| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Endocrinology (F.M.S., A.B.G., J.P.M., A.J.L.C.), William Harvey Research Institute, Barts & the London, Queen Mary University of London, London EC1A 7BE, United Kingdom; Department of Endocrinology (S.A.), Kings College Hospital, London, United Kingdom; Department of Clinical Biochemistry (L.P.), Barts & The London NHS Trust; and Haartman Institute of Pathology (J.A.), University of Helsinki, Finland
Address all correspondence and requests for reprints to: Professor A. J. L. Clark, Department of Endocrinology, St. Bartholomews Hospital, London EC1A 7BE, United Kingdom. E-mail: a.j.clark{at}qmul.ac.uk.
| Abstract |
|---|
|
|
|---|
Objective: We have investigated whether chronic ACTH stimulation or activation of the ACTH signaling pathway might be associated with GIP receptor (GIPR) expression.
Design: RT-PCR analysis and primary culture of hyperplastic adrenals.
Patients: All patients presented with CS: 20 unilateral adrenal adenomas, five Cushings disease, one food-dependent CS.
Results: RT-PCR revealed GIPR expression in all hyperplastic adrenals studied. No RT-PCR product could be detected in two normal adrenals or 20 hyperfunctioning adrenal adenomas. Primary culture revealed a significant cAMP response to ACTH in all adrenals available for study (EC50, 8.1 x 1010 M in normals, 4.7 x 1010 M in Cushings disease, and 4.4 x 1010 M in food-dependent disease). However, cultures taken from all four ACTH-dependent and the one food-dependent hyperplastic adrenals studied were also responsive to GIP (EC50 for cAMP, 1.3 x 109 M in Cushings disease and 4.1 x 1010 M in food-dependent disease).
Fasting cortisol levels were low in the case of food-dependant Cushings, rising postprandially as predicted. However, there was no trend toward low fasting or high postprandial cortisol in the other cases, suggesting that the presence of detectable GIPR alone, albeit with definite function in vitro, is not sufficient to cause clinically food-dependent CS.
Conclusions: These data are consistent with the hypothesis that chronic ACTH stimulation or constitutive activation of the ACTH signaling pathway may be associated with aberrant GIPR expression, and suggest one mechanism for the pathogenesis of this phenomenon.
| Introduction |
|---|
|
|
|---|
-subunit of Gs protein may be associated with macronodular adrenal hyperplasia (3). In Carney complex, inactivating mutations of the R1
subunit of protein kinase A may be associated with primary pigmented nodular adrenal hyperplasia and Cushings syndrome (4, 5), and these have also been described in rare sporadic cases (6). Furthermore we have also recently described an ACTH receptor mutation leading to apparent constitutive activity in a patient with bilateral adrenal hyperplasia and Cushings syndrome (7). However, a number of sporadic and familial cases of adrenal Cushings syndrome have been attributed to expression of hormone receptors other than the ACTH receptor, leading to cAMP accumulation and cortisol release (8, 9, 10, 11). This syndrome, often associated with ACTH-independent bilateral macronodular adrenal hyperplasia (AIMAH) but sometimes with a unilateral adenoma, has been most frequently associated with the aberrant expression of receptors for gastric inhibitory peptide (GIP) (12, 13, 14, 15, 16). GIP rises postprandially, which results in inappropriate postprandial cortisol release in the syndrome of food-dependent Cushings syndrome. However, alternative receptors, for example for catecholamines, LH/human chorionic gonadotropin, vasopressin, or serotonin may also be inappropriately expressed (8, 17, 18, 19). Frequently, two or more receptors are aberrantly expressed in the same adrenal (20, 21). There is no mechanistic explanation for the origins of this phenomenon. Mutation of the GIP receptor (GIPR) promoter has been proposed to account for some of these cases (8, 14). In AIMAH, the initial event could occur as a somatic mutation during early embryonic life in sporadic cases (as in McCune-Albright) or as a germline mutation in familial AIMAH. However, no mutations of this gene or its regulatory regions have yet been reported, and this hypothesis fails to explain the expression of more than a single receptor type in these tumors (22).
An alternative to this hypothesis is that an inherited or acquired mutation activates the expression of a factor that might influence either the level of expression or the function of several receptors. Conceivably, a transcription factor might fulfill such a role, although an example of such a factor is not immediately apparent. Alternatively, a factor that influenced the function of a group of receptors such as a signal transduction molecule or a desensitization molecule might provide a unifying explanation. We recently demonstrated that a non-desensitizing ACTH receptor (resulting from a missense mutation) was associated with Cushings syndrome (7). One of the aims of this study was therefore to determine whether the receptors for ACTH and GIP desensitized normally in AIMAH-associated food-dependent Cushings syndrome.
A third hypothesis is that the GIPR and/or other receptors may be normally expressed in the adrenal cortex, either at very low levels in all cells or in a subpopulation of cells. A mitogenic event in such a cell might result in development of an adrenal tumor expressing these receptors, which, by responding to physiological concentrations of circulating agonists with a mitogenic signal, would further enhance growth of the tumor, although this would not explain bilateral AIMAH. In support of this, very low levels of GIPR expression have been demonstrated in the normal adrenal cortex when RT-PCR is used in conjunction with Southern blotting (14, 23, 24).
A final possibility is that stimulation of adrenal cells by one agonist may stimulate the expression of one or more other receptors or alternatively may stimulate proliferation of a subpopulation of cells expressing these other receptors. One candidate agonist for such an effect is ACTH. Accordingly, we have investigated whether adrenal hyperplasia associated with chronic ACTH stimulation in Cushings disease might induce expression of GIPR or other receptors in primary cultures of adrenal tissue.
| Patients and Methods |
|---|
|
|
|---|
Clinical details of patients are summarized in Table 1
. Patient 1 was a 75-yr-old female who presented with malaise, diabetes mellitus, centripetal adiposity, and proximal myopathy. Serum cortisol was elevated and failed to suppress after low-dose (0.5 mg 6-hourly for 48 h) and high-dose (2 mg 6-hourly for 48 h) dexamethasone suppression testing (662 nmol/liter and 559 nmol/liter, respectively). Plasma ACTH was low but measurable (811 ng/liter). Abdominal computerized tomography scan revealed bilateral adrenal masses, and biopsy revealed adrenocortical hyperplasia. Pituitary imaging was unremarkable, and inferior petrosal sinus sampling revealed a central to peripheral gradient after CRH but with no lateralization. The patient underwent transsphenoidal surgery. However, hypercortisolemia persisted, and no adenoma was identified histologically. Variability in 0900 h serum cortisol values was noted (232695 nmol/liter), and sequential salivary and urinary samples were then examined for evidence of cyclicity. The 0900 h salivary cortisol values were low/normal (mean, 12.7 nmol/liter) with higher levels at 2200 h (mean, 16.0 nmol/liter; P = 0.096). Timed urine free cortisol measurements (sequential 3-h measurements over 24 h, repeated on three occasions) indicated a progressive daytime rise in cortisol production from 14 nmol/h (06000900 h) to 25 nmol/h (12001500 h), with peak levels of 28 nmol/liter recorded between 2100 and 2400 h. Food-dependent Cushings was thus suspected, and serum cortisol rose from 197 to 704 nmol/liter after a test meal. This rise was greater than that to CRH (peak, 414 nmol/liter), 1 mg synthetic ACTH (peak, 647 nmol/liter), or fasting (278 nmol/liter), as summarized in Fig. 1
.
|
|
|
One of the patients with Cushings disease (patient 2) appeared to have an adrenal adenoma at diagnosis, with a 2 x 3-cm left sided adrenal mass on imaging, low ACTH, equivocal pituitary imaging, and no response to a CRH test. She therefore underwent unilateral adrenalectomy shortly after presentation. Histology revealed an adenomatous nodule within diffuse adrenocortical hyperplasia, and postoperatively she remained hypercortisolemic. Investigations after adrenalectomy were consistent with cyclical Cushings disease. Because of the cyclical nature of her condition, she has not yet undergone additional invasive treatment.
Histology revealed diffuse adrenocortical hyperplasia in all other cases of Cushings disease, with an adrenal adenoma also present in patient 5.
The patient with Carney complex (patient 7) presented with Cushings syndrome and spotty skin pigmentation. She had normal pituitary imaging, undetectable serum ACTH, and no response to a CRH test and thus underwent bilateral adrenalectomy to achieve cure of her Cushings syndrome. Histology confirmed nodular cortical hyperplasia with atrophy of intervening adrenocortical tissue. The control samples (patients 8 and 9) were resected during nephrectomy for renal cell carcinoma and were normal on histological examination.
Tissue collection and culture
All samples were obtained after informed consent of the patient and prior local ethical committee approval. All adrenal tissue samples, other than the control samples, were removed during elective adrenalectomy, which was performed as treatment for Cushings syndrome. Tissues were collected during surgery, and the cortices were dissected from surrounding tissue and immediately either snap frozen in liquid nitrogen and stored at 70 C for RT-PCR at a later date or placed in cell culture medium (DMEM/F10; 1/1 medium supplemented with 10% fetal calf serum, 10% horse serum, and 1% penicillin/streptomycin) at 37 C for primary culture within an hour of surgery. Samples were macerated before collagenase digestion and incubation at 37 C for 60 min and then vigorously aerated and filtered through fine muslin before being centrifuged at 1100 rpm for 10 min and resuspended in medium (method adapted from Ref. 25). Cells were counted using trypan blue cytometry and plated in six-well plates at a concentration of 5 x 105 per well. After 24 h incubation, cells were washed and incubated for 60 min in serum-free medium before stimulation.
To assess steroid production, cells were exposed to agonist made up in serum-free medium for 3 h at 37 C before immediate freezing at 20 C until specific RIA was performed for cortisol. Agonists used were GIP (108 M), ACTH (108 M), forskolin (105 M), glucagon-like peptide-1 (GLP1) (107 M), leptin (107 M), 5-hydroxytryptophan (5HT) (105 M), vasoactive intestinal peptide (VIP) (107 M), pituitary adenylate cyclase-activating polypeptide (107 M), isoproterenol (105 M), LH (108 M), and arginine vasopressin (AVP) (108 M). Each stimulation was performed in triplicate.
To assess cAMP production, cells were exposed to increasing doses of GIP and ACTH (1012 to 106 M) for 30 min at 37 C in the presence of 1 mM isobutyl methylxanthine (IBMX) to inhibit phosphodiesterase-mediated breakdown of cAMP. cAMP was then assayed and measured using a competitive binding assay (26). To assess the desensitization of these responses, cells were first incubated with 108 M ACTH or GIP for a varying time interval (060 min) in the absence of IBMX, washed, and then exposed to a second fixed time period of stimulation in the presence of IBMX as previously described (27). cAMP production was then expressed as a percentage of maximal cAMP accumulation from a single 30-min stimulation with that ligand. All cAMP experiments were performed in duplicate.
GIPR expression study
Total RNA was extracted from adrenal tissue using the QIAGEN RNeasy kit (Crawley, UK). RT was performed using Moloney murine leukemia virus reverse transcriptase using random hexamers to prime the reaction. cDNAs thus obtained were then amplified by PCR using primers specific for the GIPR (35 cycles at 94 C for 30 sec, 66 C for 30 sec, and 72 C for 30 sec): sense, CCTGATCGCCCCTGCACGAAC; antisense, AGGTCGAGGTAGCAGACGGTCTCG (28). cDNA from the human CaCo cell line was used as a positive control. Control reactions were also performed using primers to GAPDH (sense, TCCCATCACCATCTTCCA; antisense, GTCCACCACCCTGTTGCT). PCR fragments were then identified by 1% agarose gel electrophoresis.
Statistical analysis
All data are given as mean ± SEM unless stated otherwise. All data were analyzed using Graphpad Prism software. Variable-slope sigmoidal dose-response curves were used to analyze the cAMP dose-response data and to generate EC50 values. Unpaired, two-tailed Students t tests were performed to compare basal with stimulated cortisol production for each adrenal primary culture.
| Results |
|---|
|
|
|---|
The clinical characteristics of all patients studied are summarized in Table 1
. Patient 1 had food-dependent Cushings syndrome, with repeated low fasting cortisol levels and a clear increase in postprandial serum cortisol. This patient was then further characterized for cortisol responses to ACTH and CRH, as shown in Fig. 1
, although because there was no clinical suspicion of other ectopic receptors, clinical evidence of these was not sought. For all other cases of ACTH-dependent and -independent adrenal hyperplasia, there was no significant increase between fasting and 2-h postprandial serum cortisol values.
GIPR expression
Two PCR products of similar size, 634 and 527 base pairs, were observed in the positive control cDNA (CaCo cell line), adrenal tissue taken from the patient with food-dependent Cushings syndrome (patient 1), five patients with ACTH-dependent Cushings disease (patients 26), and a patient with Carney complex (patient 7). No GIPR expression was detectable in cDNA derived from either the two normal adrenals (Fig. 2
) or the 20 adrenal adenomas (data not shown).
|
All samples of adrenal hyperplasia available for primary culture (patients 15) and the two normal adrenals showed a clear dose-response curve to ACTH with a similar EC50: 4.7 x 1010 M in Cushings disease, 4.4 x 1010 M in food-dependent disease, and 4.3 x 1010 M and 1.3 x 109 M in the two normal adrenals (Fig. 3A
). The magnitude of the response was smaller in patient 1 (rising from 141.1 to 355.3 pmol cAMP/mg protein) than in patients 25 (146.1 ± 25.4 to 741.5 ± 66.6 pmol cAMP/mg protein, mean ± SEM) or the two normal subjects (159 to 699 and 83 to 625 pmol cAMP/mg protein).
|
In the second group of experiments, cells were exposed to a fixed-dose stimulation with GIP, ACTH, forskolin, GLP1, leptin, 5HT, VIP, PACAP, isoproterenol, LH, and AVP, and cortisol responses were measured. In all cases of adrenal hyperplasia available for study, a marked response to forskolin, ACTH, and GIP was observed (Fig. 4
). Furthermore, patients 1 and 2 also showed a significant cortisol response to AVP [patient 1, 173.7 ± 11.6 nmol/liter compared with basal, 113.7 ± 4.9 (P < 0.01); patient 2, 647.5 ± 44.5 nmol/liter compared with basal, 213.7 ± 70.2 nmol/liter (P < 0.0001)]. No other ligands produced statistically significant responses. Unfortunately, there were insufficient cells from cases 8 and 9 (the normal adrenals) and cases 4 and 5 (both Cushings disease adrenals) to perform this set of experiments.
|
| Discussion |
|---|
|
|
|---|
Interestingly, the patient with clinical food-dependent Cushings syndrome in this series had detectable ACTH levels and mounted a cortisol response to CRH in vivo. This lack of suppression of pituitary ACTH and responsiveness to CRH has previously been reported in at least two other cases of food-dependent Cushings syndrome, and perhaps indicates that the intermittent nature of food-induced cortisol secretion does not always result in complete suppression of the hypothalamic-pituitary-adrenal axis (16, 24). In the first case, CRH had no significant effect on cortisol production in vitro, suggesting that the in vivo CRH response is mediated through ACTH (24). ACTH levels are thus not fully suppressed, and the continued expression of the ACTH receptor in the hyperplastic adrenal is responsible for the CRH response, whereas the high level of expression of the GIPR is responsible for the predominant clinical phenotype.
Clear evidence of the expression of the GIPR transcript was found by RT-PCR, in the case of food-dependent Cushings syndrome (patient 1), the five patients with Cushings disease (patients 26), and the patient with Carney complex (patient 7). The two normal adrenal samples and all 20 adrenal adenomas were negative for the GIPR cDNA as detected by ethidium bromide staining. It is conceivable that if we had used an even more sensitive detection method in the form of Southern blotting of RT-PCR products, a signal may have been detectable, although the significance of this, in comparison with the readily detectable signals in the hyperplastic adrenals, is questionable (23). Another group has recently published work confirming the expression of the GIPR mRNA in AIMAH not associated with food-dependent disease. Expression of the GIPR was found in four of eight cases of AIMAH associated with subclinical ACTH-independent Cushings syndrome as well as in one of 16 adrenal adenomas (28). The LH receptor was also aberrantly expressed in two of these cases, as well as the ectopic V2 receptor in one case and the ectopic 5HT7 receptor in two of these cases (21). The relative contributions of these ectopic receptors as well as the eutopic V1 receptor in one case are difficult to decipher. It is possible that such receptors may indeed be expressed eutopically and induce modest stimulation of steroidogenesis but that this is not sufficient to generate detectable increases in plasma cortisol after in vivo administration of these ligands. This may be analogous to the situation described here, in which the clinical picture is dominated by the presence of the ACTH receptor and ACTH excess, whereas the GIPR is not clinically obvious.
This is the first report of GIPR expression in the hyperplastic adrenals of Cushings disease. One adrenal from a case of Cushings disease has previously been studied for the presence of the GIPR; GIPR message was not detected by 35-cycle RT-PCR, but faint expression was detected when Southern blotting was used (14). A second report also failed to detect GIPR message in two cases of paraneoplastic ACTH-dependent Cushings syndrome (25). Clearly, additional cases need to be studied and quantitative RT-PCR performed before a definitive statement can be made regarding the prevalence and level of GIPR expression in non-food-dependent adrenal hyperplasia.
Where possible, the patient samples were further investigated as primary cultures. As expected, all samples as well as the normal adrenals showed a marked cAMP response to ACTH. EC50 values were similar in each of these five cultures. Cortisol was detectable only in primary cultures from patients 13, and these showed a response to ACTH of a size comparable to that induced by the adenylate cyclase agonist forskolin.
Predictably, a cAMP and cortisol response was also seen to GIP in patient 1 (food-dependent Cushings), whereas no cAMP response to GIP was seen in the normal adrenals. However, the ACTH-dependent hyperplastic adrenals studied also revealed a distinct cAMP and cortisol response to GIP. This observation has not been reported previously. The presence of the positive RT-PCR and the cAMP and cortisol responsivity to GIP imply that this response is mediated through the GIPR, although there was no clinical evidence of food dependence to the Cushings syndrome in these patients.
In contrast to the human, in the rat, the GIPR is widely expressed, with mRNA readily detectable in the inner layers of the adrenal cortex (29), and this has also been shown to be functionally coupled to glucocorticoid secretion through the adenylate cyclase signaling pathway (30). The possibility of GIPR expression in the normal adult human adrenal cortex at a very low level, or perhaps in a subset of cells, seems increasingly likely, although there is currently no evidence to demonstrate functional coupling of the GIPR to steroidogenesis in the human. Furthermore, it is possible that the contaminating presence of endothelial cells within adrenal samples contributes to the detectable GIPR message, although presumably not to steroidogenesis. The expression and regulation of GIPR in the normal human adrenal cortex has not been studied in great detail; however, the human GIPR promoter contains a consensus cAMP response element (31), prompting the speculation that ACTH stimulation might increase expression of GIPR. Previous groups have reported that prolonged exposure to high concentrations of ACTH up-regulate GIPR expression in rat adrenals, and it would be very desirable to test this possibility in normal adrenal cells (32). However, because there is little functional expression of the ACTH receptor in the human adrenocortical cell line NCI-H295R, and primary cultures of adrenal cells rapidly dedifferentiate, it remains difficult to address this possibility.
One explanation for the phenomenon of food-dependent Cushings that we tested was that a defect might be acquired in a regulatory system that influences multiple receptors, such as receptor desensitization. A number of common proteins such as G protein receptor kinases and arrestins have been implicated in the desensitization of the GIPR in vitro, and a defect in one of these could lead to overactivity of several receptors (33). We have recently described a case of apparent constitutive activity of a mutant ACTH receptor associated with impaired desensitization (7). In primary cultures, both the ACTH receptor and the GIPR demonstrated maximal desensitization of approximately 50% within 10 min of exposure to ligand. This is compatible with the desensitization profile of the human ACTH receptor studied in a stable transfection model and the mouse ACTH receptor endogenously expressed by Y1 cells (7, 27). There are few available data on short-term desensitization of the GIPR, although these data suggest that it desensitizes at least as effectively as the ACTH receptor. Thus, a generalized defect in receptor desensitization seems unlikely to explain the observed phenomena, and the primary defect appears to lie at the level of gene expression.
Do these observations provide any insight into food-dependent Cushings syndrome and AIMAH? Our data show that ACTH-dependent adrenal hyperplasia is frequently associated with the development of GIP responsiveness, although GIP dependency is the dominant clinical feature only in those rare cases with macronodular hyperplasia or with non-ACTH-dependent adrenal adenomas. Clearly it would be wrong to suggest that AIMAH was merely a late development of ACTH-dependent Cushings syndrome, because correction of ACTH excess by, for example, transsphenoidal surgery, is not followed by the development of food-dependent Cushings syndrome. However, we do argue that activation of the ACTH signaling pathway by mechanisms downstream of ACTH may be responsible for this phenomenon. We have shown for example that adrenal hyperplasia associated with Carney complex is accompanied by aberrant adrenal GIPR expression in one case. The micronodular adrenal hyperplasia associated with Carney complex is one of the two disorders clearly resulting from constitutive activation of the ACTH signaling pathway, at least in 50% of cases (the other being McCune-Albright syndrome). It will be of great interest to study additional adrenal samples from Carney complex and McCune-Albright syndrome when they become available. Potentially other as yet unidentified events that activate this pathway might also lead to GIPR expression, and in a proportion, this might become sufficiently dominant that it leads to GIP dependency of cortisol production and the development of AIMAH.
In summary, we have confirmed the presence of functional GIPRs in the adrenal hyperplasia of food-dependent Cushings syndrome. Furthermore, we have demonstrated the presence of functional GIPR in the adrenal hyperplasia of Cushings disease as well as the presence of GIPR mRNA in Cushings syndrome resulting from micronodular adrenal hyperplasia of Carney complex. We have failed to detect GIPR expression in either normal adult adrenals or in 20 cases of adrenal adenoma. These data are consistent with the hypothesis that AIMAH may, at least in some cases, be a late complication of chronic activation of the ACTH signaling pathway in the adrenal cortex. In those cases, that ultimately present with AIMAH, we propose that a point has been passed at which GIPR signaling becomes dominant leading to GIP-dependent cortisol secretion and adrenal cell growth.
| Footnotes |
|---|
First Published Online February 10, 2005
Abbreviations: AIMAH, ACTH-independent bilateral macronodular adrenal hyperplasia; AVP, arginine vasopressin; GIP, gastric inhibitory peptide; GIPR, GIP receptor; GLP1, glucagon-like peptide-1; 5HT, 5-hydroxytryptophan; IBMX, isobutyl methylxanthine; VIP, vasoactive intestinal peptide.
Received June 7, 2004.
Accepted January 28, 2005.
| References |
|---|
|
|
|---|
regulatory subunit in patients with the Carney complex. Nat Genet 26:8992[CrossRef][Medline]
regulatory subunit cause familial cardiac myxomas and Carney complex. J Clin Invest 106:R31R38
This article has been cited by other articles:
![]() |
M. H. S. Costa, A. C. Latronico, R. M. Martin, A. S Barbosa, M. Q Almeida, C. F. P. Lotfi, H. P Lima Valassi, M. Y. Nishi, A. M. Lucon, S. A. Siqueira, et al. Expression profiles of the glucose-dependent insulinotropic peptide receptor and LHCGR in sporadic adrenocortical tumors J. Endocrinol., February 1, 2009; 200(2): 167 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Vezzosi, D Cartier, C Regnier, P Otal, A Bennet, F Parmentier, M Plantavid, A Lacroix, H Lefebvre, and P Caron Familial adrenocorticotropin-independent macronodular adrenal hyperplasia with aberrant serotonin and vasopressin adrenal receptors Eur. J. Endocrinol., January 1, 2007; 156(1): 21 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lampron, I. Bourdeau, P. Hamet, J. Tremblay, and A. Lacroix Whole Genome Expression Profiling of Glucose-Dependent Insulinotropic Peptide (GIP)- and Adrenocorticotropin-Dependent Adrenal Hyperplasias Reveals Novel Targets for the Study of GIP-Dependent Cushing's Syndrome J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3611 - 3618. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Basu, R. Singh, A. Basu, C.M. Johnson, and R. A. Rizza Effect of Nutrient Ingestion on Total-Body and Splanchnic Cortisol Production in Humans Diabetes, March 1, 2006; 55(3): 667 - 674. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Saner-Amigh, B. A. Mayhew, F. Mantero, F. Schiavi, P. C. White, C. V. Rao, and W. E. Rainey Elevated Expression of Luteinizing Hormone Receptor in Aldosterone-Producing Adenomas J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 1136 - 1142. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Mazzuco, O. Chabre, N. Sturm, J.-J. Feige, and M. Thomas Ectopic Expression of the Gastric Inhibitory Polypeptide Receptor Gene Is a Sufficient Genetic Event to Induce Benign Adrenocortical Tumor in a Xenotransplantation Model Endocrinology, February 1, 2006; 147(2): 782 - 790. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Baldacchino, S. Oble, P.-O. Decarie, I. Bourdeau, P. Hamet, J. Tremblay, and A. Lacroix The Sp transcription factors are involved in the cellular expression of the human glucose-dependent insulinotropic polypeptide receptor gene and overexpressed in adrenals of patients with Cushing's syndrome J. Mol. Endocrinol., August 1, 2005; 35(1): 61 - 71. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |