help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism, doi:10.1210/jc.2004-0946
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
90/5/3009    most recent
Author Manuscript (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Swords, F. M.
Right arrow Articles by Clark, A. J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Swords, F. M.
Right arrow Articles by Clark, A. J. L.
Related Collections
Right arrow Adrenal and Hypertension
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 5 3009-3016
Copyright © 2005 by The Endocrine Society

The Aberrant Expression of the Gastric Inhibitory Polypeptide (GIP) Receptor in Adrenal Hyperplasia: Does Chronic Adrenocorticotropin Exposure Stimulate Up-Regulation of GIP Receptors in Cushing’s Disease?

F. M. Swords, S. Aylwin, L. Perry, J. Arola, A. B. Grossman, J. P. Monson and A. J. L. Clark

Department of Endocrinology (F.M.S., A.B.G., J.P.M., A.J.L.C.), William Harvey Research Institute, Barts & the London, Queen Mary University of London, London EC1A 7BE, United Kingdom; Department of Endocrinology (S.A.), King’s College Hospital, London, United Kingdom; Department of Clinical Biochemistry (L.P.), Barts & The London NHS Trust; and Haartman Institute of Pathology (J.A.), University of Helsinki, Finland

Address all correspondence and requests for reprints to: Professor A. J. L. Clark, Department of Endocrinology, St. Bartholomew’s Hospital, London EC1A 7BE, United Kingdom. E-mail: a.j.clark{at}qmul.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Context: Cortisol secretion is usually under the control of ACTH. However, cortisol secretion occurs in response to gastric inhibitory polypeptide (GIP) in rare cases of food-dependent Cushing’s syndrome (CS).

Objective: We have investigated whether chronic ACTH stimulation or activation of the ACTH signaling pathway might be associated with GIP receptor (GIPR) expression.

Design: RT-PCR analysis and primary culture of hyperplastic adrenals.

Patients: All patients presented with CS: 20 unilateral adrenal adenomas, five Cushing’s disease, one food-dependent CS.

Results: RT-PCR revealed GIPR expression in all hyperplastic adrenals studied. No RT-PCR product could be detected in two normal adrenals or 20 hyperfunctioning adrenal adenomas. Primary culture revealed a significant cAMP response to ACTH in all adrenals available for study (EC50, 8.1 x 10–10 M in normals, 4.7 x 10–10 M in Cushing’s disease, and 4.4 x 10–10 M in food-dependent disease). However, cultures taken from all four ACTH-dependent and the one food-dependent hyperplastic adrenals studied were also responsive to GIP (EC50 for cAMP, 1.3 x 10–9 M in Cushing’s disease and 4.1 x 10–10 M in food-dependent disease).

Fasting cortisol levels were low in the case of food-dependant Cushing’s, rising postprandially as predicted. However, there was no trend toward low fasting or high postprandial cortisol in the other cases, suggesting that the presence of detectable GIPR alone, albeit with definite function in vitro, is not sufficient to cause clinically food-dependent CS.

Conclusions: These data are consistent with the hypothesis that chronic ACTH stimulation or constitutive activation of the ACTH signaling pathway may be associated with aberrant GIPR expression, and suggest one mechanism for the pathogenesis of this phenomenon.


    Introduction
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
THE SECRETION OF cortisol by the adrenal cortex is primarily regulated by ACTH. The commonest cause of Cushing’s syndrome is ACTH hypersecretion by corticotroph adenomas of the anterior pituitary (Cushing’s disease), and less frequently from an extrapituitary tumor (ectopic ACTH syndrome). However, in adrenal Cushing’s syndrome, cortisol hypersecretion occurs in the absence of detectable ACTH, usually in association with an adrenal adenoma or carcinoma, or less frequently in association with bilateral hyperplasia of the adrenals (1, 2). In some uncommon instances, this can be explained by aberrant activation of the ACTH signaling pathway. For example, in McCune-Albright syndrome, activating somatic mutations of the {alpha}-subunit of Gs protein may be associated with macronodular adrenal hyperplasia (3). In Carney complex, inactivating mutations of the R1{alpha} subunit of protein kinase A may be associated with primary pigmented nodular adrenal hyperplasia and Cushing’s syndrome (4, 5), and these have also been described in rare sporadic cases (6). Furthermore we have also recently described an ACTH receptor mutation leading to apparent constitutive activity in a patient with bilateral adrenal hyperplasia and Cushing’s syndrome (7). However, a number of sporadic and familial cases of adrenal Cushing’s syndrome have been attributed to expression of hormone receptors other than the ACTH receptor, leading to cAMP accumulation and cortisol release (8, 9, 10, 11). This syndrome, often associated with ACTH-independent bilateral macronodular adrenal hyperplasia (AIMAH) but sometimes with a unilateral adenoma, has been most frequently associated with the aberrant expression of receptors for gastric inhibitory peptide (GIP) (12, 13, 14, 15, 16). GIP rises postprandially, which results in inappropriate postprandial cortisol release in the syndrome of food-dependent Cushing’s syndrome. However, alternative receptors, for example for catecholamines, LH/human chorionic gonadotropin, vasopressin, or serotonin may also be inappropriately expressed (8, 17, 18, 19). Frequently, two or more receptors are aberrantly expressed in the same adrenal (20, 21).

There is no mechanistic explanation for the origins of this phenomenon. Mutation of the GIP receptor (GIPR) promoter has been proposed to account for some of these cases (8, 14). In AIMAH, the initial event could occur as a somatic mutation during early embryonic life in sporadic cases (as in McCune-Albright) or as a germline mutation in familial AIMAH. However, no mutations of this gene or its regulatory regions have yet been reported, and this hypothesis fails to explain the expression of more than a single receptor type in these tumors (22).

An alternative to this hypothesis is that an inherited or acquired mutation activates the expression of a factor that might influence either the level of expression or the function of several receptors. Conceivably, a transcription factor might fulfill such a role, although an example of such a factor is not immediately apparent. Alternatively, a factor that influenced the function of a group of receptors such as a signal transduction molecule or a desensitization molecule might provide a unifying explanation. We recently demonstrated that a non-desensitizing ACTH receptor (resulting from a missense mutation) was associated with Cushing’s syndrome (7). One of the aims of this study was therefore to determine whether the receptors for ACTH and GIP desensitized normally in AIMAH-associated food-dependent Cushing’s syndrome.

A third hypothesis is that the GIPR and/or other receptors may be normally expressed in the adrenal cortex, either at very low levels in all cells or in a subpopulation of cells. A mitogenic event in such a cell might result in development of an adrenal tumor expressing these receptors, which, by responding to physiological concentrations of circulating agonists with a mitogenic signal, would further enhance growth of the tumor, although this would not explain bilateral AIMAH. In support of this, very low levels of GIPR expression have been demonstrated in the normal adrenal cortex when RT-PCR is used in conjunction with Southern blotting (14, 23, 24).

A final possibility is that stimulation of adrenal cells by one agonist may stimulate the expression of one or more other receptors or alternatively may stimulate proliferation of a subpopulation of cells expressing these other receptors. One candidate agonist for such an effect is ACTH. Accordingly, we have investigated whether adrenal hyperplasia associated with chronic ACTH stimulation in Cushing’s disease might induce expression of GIPR or other receptors in primary cultures of adrenal tissue.


    Patients and Methods
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Clinical screening and patients

Clinical details of patients are summarized in Table 1Go. Patient 1 was a 75-yr-old female who presented with malaise, diabetes mellitus, centripetal adiposity, and proximal myopathy. Serum cortisol was elevated and failed to suppress after low-dose (0.5 mg 6-hourly for 48 h) and high-dose (2 mg 6-hourly for 48 h) dexamethasone suppression testing (662 nmol/liter and 559 nmol/liter, respectively). Plasma ACTH was low but measurable (8–11 ng/liter). Abdominal computerized tomography scan revealed bilateral adrenal masses, and biopsy revealed adrenocortical hyperplasia. Pituitary imaging was unremarkable, and inferior petrosal sinus sampling revealed a central to peripheral gradient after CRH but with no lateralization. The patient underwent transsphenoidal surgery. However, hypercortisolemia persisted, and no adenoma was identified histologically. Variability in 0900 h serum cortisol values was noted (232–695 nmol/liter), and sequential salivary and urinary samples were then examined for evidence of cyclicity. The 0900 h salivary cortisol values were low/normal (mean, 12.7 nmol/liter) with higher levels at 2200 h (mean, 16.0 nmol/liter; P = 0.096). Timed urine free cortisol measurements (sequential 3-h measurements over 24 h, repeated on three occasions) indicated a progressive daytime rise in cortisol production from 14 nmol/h (0600–0900 h) to 25 nmol/h (1200–1500 h), with peak levels of 28 nmol/liter recorded between 2100 and 2400 h. Food-dependent Cushing’s was thus suspected, and serum cortisol rose from 197 to 704 nmol/liter after a test meal. This rise was greater than that to CRH (peak, 414 nmol/liter), 1 mg synthetic ACTH (peak, 647 nmol/liter), or fasting (278 nmol/liter), as summarized in Fig. 1Go.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Clinical characteristics of patients studied

 


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 1. Plot showing the in vivo cortisol responses to various challenges in patient 1 preoperatively. Note the low fasting levels of serum cortisol, which increase dramatically in response to a mixed test meal or to 100 µg iv CRH stimulus or 1 mg im Synacthen.

 
Patients 2–6 had Cushing’s disease. There was no clinical suggestion of food dependency in any of these patients at the time of diagnosis, and so they were not screened specifically at that time. The manner in which their diagnoses had been established is summarized in Table 2Go. Four of the five patients with Cushing’s disease had undergone prior treatment of their ACTH-secreting pituitary adenomas with transsphenoidal surgery and conventional radiotherapy, but ACTH and cortisol excess persisted. Patients 3–6 had had unsatisfactory responses to metyrapone and ketoconazole adrenolytic therapy and had elected to undergo adrenalectomy to achieve a more rapid normalization of cortisol levels. Patients 2–5 were off adrenolytic therapy for at least 6 wk at the time of surgery, whereas patient 6 remained on metyrapone 500 mg three times daily for surgery.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Establishment of Cushing’s disease diagnosis

 
All patients were rescreened for the presence of ectopic/abnormal adrenal hormone receptors before adrenalectomy (8). An 0900 h, assessment of circulating ACTH, cortisol, aldosterone, testosterone, dehydroepiandrosterone sulfate, and estradiol were measured after an overnight fast and in the supine posture for 1 h, followed by evaluation of diurnal rhythm of cortisol including the response to a test meal and measurement of sleeping midnight cortisol. Other aberrant responses were not examined.

One of the patients with Cushing’s disease (patient 2) appeared to have an adrenal adenoma at diagnosis, with a 2 x 3-cm left sided adrenal mass on imaging, low ACTH, equivocal pituitary imaging, and no response to a CRH test. She therefore underwent unilateral adrenalectomy shortly after presentation. Histology revealed an adenomatous nodule within diffuse adrenocortical hyperplasia, and postoperatively she remained hypercortisolemic. Investigations after adrenalectomy were consistent with cyclical Cushing’s disease. Because of the cyclical nature of her condition, she has not yet undergone additional invasive treatment.

Histology revealed diffuse adrenocortical hyperplasia in all other cases of Cushing’s disease, with an adrenal adenoma also present in patient 5.

The patient with Carney complex (patient 7) presented with Cushing’s syndrome and spotty skin pigmentation. She had normal pituitary imaging, undetectable serum ACTH, and no response to a CRH test and thus underwent bilateral adrenalectomy to achieve cure of her Cushing’s syndrome. Histology confirmed nodular cortical hyperplasia with atrophy of intervening adrenocortical tissue. The control samples (patients 8 and 9) were resected during nephrectomy for renal cell carcinoma and were normal on histological examination.

Tissue collection and culture

All samples were obtained after informed consent of the patient and prior local ethical committee approval. All adrenal tissue samples, other than the control samples, were removed during elective adrenalectomy, which was performed as treatment for Cushing’s syndrome. Tissues were collected during surgery, and the cortices were dissected from surrounding tissue and immediately either snap frozen in liquid nitrogen and stored at –70 C for RT-PCR at a later date or placed in cell culture medium (DMEM/F10; 1/1 medium supplemented with 10% fetal calf serum, 10% horse serum, and 1% penicillin/streptomycin) at 37 C for primary culture within an hour of surgery. Samples were macerated before collagenase digestion and incubation at 37 C for 60 min and then vigorously aerated and filtered through fine muslin before being centrifuged at 1100 rpm for 10 min and resuspended in medium (method adapted from Ref. 25). Cells were counted using trypan blue cytometry and plated in six-well plates at a concentration of 5 x 105 per well. After 24 h incubation, cells were washed and incubated for 60 min in serum-free medium before stimulation.

To assess steroid production, cells were exposed to agonist made up in serum-free medium for 3 h at 37 C before immediate freezing at –20 C until specific RIA was performed for cortisol. Agonists used were GIP (10–8 M), ACTH (10–8 M), forskolin (10–5 M), glucagon-like peptide-1 (GLP1) (10–7 M), leptin (10–7 M), 5-hydroxytryptophan (5HT) (10–5 M), vasoactive intestinal peptide (VIP) (10–7 M), pituitary adenylate cyclase-activating polypeptide (10–7 M), isoproterenol (10–5 M), LH (10–8 M), and arginine vasopressin (AVP) (10–8 M). Each stimulation was performed in triplicate.

To assess cAMP production, cells were exposed to increasing doses of GIP and ACTH (10–12 to 10–6 M) for 30 min at 37 C in the presence of 1 mM isobutyl methylxanthine (IBMX) to inhibit phosphodiesterase-mediated breakdown of cAMP. cAMP was then assayed and measured using a competitive binding assay (26). To assess the desensitization of these responses, cells were first incubated with 10–8 M ACTH or GIP for a varying time interval (0–60 min) in the absence of IBMX, washed, and then exposed to a second fixed time period of stimulation in the presence of IBMX as previously described (27). cAMP production was then expressed as a percentage of maximal cAMP accumulation from a single 30-min stimulation with that ligand. All cAMP experiments were performed in duplicate.

GIPR expression study

Total RNA was extracted from adrenal tissue using the QIAGEN RNeasy kit (Crawley, UK). RT was performed using Moloney murine leukemia virus reverse transcriptase using random hexamers to prime the reaction. cDNAs thus obtained were then amplified by PCR using primers specific for the GIPR (35 cycles at 94 C for 30 sec, 66 C for 30 sec, and 72 C for 30 sec): sense, CCTGATCGCCCCTGCACGAAC; antisense, AGGTCGAGGTAGCAGACGGTCTCG (28). cDNA from the human CaCo cell line was used as a positive control. Control reactions were also performed using primers to GAPDH (sense, TCCCATCACCATCTTCCA; antisense, GTCCACCACCCTGTTGCT). PCR fragments were then identified by 1% agarose gel electrophoresis.

Statistical analysis

All data are given as mean ± SEM unless stated otherwise. All data were analyzed using Graphpad Prism software. Variable-slope sigmoidal dose-response curves were used to analyze the cAMP dose-response data and to generate EC50 values. Unpaired, two-tailed Student’s t tests were performed to compare basal with stimulated cortisol production for each adrenal primary culture.


    Results
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Clinical investigation

The clinical characteristics of all patients studied are summarized in Table 1Go. Patient 1 had food-dependent Cushing’s syndrome, with repeated low fasting cortisol levels and a clear increase in postprandial serum cortisol. This patient was then further characterized for cortisol responses to ACTH and CRH, as shown in Fig. 1Go, although because there was no clinical suspicion of other ectopic receptors, clinical evidence of these was not sought. For all other cases of ACTH-dependent and -independent adrenal hyperplasia, there was no significant increase between fasting and 2-h postprandial serum cortisol values.

GIPR expression

Two PCR products of similar size, 634 and 527 base pairs, were observed in the positive control cDNA (CaCo cell line), adrenal tissue taken from the patient with food-dependent Cushing’s syndrome (patient 1), five patients with ACTH-dependent Cushing’s disease (patients 2–6), and a patient with Carney complex (patient 7). No GIPR expression was detectable in cDNA derived from either the two normal adrenals (Fig. 2Go) or the 20 adrenal adenomas (data not shown).



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 2. Agarose gel photograph indicating the presence of GIPR transcripts by RT-PCR for patients 1–7, all of whom had adrenal hyperplasia of various etiology; the results were negative for the two normal adrenals (lanes 8 and 9). Product sizes 634 and 540 bp correspond to the predicted products of two described splice variants. Primers to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as a positive control for each case, predicted product size 800 bp, shown below. Water was used as a negative control, lane 10, and cDNA from the cell line CaCo was used as a positive control, lane 11. A size marker is shown to the left of lane 1.

 
Effects of GIP, ACTH, and other agonists on cultured adrenal cells

All samples of adrenal hyperplasia available for primary culture (patients 1–5) and the two normal adrenals showed a clear dose-response curve to ACTH with a similar EC50: 4.7 x 10–10 M in Cushing’s disease, 4.4 x 10–10 M in food-dependent disease, and 4.3 x 10–10 M and 1.3 x 10–9 M in the two normal adrenals (Fig. 3AGo). The magnitude of the response was smaller in patient 1 (rising from 141.1 to 355.3 pmol cAMP/mg protein) than in patients 2–5 (146.1 ± 25.4 to 741.5 ± 66.6 pmol cAMP/mg protein, mean ± SEM) or the two normal subjects (159 to 699 and 83 to 625 pmol cAMP/mg protein).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 3. cAMP responses to ACTH and GIP. A, cAMP dose-response curves to ACTH of the adrenal cell primary cultures. Data are combined for patients 2–5 (the Cushing’s disease adrenals), with mean ± SEM shown. Data for patients 1 (food-dependent Cushing’s syndrome) and 9 and 10 (normals) are given individually. B, cAMP dose-response curves to GIP. In all cases, cAMP levels were lower, with a very modest response in patient 1, food-dependent Cushing’s syndrome (basal, 90.2, to maximal 153.2 pmol/mg protein; EC50, 4.1 x1 0–10 M), a more dramatic response in Cushing’s disease (cAMP levels rising from 88.6 ± 24.2 to 327.8 ± 54.6 pmol/mg protein; EC50, 1.3 x 10–9 M), and no response in the two normal adrenals. C, Desensitization of the cAMP response. Desensitization of both receptors appears to be intact. Data for patient 1 are shown separately; data are combined for patients 2–5, mean ± SEM.

 
A dose response to GIP was also produced in all hyperplastic adrenal samples but not in the normal adrenal glands; EC50 for cAMP was 1.3 x 10–9 M in Cushing’s disease, 4.1 x 10–10 M in food-dependent disease (Fig. 3BGo). In the case of patients 2–5, the magnitude of the response was less than that to ACTH but greater than that of patient 1 to GIP. cAMP levels increased from 88.6 ± 24.2 to 327.8 ± 54.6 pmol/mg protein in response to GIP in the patients with Cushing’s disease and from 90.2 to 153.2 pmol/mg protein in patient 1.

In the second group of experiments, cells were exposed to a fixed-dose stimulation with GIP, ACTH, forskolin, GLP1, leptin, 5HT, VIP, PACAP, isoproterenol, LH, and AVP, and cortisol responses were measured. In all cases of adrenal hyperplasia available for study, a marked response to forskolin, ACTH, and GIP was observed (Fig. 4Go). Furthermore, patients 1 and 2 also showed a significant cortisol response to AVP [patient 1, 173.7 ± 11.6 nmol/liter compared with basal, 113.7 ± 4.9 (P < 0.01); patient 2, 647.5 ± 44.5 nmol/liter compared with basal, 213.7 ± 70.2 nmol/liter (P < 0.0001)]. No other ligands produced statistically significant responses. Unfortunately, there were insufficient cells from cases 8 and 9 (the normal adrenals) and cases 4 and 5 (both Cushing’s disease adrenals) to perform this set of experiments.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 4. Histograms illustrating the cortisol response of the adrenal cell primary cultures to various ligands. A, Patient 1; B, patient 2; C, patient 3. Forsk, forskolin; Isopro, isoproterenol; PACAP, pituitary adenylate cyclase-activating polypeptide. The response to VIP was not tested in patient 1. ***, P < 0.001; **, P < 0.005; *, P < 0.05. The response to AVP in patient 1, although statistically significant, is of comparatively low magnitude.

 
The tendency of the ACTH and GIP cAMP responses to desensitize were then determined. Cells were subjected to a double stimulation with ACTH followed by ACTH, or GIP followed by GIP. All samples showed similar responses with dramatic early desensitization to both ligands (Fig. 3CGo). Response to the second GIP stimulus was reduced to 55.4 ± 6.3% at 5 min and reached a plateau of 33.1 ± 6.3% at 30 min, and for ACTH, the second stimulus was reduced to 56.8 ± 7.1% at 5 min, reaching a plateau of 29.9 ± 4.8% at 30 min before exposure to ligand (pooled data).


    Discussion
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
We have demonstrated functional expression of the GIPR in five adrenals from patients with ACTH-dependent adrenal hyperplasia as well as one patient with food-dependent Cushing’s syndrome associated with AIMAH and one patient with micronodular adrenal hyperplasia and Carney complex. Only the patient with AIMAH had clinical evidence of food-dependent cortisol secretion.

Interestingly, the patient with clinical food-dependent Cushing’s syndrome in this series had detectable ACTH levels and mounted a cortisol response to CRH in vivo. This lack of suppression of pituitary ACTH and responsiveness to CRH has previously been reported in at least two other cases of food-dependent Cushing’s syndrome, and perhaps indicates that the intermittent nature of food-induced cortisol secretion does not always result in complete suppression of the hypothalamic-pituitary-adrenal axis (16, 24). In the first case, CRH had no significant effect on cortisol production in vitro, suggesting that the in vivo CRH response is mediated through ACTH (24). ACTH levels are thus not fully suppressed, and the continued expression of the ACTH receptor in the hyperplastic adrenal is responsible for the CRH response, whereas the high level of expression of the GIPR is responsible for the predominant clinical phenotype.

Clear evidence of the expression of the GIPR transcript was found by RT-PCR, in the case of food-dependent Cushing’s syndrome (patient 1), the five patients with Cushing’s disease (patients 2–6), and the patient with Carney complex (patient 7). The two normal adrenal samples and all 20 adrenal adenomas were negative for the GIPR cDNA as detected by ethidium bromide staining. It is conceivable that if we had used an even more sensitive detection method in the form of Southern blotting of RT-PCR products, a signal may have been detectable, although the significance of this, in comparison with the readily detectable signals in the hyperplastic adrenals, is questionable (23). Another group has recently published work confirming the expression of the GIPR mRNA in AIMAH not associated with food-dependent disease. Expression of the GIPR was found in four of eight cases of AIMAH associated with subclinical ACTH-independent Cushing’s syndrome as well as in one of 16 adrenal adenomas (28). The LH receptor was also aberrantly expressed in two of these cases, as well as the ectopic V2 receptor in one case and the ectopic 5HT7 receptor in two of these cases (21). The relative contributions of these ectopic receptors as well as the eutopic V1 receptor in one case are difficult to decipher. It is possible that such receptors may indeed be expressed eutopically and induce modest stimulation of steroidogenesis but that this is not sufficient to generate detectable increases in plasma cortisol after in vivo administration of these ligands. This may be analogous to the situation described here, in which the clinical picture is dominated by the presence of the ACTH receptor and ACTH excess, whereas the GIPR is not clinically obvious.

This is the first report of GIPR expression in the hyperplastic adrenals of Cushing’s disease. One adrenal from a case of Cushing’s disease has previously been studied for the presence of the GIPR; GIPR message was not detected by 35-cycle RT-PCR, but faint expression was detected when Southern blotting was used (14). A second report also failed to detect GIPR message in two cases of paraneoplastic ACTH-dependent Cushing’s syndrome (25). Clearly, additional cases need to be studied and quantitative RT-PCR performed before a definitive statement can be made regarding the prevalence and level of GIPR expression in non-food-dependent adrenal hyperplasia.

Where possible, the patient samples were further investigated as primary cultures. As expected, all samples as well as the normal adrenals showed a marked cAMP response to ACTH. EC50 values were similar in each of these five cultures. Cortisol was detectable only in primary cultures from patients 1–3, and these showed a response to ACTH of a size comparable to that induced by the adenylate cyclase agonist forskolin.

Predictably, a cAMP and cortisol response was also seen to GIP in patient 1 (food-dependent Cushing’s), whereas no cAMP response to GIP was seen in the normal adrenals. However, the ACTH-dependent hyperplastic adrenals studied also revealed a distinct cAMP and cortisol response to GIP. This observation has not been reported previously. The presence of the positive RT-PCR and the cAMP and cortisol responsivity to GIP imply that this response is mediated through the GIPR, although there was no clinical evidence of food dependence to the Cushing’s syndrome in these patients.

In contrast to the human, in the rat, the GIPR is widely expressed, with mRNA readily detectable in the inner layers of the adrenal cortex (29), and this has also been shown to be functionally coupled to glucocorticoid secretion through the adenylate cyclase signaling pathway (30). The possibility of GIPR expression in the normal adult human adrenal cortex at a very low level, or perhaps in a subset of cells, seems increasingly likely, although there is currently no evidence to demonstrate functional coupling of the GIPR to steroidogenesis in the human. Furthermore, it is possible that the contaminating presence of endothelial cells within adrenal samples contributes to the detectable GIPR message, although presumably not to steroidogenesis. The expression and regulation of GIPR in the normal human adrenal cortex has not been studied in great detail; however, the human GIPR promoter contains a consensus cAMP response element (31), prompting the speculation that ACTH stimulation might increase expression of GIPR. Previous groups have reported that prolonged exposure to high concentrations of ACTH up-regulate GIPR expression in rat adrenals, and it would be very desirable to test this possibility in normal adrenal cells (32). However, because there is little functional expression of the ACTH receptor in the human adrenocortical cell line NCI-H295R, and primary cultures of adrenal cells rapidly dedifferentiate, it remains difficult to address this possibility.

One explanation for the phenomenon of food-dependent Cushing’s that we tested was that a defect might be acquired in a regulatory system that influences multiple receptors, such as receptor desensitization. A number of common proteins such as G protein receptor kinases and arrestins have been implicated in the desensitization of the GIPR in vitro, and a defect in one of these could lead to overactivity of several receptors (33). We have recently described a case of apparent constitutive activity of a mutant ACTH receptor associated with impaired desensitization (7). In primary cultures, both the ACTH receptor and the GIPR demonstrated maximal desensitization of approximately 50% within 10 min of exposure to ligand. This is compatible with the desensitization profile of the human ACTH receptor studied in a stable transfection model and the mouse ACTH receptor endogenously expressed by Y1 cells (7, 27). There are few available data on short-term desensitization of the GIPR, although these data suggest that it desensitizes at least as effectively as the ACTH receptor. Thus, a generalized defect in receptor desensitization seems unlikely to explain the observed phenomena, and the primary defect appears to lie at the level of gene expression.

Do these observations provide any insight into food-dependent Cushing’s syndrome and AIMAH? Our data show that ACTH-dependent adrenal hyperplasia is frequently associated with the development of GIP responsiveness, although GIP dependency is the dominant clinical feature only in those rare cases with macronodular hyperplasia or with non-ACTH-dependent adrenal adenomas. Clearly it would be wrong to suggest that AIMAH was merely a late development of ACTH-dependent Cushing’s syndrome, because correction of ACTH excess by, for example, transsphenoidal surgery, is not followed by the development of food-dependent Cushing’s syndrome. However, we do argue that activation of the ACTH signaling pathway by mechanisms downstream of ACTH may be responsible for this phenomenon. We have shown for example that adrenal hyperplasia associated with Carney complex is accompanied by aberrant adrenal GIPR expression in one case. The micronodular adrenal hyperplasia associated with Carney complex is one of the two disorders clearly resulting from constitutive activation of the ACTH signaling pathway, at least in 50% of cases (the other being McCune-Albright syndrome). It will be of great interest to study additional adrenal samples from Carney complex and McCune-Albright syndrome when they become available. Potentially other as yet unidentified events that activate this pathway might also lead to GIPR expression, and in a proportion, this might become sufficiently dominant that it leads to GIP dependency of cortisol production and the development of AIMAH.

In summary, we have confirmed the presence of functional GIPRs in the adrenal hyperplasia of food-dependent Cushing’s syndrome. Furthermore, we have demonstrated the presence of functional GIPR in the adrenal hyperplasia of Cushing’s disease as well as the presence of GIPR mRNA in Cushing’s syndrome resulting from micronodular adrenal hyperplasia of Carney complex. We have failed to detect GIPR expression in either normal adult adrenals or in 20 cases of adrenal adenoma. These data are consistent with the hypothesis that AIMAH may, at least in some cases, be a late complication of chronic activation of the ACTH signaling pathway in the adrenal cortex. In those cases, that ultimately present with AIMAH, we propose that a point has been passed at which GIPR signaling becomes dominant leading to GIP-dependent cortisol secretion and adrenal cell growth.


    Footnotes
 
F.M.S. was supported by a Wellcome Clinical Research Fellowship.

First Published Online February 10, 2005

Abbreviations: AIMAH, ACTH-independent bilateral macronodular adrenal hyperplasia; AVP, arginine vasopressin; GIP, gastric inhibitory peptide; GIPR, GIP receptor; GLP1, glucagon-like peptide-1; 5HT, 5-hydroxytryptophan; IBMX, isobutyl methylxanthine; VIP, vasoactive intestinal peptide.

Received June 7, 2004.

Accepted January 28, 2005.


    References
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 

  1. Newell-Price J, Jorgensen JO, Grossman A 1999 The diagnosis and differential diagnosis of Cushing’s syndrome. Horm Res 51(Suppl 3):81–94
  2. Stratakis CA, Kirschner LS 1998 Clinical and genetic analysis of primary bilateral adrenal diseases (micro- and macronodular disease) leading to Cushing’s syndrome. Horm Metab Res 30:456–463[Medline]
  3. Weinstein LS, Shenker A, Gejman PV, Merino MJ, Friedman E, Spiegel AM 1991 Activating mutations of the stimulatory G protein in the McCune Albright syndrome. N Engl J Med 325:1688–1695[Abstract]
  4. Kirschner LS, Carney JA, Pack D, Taymans SE, Giatzakis C, Cho YS, Cho-Chung YS, Stratakis CA 2000 Mutations of the gene encoding the protein kinase A type 1-{alpha} regulatory subunit in patients with the Carney complex. Nat Genet 26:89–92[CrossRef][Medline]
  5. Casey M, Vaughan CJ, He J, Hatcher CJ, Winter JM, Weremowicz S, Montgomery K, Kucherlapati R, Morton CC, Basson CT 2000 Mutations of the gene encoding the protein kinase A type 1-{alpha} regulatory subunit cause familial cardiac myxomas and Carney complex. J Clin Invest 106:R31–R38
  6. Groussin L, Jullian E, Perlemoine K, Louvel A, Leheup B, Luton JP, Bertagna X, Bertherat J 2002 Mutations of the PRKAR1A gene in Cushing’s syndrome due to sporadic primary pigmented nodular adrenocortical disease. J Clin Endocrinol Metab 87:4324–4329[Abstract/Free Full Text]
  7. Swords FM, Baig A, Malchoff DM, Malchoff CD, Thorner MO, Hunyady L, Clark AJL 2002 Constitutive activation of the ACTH receptor associated with defective receptor desensitisation and sequestration. Mol Endocrinol 16:2746–2753[Abstract/Free Full Text]
  8. Lacroix A, N'Diaye N, Tremblay J, Hamet P 2001 Ectopic and abnormal hormone receptors in adrenal Cushing’s syndrome. Endocr Rev 22:75–110[Abstract/Free Full Text]
  9. Miyamura N, Taguchi T, Murata Y, Taketa K, Iwashita S, Matsumoto K, Nishikawa T, Toyonaga T, Sakakida M, Araki E 2002 Inherited adrenocorticotropin-independent macronodular adrenal hyperplasia with abnormal cortisol secretion by vasopressin and catecholamines: detection of the aberrant hormone receptors on adrenal gland. Endocrine 9:319–326
  10. Imohl M, Koditz R, Stachon A, Muller KM, Nicolas V, Pfeilschifter J, Krieg M 2002 Catecholamine-dependent hereditary Cushing’s syndrome: follow-up after unilateral adrenalectomy. Med Klin (Munich) 97:747–753
  11. Lee S, Jun S, Hong SW, Kim DJ, Rhee Y, Lim S, Familial adrenocorticotropin-Independent macronodular adrenal hyperplasia: ectopic expression of vasopressin V1b, V2 receptors in the adrenal gland. Program of the 86th Annual Meeting of The Endocrine Society, New Orleans, LA, 2004, p 566 (Abstract P3-417)
  12. Lacroix A, Bolte E, Tremblay J, Dupre J, Poitras P, Fournier H, Garon J, Garrel D, Bayard F, Taillefer R, Flanagan RJ, Hamet P 1992 Gastric inhibitory polypeptide-dependent cortisol hypersecretion: a new cause for Cushing’s syndrome. N Engl J Med 327:974–980[Abstract]
  13. Reznik Y, Allali-Zerah V, Chayvialle JA, Leroyer R, Leymarie P, Travert G, Lebrethon MC, Budi I, Balliere AM, Mahoudeau J 1992 Food-dependent Cushing’s syndrome mediated by aberrant adrenal sensitivity to gastric inhibitory polypeptide. N Engl J Med 327:981–986[Abstract]
  14. N'Diaye N, Tremblay J, Hamet P, De Herder WW, Lacroix A 1998 Adrenocortical overexpression of gastric inhibitory polypeptide receptor underlies food-dependent Cushing’s syndrome. J Clin Endocrinol Metab 83:2781–2785[Abstract/Free Full Text]
  15. Luton JP, Nertherat J, Kuhn J, Bertagna X 1998 Aberrant expression of the GIPR in an adrenal cortical adenoma responsible for a case of food-dependent Cushing’s syndrome. Bull Acad Natl Med 182:1839–1850[Medline]
  16. Tsagarakis S, Tsigos C, Vassiliou V, Tsiotra P, Pratsinis H, Kletsas D, Trivizas P, Nikou A, Mavromatis T, Sotsiou F, Raptis S, Thalassinos N 2001 Food-dependent androgen and cortisol secretion by a gastric inhibitory polypeptide-receptor expressive adrenocortical adenoma leading to hirsutism and subclinical Cushing’s syndrome: in vivo and in vitro studies. J Clin Endocrinol Metab 86:583–589[Abstract/Free Full Text]
  17. Lacroix A, Tremblay J, Rousseau G, Bouvier M, Hamet P 1997 Propanolol therapy for ectopic ß-adrenergic receptors in adrenal Cushing’s syndrome. N Engl J Med 337:1429–1434[Free Full Text]
  18. Lacroix A, Hamet P, Boutin JM 1999 Leuprolide acetate therapy in luteinizing hormone-dependent Cushing’s syndrome. N Engl J Med 341:1577–1581[Free Full Text]
  19. Lacroix A, Tremblay J, Touyz RM, Deng LY, Lariviere R, Cusson JR, Schriffin EL, Hamet P 1997 Abnormal adrenal and vascular responses to vasopressin mediated by a V1-vasopressin receptor in a patient with adrenocorticotropin-independent macronodular adrenal hyperplasia, Cushing’s syndrome, and orthostatic hypotension. J Clin Endocrinol Metab 82:2414–2422[Abstract/Free Full Text]
  20. Matsukora S, Kakita T, Sueoka S, Yoshimi H, Hirata Y, Yokota M, Fujita T 1980 Multiple hormone receptors in the adenylate cyclase of human adrenocortical tumours. Cancer Res 40: 3768–3771
  21. Louiset E, Contesse V, Cartier D, Bertherat J, Duparc C, Barrande G, Groussin L, Vaudry H, Lefebvre H 2004 Pharmacological profile and coupling mechanisms of illegitimate receptors in ACTH-independent macronodular bilateral adrenal hyperplasia causing Cushing’s syndrome. Program of the 86th Annual Meeting of The Endocrine Society, New Orleans, LA, 2004 (Abstract P3-410)
  22. Antonini SR, N'Diaye N, Baldacchino V, Hamet P, Tremblay J, Lacroix A 2004 An analysis of the putative regulatory region of the GIP receptor gene in food-dependent Cushing’s syndrome. J Steroid Biochem Mol Biol 91:171–177[CrossRef][Medline]
  23. Lebrethon MC, Avallet O, Reznik Y, Archambeaud F, Combes J, Usdin TB, Narboni G, Mahoudeau J, Saez JM 1998 Food-dependent Cushing’s syndrome: characterization and functional role of gastric inhibitory polypeptide receptor in the adrenals of three patients. J Clin Endocrinol Metab 83:4514–4519[Abstract/Free Full Text]
  24. Croughs RJ, Zelissen PM, Van Vroonhoven TJ, Hofland LJ, N'Diaye N, Lacroix A, De Herder WW 2000 GIP dependent adrenal Cushing’s syndrome with incomplete suppression of ACTH. Clin Endocrinol 52:235–240[CrossRef][Medline]
  25. Chabre O, Liakos P, Vivier J, Chaffonjon P, Labat-Moleur F, Martinie M, Bottari SP, Bachelot I, Chambaz EM, Defaye G, Feige JJ 1998 Cushing’s syndrome due to a gastric inhibitory polypeptide-dependent adrenal adenoma: insights into hormonal control of adrenocortical tumorigenesis. J Clin Endocrinol Metab 83:3134–3143[Abstract/Free Full Text]
  26. Brown BL, Albano JD, Ekins RP, Sgherzi AM, Tampion W 1971 A simple and sensitive saturation assay method for the measurement of adenosine 3':5'-cyclic monophosphate. Biochem J 121:561–562[Medline]
  27. Baig AH, Swords FM, Noon LA, King PJ, Hunyady L, Clark AJ 2001 Desensitization of the Y1 cell adrenocorticotropin receptor: evidence for a restricted heterologous mechanism implying a role for receptor-effector complexes. J Biol Chem 276:44792–44797[Abstract/Free Full Text]
  28. Groussin L, Perlemoine K, Contesse V, Lefebvre H, Tabarin A, Thieblot P, Schlienger JL, Luton JP, Bertagna X, Bertherat J 2002 The ectopic expression of the gastric inhibitory polypeptide receptor is frequent in adrenocorticotropin-independent bilateral macronodular adrenal hyperplasia, but rare in unilateral tumors. J Clin Endocrinol Metab 87:1980–1985[Abstract/Free Full Text]
  29. Usdin TB, Mezey E, Button DC, Brownstein MJ, Bonner TI 1993 Gastric inhibitory polypeptide receptor, a member of the secretin-vasoactive intestinal peptide receptor family, is widely distributed in peripheral organs and the brain. Endocrinology 133:2861–2870[Abstract]
  30. Mazzocchi G, Rebuffat P, Meneghelli V, Malendowicz LK, Tortoralla C, Gottardo G, Nussdorfer GG 1999 Gastric inhibitory polypeptide stimulated glucocorticoid secretion in rats, acting through specific receptors coupled with the adenylate cyclase-dependent signaling pathway. Peptides 20:589–594[CrossRef][Medline]
  31. Antonini SR, N'Diaye N, Hamet P, Tremblay J, Lacroix A 2002 Analysis of the putative promoter region of the GIP receptor gene (GIPR) in GIP-dependent Cushing’s syndrome. Endocr Res 28:755–756[Medline]
  32. Nussdorfer GG, Bahcelioglu M, Neri G, Malendowicz LK 2000 Secretin, gastric inhibitory polypeptide, parathyroid hormone and related peptides in the regulation of the hypothalamus-pituitary-adrenal axis. Peptides 21:309–324[CrossRef][Medline]
  33. Tseng CC, Zhang XY 2000 Role of G protein-coupled receptor kinases in glucose-dependent insulinotropic polypeptide receptor signaling. Endocrinology 141:947–952[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
D Vezzosi, D Cartier, C Regnier, P Otal, A Bennet, F Parmentier, M Plantavid, A Lacroix, H Lefebvre, and P Caron
Familial adrenocorticotropin-independent macronodular adrenal hyperplasia with aberrant serotonin and vasopressin adrenal receptors
Eur. J. Endocrinol., January 1, 2007; 156(1): 21 - 31.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Lampron, I. Bourdeau, P. Hamet, J. Tremblay, and A. Lacroix
Whole Genome Expression Profiling of Glucose-Dependent Insulinotropic Peptide (GIP)- and Adrenocorticotropin-Dependent Adrenal Hyperplasias Reveals Novel Targets for the Study of GIP-Dependent Cushing's Syndrome
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3611 - 3618.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
R. Basu, R. Singh, A. Basu, C.M. Johnson, and R. A. Rizza
Effect of Nutrient Ingestion on Total-Body and Splanchnic Cortisol Production in Humans
Diabetes, March 1, 2006; 55(3): 667 - 674.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Saner-Amigh, B. A. Mayhew, F. Mantero, F. Schiavi, P. C. White, C. V. Rao, and W. E. Rainey
Elevated Expression of Luteinizing Hormone Receptor in Aldosterone-Producing Adenomas
J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 1136 - 1142.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. L. Mazzuco, O. Chabre, N. Sturm, J.-J. Feige, and M. Thomas
Ectopic Expression of the Gastric Inhibitory Polypeptide Receptor Gene Is a Sufficient Genetic Event to Induce Benign Adrenocortical Tumor in a Xenotransplantation Model
Endocrinology, February 1, 2006; 147(2): 782 - 790.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
V. Baldacchino, S. Oble, P.-O. Decarie, I. Bourdeau, P. Hamet, J. Tremblay, and A. Lacroix
The Sp transcription factors are involved in the cellular expression of the human glucose-dependent insulinotropic polypeptide receptor gene and overexpressed in adrenals of patients with Cushing's syndrome
J. Mol. Endocrinol., August 1, 2005; 35(1): 61 - 71.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
90/5/3009    most recent
Author Manuscript (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Swords, F. M.
Right arrow Articles by Clark, A. J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Swords, F. M.
Right arrow Articles by Clark, A. J. L.
Related Collections
Right arrow Adrenal and Hypertension


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals