A, Bernier-Valentin F, Selmi-Ruby S, Rousset B 1997 Characterization of the rat thyroid iodide transporter using anti-peptide antibodies. Relationship between its expression and activity. J Biol Chem 272:18245–18249[Abstract/Free Full Text]
  25. Selmi-Ruby S, Watrin C, Trouttet-Masson S, Bernier-Valentin F, Flachon V, Munari-Silem Y, Rousset B 2003 The porcine sodium/iodide symporter gene exhibits an uncommon expression pattern related to the use of alternative splice sites not present in the human or murine species. Endocrinology 144:1074–1085[Abstract/Free Full Text]
  26. Xing M, Tokumaru Y, Wu G, Westra WB, Ladenson PW, Sidransky D 2003 Hypermethylation of the Pendred syndrome gene SLC26A4 is an early event in thyroid tumorigenesis. Cancer Res 63:2312–2315[Abstract/Free Full Text]
  27. Venkataraman GM, Yatin M, Macinek R, Ain KB 1999 Restoration of iodide uptake in dedifferentiated thyroid carcinoma: relationship to human Na+/I symporter gene methylation status. J Clin Endocrinol Metab 84:2449–2457[Abstract/Free Full Text]
  28. Cohen Y, Xing M, Mambo E, Guo Z, Wu G, Trink B, Beller U, Westra WH, Ladenson PW, Sidransky D 2003 BRAF mutations in papillary thyroid carcinoma. J Natl Cancer Inst 95:625–627[Abstract/Free Full Text]
  29. Kimura ET, Nikiforova MN, Zhu Z, Knauf, JA, Nikiforov YE, Fagin JA 2003 High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res 63:1454–1457[Abstract/Free Full Text]
  30. Soares P, Trovisco V, Rocha AS, Lima J, Castro P, Preto A, Maximo V, Botelho T, Seruca R, Sobrinho-Simoes M 2003 BRAF mutations and RET/PTC rearrangements are alternative events in the etiopathogenesis of PTC. Oncogene 22:4578–4580[CrossRef][Medline]
  31. Xu X, Quiros RM, Gattuso P, Ain KB, Prinz RA 2003 High prevalence of BRAF gene mutation in papillary thyroid carcinomas and thyroid tumor cell lines. Cancer Res 63:4561–4567[Abstract/Free Full Text]
  32. Namba H, Nakashima M, Hayashi T, Hayashida N, Maeda S, Rogounovitch TI, Ohtsuru A, Saenko VA, Kanematsu T, Yamashita S 2003 Clinical implication of hot spot BRAF mutation, V599E, in papillary thyroid cancers. J Clin Endocrinol Metab 88:4393–4397[Abstract/Free Full Text]
  33. Fukushima T, Suzuki S, Mashito M, Ohtake T, Endo Y, Takebayashi Y, Sekikawa K, Hagiwara K, Takenoshita S 2003 BRAF mutations in papillary carcinomas of the thyroid. Oncogene 22:6455–6457[CrossRef][Medline]
  34. Xing M, Vasko V, Tallini G, Larin A, Wu G, Udelsman R, Ringel MD, Ladenson PW, Sidransky D 2004 BRAF T1796A transversion mutation in various thyroid neoplasms. J Clin Endocrinol Metab 89:1365–1368[Abstract/Free Full Text]
  35. Trovisco V, Vieira de Castro I, Soares P, Maximo V, Silva P, Magalhaes J, Abrosimov A, Guiu XM, Sobrinho-Simoes M 2004 BRAF mutations are associated with some histological types of papillary thyroid carcinoma. J Pathol 202:247–251[CrossRef][Medline]
  36. Puxeddu E, Moretti S, Elisei R, Romei C, Pascucci R, Martinelli M, Marino C, Avenia N, Rossi ED, Fadda G, Cavaliere A, Ribacchi R, Falorni A, Pontecorvi A, Pacini F, Pinchera A, Santeusanio F 2004 BRAF (V599E) mutation is the leading genetic event in adult sporadic papillary thyroid carcinomas. J Clin Endocrinol Metab 89:2414–2420[Abstract/Free Full Text]
  37. Fugazzola L, Mannavola D, Cirello V, Vannucchi G, Muzza M, Vicentini L, Beck-Peccoz P 2004 BRAF mutations in an Italian cohort of thyroid cancers. Clin Endocrinol (Oxf) 61:239–243[CrossRef][Medline]
  38. Reddy KB, Nabha SM, Atanaskova N 2003 Role of MAP kinase in tumor progression and invasion. Cancer Metastasis Rev 22:395–403[CrossRef][Medline]



This article has been cited by other articles:


Home page
Endocr Relat CancerHome page
S. Durand, C. Ferraro-Peyret, M. Joufre, A. Chave, F. Borson-Chazot, S. Selmi-Ruby, and B. Rousset
Molecular characteristics of papillary thyroid carcinomas without BRAF mutation or RET/PTC rearrangement: relationship with clinico-pathological features
Endocr. Relat. Cancer, June 1, 2009; 16(2): 467 - 481.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Frank, N. Groger, M. Diener, C. Becker, T. Braun, and T. Boettger
Lactaturia and Loss of Sodium-dependent Lactate Uptake in the Colon of SLC5A8-deficient Mice
J. Biol. Chem., September 5, 2008; 283(36): 24729 - 24737.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. P. Whitman, B. Hackanson, S. Liyanarachchi, S. Liu, L. J. Rush, K. Maharry, D. Margeson, R. Davuluri, J. Wen, T. Witte, et al.
DNA hypermethylation and epigenetic silencing of the tumor suppressor gene, SLC5A8, in acute myeloid leukemia with the MLL partial tandem duplication
Blood, September 1, 2008; 112(5): 2013 - 2016.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Durand, C. Ferraro-Peyret, S. Selmi-Ruby, C. Paulin, M. El Atifi, F. Berger, N. Berger-Dutrieux, M. Decaussin, J.-L. Peix, C. Bournaud, et al.
Evaluation of Gene Expression Profiles in Thyroid Nodule Biopsy Material to Diagnose Thyroid Cancer
J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1195 - 1202.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. Xing
BRAF Mutation in Papillary Thyroid Cancer: Pathogenic Role, Molecular Bases, and Clinical Implications
Endocr. Rev., December 1, 2007; 28(7): 742 - 762.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Durante, E. Puxeddu, E. Ferretti, R. Morisi, S. Moretti, R. Bruno, F. Barbi, N. Avenia, A. Scipioni, A. Verrienti, et al.
BRAF Mutations in Papillary Thyroid Carcinomas Inhibit Genes Involved in Iodine Metabolism
J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2840 - 2843.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Plata, C. R. Sussman, A. Sindic, J. O. Liang, D. B. Mount, Z. M. Josephs, M.-H. Chang, and M. F. Romero
Zebrafish Slc5a12 Encodes an Electroneutral Sodium Monocarboxylate Transporter (SMCTn): A COMPARISON WITH THE ELECTROGENIC SMCT (SMCTe/Slc5a8)
J. Biol. Chem., April 20, 2007; 282(16): 11996 - 12009.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Xing
Gene Methylation in Thyroid Tumorigenesis
Endocrinology, March 1, 2007; 148(3): 948 - 953.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Liu, S. Hu, P. Hou, D. Jiang, S. Condouris, and M. Xing
Suppression of BRAF/MEK/MAP Kinase Pathway Restores Expression of Iodide-Metabolizing Genes in Thyroid Cells Expressing the V600E BRAF Mutant
Clin. Cancer Res., February 15, 2007; 13(4): 1341 - 1349.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
T Kogai, K Taki, and G A Brent
Enhancement of sodium/iodide symporter expression in thyroid and breast cancer.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 797 - 826.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
L Fugazzola, E Puxeddu, N Avenia, C Romei, V Cirello, A Cavaliere, P Faviana, D Mannavola, S Moretti, S Rossi, et al.
Correlation between B-RAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: data from a multicentric Italian study and review of the literature.
Endocr. Relat. Cancer, June 1, 2006; 13(2): 455 - 464.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Bernier-Valentin, S. Trouttet-Masson, R. Rabilloud, S. Selmi-Ruby, and B. Rousset
Three-Dimensional Organization of Thyroid Cells into Follicle Structures Is a Pivotal Factor in the Control of Sodium/Iodide Symporter Expression
Endocrinology, April 1, 2006; 147(4): 2035 - 2042.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M.-F. van den Hove, K. Croizet-Berger, F. Jouret, S. E. Guggino, W. B. Guggino, O. Devuyst, and P. J. Courtoy
The Loss of the Chloride Channel, ClC-5, Delays Apical Iodide Efflux and Induces a Euthyroid Goiter in the Mouse Thyroid Gland
Endocrinology, March 1, 2006; 147(3): 1287 - 1296.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Xing, W. H. Westra, R. P. Tufano, Y. Cohen, E. Rosenbaum, K. J. Rhoden, K. A. Carson, V. Vasko, A. Larin, G. Tallini, et al.
BRAF Mutation Predicts a Poorer Clinical Prognosis for Papillary Thyroid Cancer
J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6373 - 6379.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Bruno, E. Ferretti, E. Tosi, F. Arturi, P. Giannasio, T. Mattei, A. Scipioni, I. Presta, R. Morisi, A. Gulino, et al.
Modulation of Thyroid-Specific Gene Expression in Normal and Nodular Human Thyroid Tissues from Adults: An in Vivo Effect of Thyrotropin
J. Clin. Endocrinol. Metab., October 1, 2005; 90(10): 5692 - 5697.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Porra, V.
Right arrow Articles by Rousset, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Porra, V.
Right arrow Articles by Rousset, B.
Right arrowPubmed/NCBI databases
*OMIM
*Genetics Home Reference
Medline Plus Health Information
*Thyroid Cancer
Related Collections
Right arrow Thyroid
Right arrow Endocrine Oncology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals