help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2004-1696
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*METFORMIN HYDROCHLORIDE
Related Collections
Right arrow Metabolism
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 4 2282-2289
Copyright © 2005 by The Endocrine Society

Monocyte Chemoattractant Protein-1 Release Is Higher in Visceral than Subcutaneous Human Adipose Tissue (AT): Implication of Macrophages Resident in the AT

Jens M. Bruun, Aina S. Lihn, Steen B. Pedersen and Bjørn Richelsen

Department of Endocrinology and Metabolism C, Aarhus University Hospital, Aarhus Sygehus, Tage Hansensgade 2, DK-8000 Aarhus C, Denmark

Address all correspondence and requests for reprints to: Jens M. Bruun, M.D., Department of Endocrinology and Metabolism, Aarhus University Hospital, Aarhus Sygehus, Tage Hansensgade 2, DK-8000 Aarhus C, Denmark. E-mail: Jens.Bruun{at}ki.au.dk.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Human adipose tissue (AT) produces several adipokines including monocyte chemoattractant protein (MCP)-1, involved in the pathogenesis of atherosclerosis.

Objective: Human AT cultures, isolated adipocytes, and stromal-vascular cells were used to investigate the relationship among AT-resident macrophages, MCP-1, and adiposity and the regulation of MCP-1.

Results: mRNA levels of specific macrophage markers (CD68 and CD14) are correlated with adiposity in sc AT and visceral AT (P < 0.05). MCP-1 production is higher in stromal-vascular cells vs. adipocytes (P < 0.01) and correlates with macrophage markers in both AT compartments (P < 0.05). MCP-1 release is higher in obese subjects (P < 0.05) and in VAT (P < 0.01), but after adjusting for AT-resident macrophages, the differences disappear. MCP-1 is stimulated by IL-1ß, TNF-{alpha}, IL-8, IL-4, and IL-6 + IL-6-soluble receptor and is decreased by dexamethasone, IL-10, metformin, and thiazolidinediones.

Discussion: MCP-1 is correlated with specific macrophage markers, adiposity, and AT localization, but the relationship seems to be related to the number of AT-resident macrophages. Despite this, MCP-1 may be involved in obesity-related health complications, and the decrease of MCP-1 by metformin and thiazolidinediones suggests that these antidiabetic compounds have antiinflammatory properties improving the low-grade inflammatory state observed in obesity.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
OBESITY, ESPECIALLY VISCERAL obesity, is associated with a low-grade inflammatory state (1) insulin resistance, development of type 2 diabetes, and premature atherosclerosis (2). Although no clear link has been established between obesity and the associated deleterious health complications, accumulating evidence suggests the involvement of adipose tissue (AT)-derived proteins, collectively known as adipokines [e.g. adiponectin (3), IL-6 (4), IL-8 (5, 6), and TNF-{alpha} (7)]. The production and release of IL-6 (8) and IL-8 (9) have previously been reported to be increased in the visceral AT (VAT) depot and in relation to obesity; recently, the antiinflammatory adipokine, adiponectin, was found to be lower in VAT compared with sc AT (SAT) (10), suggesting that the VAT depot is more proinflammatory. Except for leptin and adiponectin, adipokines are not exclusively produced by the adipocytes, but inflammatory cells such as monocytes and macrophages within the AT may contribute to the production (11, 12).

The chemokine monocyte chemoattractant protein (MCP)-1 has recently been added to the growing list of adipokines (13). MCP-1 has been shown to be produced by macrophages and endothelial cells via an activation of the nuclear transcription factor-{kappa}B pathway (14). MCP-1 recruits monocytes, leukocytes, and other inflammatory cells in response to an inflammatory challenge (15). Circulating MCP-1 has been found to be increased in animal models of obesity (ob/ob mice and diet-induced obesity mice) compared with lean littermates (16, 17) and reduced after weight loss (17). In humans, circulating MCP-1 has been found to be associated with cardiovascular disease (18) and is elevated in type 2 diabetic patients compared with nondiabetics (19). Recently, we found that MCP-1 mRNA levels in human AT samples correlated with measures of adiposity and that circulating MCP-1 was reduced after weight loss in severely obese subjects (20).

A growing body of evidence suggests that inflammatory processes are involved in the pathogenesis of atherosclerosis and cardiovascular disease (21). Blockade of MCP-1 through transfection of an N-terminal deletion mutant in the MCP-1 gene decreased progression of atherosclerosis in apolipoprotein E-knockout mice prone to develop severe cardiovascular disease (22). In mice with diet-induced obesity, elevated MCP-1 levels were found to be associated with an increase in activated (CD11b-positive) monocytes (17) and uptake of oxidized LDL in monocytes through activation of scavenger receptors (23), supporting the hypothesis that MCP-1 may play an important role in the atherosclerotic process within the vessel wall (24). In vitro, high glucose (up to 35 mM) increased MCP-1 production in human vascular endothelial cells (25), and MCP-1 blunted the insulin-stimulated glucose uptake in 3T3-L1 adipocytes (16), suggesting an involvement of MCP-1 in obesity-related insulin resistance.

Because AT-derived MCP-1 is known to originate from adipocytes and stromal-vascular (SV) cells, the relationship among MCP-1, adiposity, and macrophages resident in whole-human AT cultures was investigated in two AT depots using two known macrophage-specific markers: CD68 (26) and CD14 (27). Secondly, mRNA levels of MCP-1 and other adipokines [e.g. TNF-{alpha}, IL-6, and IL-8] were compared with mRNA levels of CD68, CD14, and the adipocyte-specific protein leptin in isolated human adipocytes and the adjacent SV fraction. Finally, the regulation of MCP-1 release in relation to adiposity, AT localization, other adipokines, and antidiabetic compounds [e.g. thiazolidinediones (TZDs) and metformin] were investigated in whole human AT cultures.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects

SAT was obtained from 15 healthy normal to overweight women [mean body mass index (BMI), 24.6 ± 1.3 kg/m2] and from five obese subjects (four males and one female; mean BMI, 39.9 ± 1.4 kg/m2). Paired VAT and SAT samples were obtained from five normal to overweight women (mean BMI, 25.1 ± 1.3 kg/m2) undergoing surgery due to gynecological diseases and from five obese women (mean BMI, 43.0 ± 3.3 kg/m2) undergoing laparoscopic adjustable silicone gastric band surgery for the treatment of morbid obesity. None of the subjects received any medication known to influence AT metabolism.

Isolated adipocytes and whole AT cultures

As described (5), the AT was transported to the laboratory and washed several times in isotonic NaCl. Adipocytes were isolated by collagenase digestion (0.15 mg/g AT) of AT fragments in 10 mmol/liter HEPES buffer for 45–60 min at 37 C. The isolated adipocytes were washed three times in buffer containing 5% albumin. The isolated adipocytes were resuspended in medium 199 containing 1% BSA and 25 mM HEPES. Finally, the 200-µl cell suspension containing 10% adipose cells, corresponding to approximately 100,000 adipocytes in each tube, was snap-frozen in liquid nitrogen and kept at –80 C for later RNA extraction. After the initial collagenase digestion, the SV fraction remaining was centrifuged for 15 min at 6300 x g, resuspended in 9 ml buffer, and filtered through a nylon mesh. This procedure was repeated three times, after which the supernatant was removed, and the SV fraction was snap-frozen in liquid nitrogen and kept at –80 C for later RNA extraction. For the whole AT incubations, a total amount of 500 mg AT was minced into fragments less than 10 mg. AT fragments were preincubated overnight (for ~15 h) and incubated for up to 72 h because a maximal effect of IL-1ß-stimulated MCP-1 release was observed at that time point (P < 0.001, data not shown).

AT was incubated with IL-1ß (2 µg/liter), TNF-{alpha} (10 µg/liter), dexamethasone (50 nM), IL-6 (50 µg/liter), IL-6 (50 µg/liter), plus the IL-6 soluble receptor (IL-6sR) (100 µg/liter), IL-8 (1 mg/liter), IL-10 (10 µg/liter), or IL-4 (10 µg/liter). Separate incubations using IL-6 alone or IL-6 + IL-6sR were chosen because studies have shown that incubation with IL-6 + IL-6sR but not IL-6 elicits biological effects in human AT (28, 29, 30). In addition, AT was incubated with metformin (0.1, 1, or 10 mM), TZDs, and peroxisome proliferator-activated receptor (PPAR)-{gamma} agonists: ciglitazone (50 µM), troglitazone (10 µM), pioglitazone (10 µM), or the PPAR{alpha} agonist 5,8,11,14-eicosatetraynoic acid (ETYA) (15 µM). All incubations were performed as duplicates. Culture medium from the different incubations was kept at –20 C until protein analysis, and the AT fragments were snap-frozen in liquid nitrogen and kept at –80 C for later RNA extraction.

MCP-1 protein

MCP-1 protein levels were assessed using a specific human ELISA method (MCP-1 DuoSet; R&D Systems Europe Ltd., Abingdon, UK) with an intraassay coefficient of variation of 8.1% (n = 12). Samples were diluted 1:100 to be within the assay range (31.2–1000 ng/liter). The amount of protein in the medium from paired SAT and VAT incubations was normalized for cellular DNA content as previously described (31).

Determination of mRNA levels

For mRNA determination, the following oligonucleotide primer pairs were used: MCP-1, 5' CGACATCCTGGAACTGCCCTACC 3' and 5' CACTGTGCCGCTCTCGTTCAC 3'; TNF-{alpha}, 5' CGAGTGACAAGCCTGTAGC 3' and 5' GGTGTGGGTGAGGAGCACAT 3'; IL-8, 5' TTGGCAGCCTTCCTGATTTC 3' and 5' AACTTCTCCACAACCCTCTG 3'; IL-6, 5' AAATGCCAGCCTGCTGACGAAG 3' and 5' AACAACAATCTGAGGTGCCCATGCTAC 3'; leptin, 5' GATGACACCAAAACCCTCATC 3' and 5' GCCACCACCTCTGTGGAGTAG 3'; CD68, 5' GCTACATGGCGGTGGAGTACAA 3' and 5' ATGATGAGAGGCAGCAAGATGG 3'; and CD14, 5' TAAAGGACTGCCAGCCAAGC 3' and 5' AGCCAAGGCAGTTTGAGTCC 3'. ß-Actin was used as housekeeping gene: 5'ACGGGGTCACCCACACTGTGC 3' and 5'CTAGAAGCATTTGCGGTGGACGATG 3'.

RNA was isolated from 250 mg AT using Trizol reagents (Life Technologies, Inc., Roskilde, Denmark). cDNA was made with random hexamer primers using the GeneAmp PCR kit (Applied Biosystems, Foster City, CA). When using the number of threshold cycles (CT) as indications of the amount of mRNA in the adipocyte and SV fractions, no difference was found (24.8 ± 0.7 CT vs. 24.0 ± 0.3 CT, P = 0.32). Quantification of target gene (MCP-1, TNF-{alpha}, IL-6, IL-8, leptin, CD68, or CD14) mRNA was expressed relative to the housekeeping gene (ß-actin) mRNA, except in Fig. 3DGo, where MCP-1 was the target gene and CD68 was used as a housekeeping gene to evaluate the impact of resident macrophages on MCP-1 mRNA levels in the different AT depots. Quantification was performed with a SYBR-Green real-time PCR assay using an iCycler PCR machine from Bio-Rad (Hercules, CA) as previously described (32). In brief, PCR amplification was performed with PCR master mix-containing target primers, Hot Star Taq DNA polymerase, and SYBR-Green and PCR buffer. All samples were determined as duplicates. Samples were incubated for an initial denaturation at 95 C for 10 min, followed by 40 PCR cycles each consisting of 95 C for 30 sec, 57 C for 30 sec, and 74 C for 60 sec. Relative gene expression of MCP-1, TNF-{alpha}, IL-6, IL-8, leptin, CD68, or CD14 to ß-actin was calculated as described in User Bulletin no. 2 (1997) from PerkinElmer Cetus (Norwalk, CT).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3. MCP-1 release and relationship between MCP-1 and CD68 production in SAT and VAT. MCP-1 protein levels (A), MCP-1 mRNA levels (B), and CD68 mRNA levels (C). As described in Subjects and Methods, MCP-1 mRNA quantification was done relative to CD68 mRNA to evaluate the impact of resident macrophages on MCP-1 mRNA levels in the two AT depots (D). All investigations were performed in whole AT cultures obtained from the SAT or VAT depot from lean (mean BMI, 24 kg/m2, n = 5) and obese (mean BMI, 47 kg/m2, n = 5) subjects and incubated for 72 h. Data represent mean values ± SEM. *, P < 0.05; **, P < 0.01 (SAT vs. VAT); #, P < 0.05; ##, P < 0.01 (lean vs. obese).

 
Statistical analysis

The SPSS statistical packet (SPSS, Chicago, IL) was used for the calculations. Normality was tested using the Kolmogorov-Smirnov test. The association between AT-resident macrophages and adiposity was investigated using the Pearson correlation coefficient (rp). When comparing AT incubations from different subjects as well as AT incubations from subjects with different degrees of adiposity, an unpaired Student’s t test was applied. When comparing AT depots from the same individual, a paired t test was applied. Because comparison between adipocyte fractions vs. SV fraction from the same individual did not pass the normality test, a nonparametric Mann-Whitney test was applied. Threshold for significance was set at P < 0.05.

Ethics

Informed, written consent was obtained from all subjects. The Ethical Committee of Aarhus approved the study.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
AT-resident macrophages, MCP-1, and adiposity

The macrophage-specific markers CD68 and CD14 were significantly associated with adiposity (rp = 0.63, P < 0.05, Fig. 1AGo) and (rp = 0.56, P < 0.05, Fig. 1AGo) in SAT. Similar results were obtained in VAT (CD68, rp = 0.78, P < 0.01; CD14, rp = 0.81, P < 0.01; data not shown). In the SAT depot, MCP-1 mRNA levels correlated with mRNA levels of CD68 (rp = 0.66, P < 0.01, Fig. 1BGo) and CD14 (rp = 0.55, P < 0.05, Fig. 1BGo). In VAT MCP-1 correlated with CD68 (P < 0.05, data not shown), but the association with CD14 did not reach statistical significance in that depot (P = 0.07, data not shown).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1. Correlation between macrophage-specific markers, adiposity, and MCP-1. Correlation between mRNA levels of the macrophage-specific markers, CD68 and CD14, and BMI (kilograms per meter squared) (A) or MCP-1 mRNA levels (B) in SAT biopsies. n = 15, with a BMI range of 21.5–49.8 kg/m2. Bivariate correlation with rp.

 
Isolated adipocytes vs. SV fraction

Leptin mRNA levels in the SV fraction were approximately 1% of that in the isolated adipocyte fraction (P < 0.01, Fig. 2Go). Opposite to leptin, mRNA levels of the macrophage-specific markers CD68 and CD14 in the adipocyte fraction were approximately 2% of that in the SV fraction (P < 0.001, Fig. 2Go). MCP-1, IL-6, and IL-8 mRNA levels in isolated adipocytes were between 10 and 15% of that in the SV fraction (P < 0.001, Fig. 2Go). TNF-{alpha} mRNA levels in isolated adipocytes were approximately 5% of that in the SV fraction (P < 0.001, Fig. 2Go). The observation that CD68 and CD14 mRNA were detectable in the adipocyte fraction and leptin mRNA in the SV fraction might be due to minor contamination with mature adipocytes and macrophages, respectively.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2. Adipokine production in adipocytes vs. SV cells. Adipokine (MCP-1, IL-6, and IL-8) mRNA levels in the adipocyte fraction vs. the SV fraction of human AT was compared with that of the adipocyte-specific marker leptin and macrophage-specific markers CD68 and CD14. Due to the high expression of TNF-{alpha} in the SV fraction, this adipokine is presented as an insert. Data represent mean values ± SEM (n = 9). **, P < 0.01; ***, P < 0.001; adipocyte fraction vs. SV fraction.

 
Effects of adiposity and AT localization

MCP-1 release from AT obtained from obese subjects was about 7-fold higher compared with AT from lean subjects (1.0 ± 0.3 µg protein/µg DNA vs. 0.2 ± 0.03 µg protein/µg DNA, P < 0.01, Fig. 3AGo). VAT displayed a 2-fold higher MCP-1 release compared with SAT in both lean (P < 0.01, Fig. 3AGo) and obese (P < 0.05, Fig. 3AGo) subjects. Similar results were obtained for MCP-1 and CD68 mRNA levels in the two compartments (Fig. 3Go, B and C). When looking at the relationship between CD68 and MCP-1 mRNA levels, the impact of obesity and AT localization disappeared (Fig. 3DGo).

Effects of cytokines on MCP-1 release

The proinflammatory cytokines IL-1ß and TNF-{alpha} increased MCP-1 release by more than 2-fold (P < 0.001, Fig. 4Go) in the AT. IL-6 + IL-6sR, IL-8, and IL-4 increased MCP-1 release by 20–30% (P < 0.05, Fig. 4Go). Dexamethasone and IL-10 exerted antiinflammatory effects on MCP-1, reducing the release by approximately 25% (P < 0.001, Fig. 4Go).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 4. Regulation of MCP-1 release in whole AT cultures. Human AT cultures were incubated with IL-1ß (2 µg/liter), TNF-{alpha} (10 µg/liter), dexamethasone (Dexa; 50 nM), IL-6 (50 µg/liter), IL-6 (50 µg/liter) plus IL-6sR (100 µg/liter), IL-8 (1 mg/liter), IL-10 (10 µg/liter), or IL-4 (10 µg/liter) for 48 h. Data represent mean values ± SEM (n = 6). *, P < 0.05; ***, P < 0.001 compared with control incubations.

 
Effects of antidiabetic compounds

In SAT incubations, metformin decreased MCP-1 release in a dose-dependent manner by up to 40% (P < 0.01, Fig. 5AGo). The TZDs and PPAR{gamma} agonists ciglitazone, pioglitazone, and troglitazone decreased MCP-1 release by up to 20% (P < 0.01, Fig 5BGo), but the PPAR{alpha} agonist ETYA had no effect on MCP-1 release (Fig. 5BGo). In the VAT depot, MCP-1 release was decreased by metformin (P < 0.05, data not shown) and troglitazone (P < 0.05, data not shown) to the same extent as found in the SAT samples.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 5. Regulation of MCP-1 release by antidiabetic compounds. Human SAT was incubated with: A, metformin (0.1, 1, or 10 mM); and B, TZDs [ciglitazone (Cig; 50 µM), troglitazone (Trog; 10 µM), pioglitazone (Pio; 10 µM), or ETYA (15 µM)] for 48 h. Data represent mean values ± SEM (n = 6). *, P < 0.05; **, P < 0.01 compared with control incubations.

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
In the present paper, the regulation of AT-derived MCP-1 and the involvement of AT-resident macrophages were studied in human AT in vitro. It is demonstrated for the first time that MCP-1 release is higher in obese compared with lean subjects and in VAT compared with SAT. Interestingly, the relationship between MCP-1, adiposity, and AT localization disappears after adjusting for AT-resident macrophages using the macrophage-specific marker CD68. The finding that MCP-1 release is higher in the VAT depot is in accordance with reports on other adipokines, IL-6 (8), and IL-8 (9). However, we have recently reported that the association between IL-8 and adiposity in SAT samples was attributable to SV cells rather than adipocytes (9). Taken together with the finding that approximately 10–15% of MCP-1, IL-6, and IL-8 is derived from the adipocyte fraction compared with the SV fraction, it suggests that the higher production and release of IL-6 and IL-8 in relation to obesity and AT localization may be related to an increased number of macrophages resident in the human AT under these conditions.

MCP-1 release from whole AT cultures was highly regulated and increased by proinflammatory cytokines and chemokines such as IL-1ß, TNF-{alpha}, IL-4, and IL-8, and decreased by the antiinflammatory cytokine IL-10 and the corticosteroid, dexamethasone. The effects of IL-1ß and TNF-{alpha} are similar to the effects reported in other cell-types (33, 34). Interestingly, when IL-6 was incubated with its soluble receptor (IL-6sR), it displayed proinflammatory properties increasing MCP-1 release, whereas incubation with IL-6 alone was without any effect on MCP-1 release. This finding is somewhat in contrast to a recent report where incubation with IL-6 alone increased MCP-1 production in 3T3-L1 adipocytes (34). However, the discrepancy may be related to differences in model system (e.g. murine 3T3-L1 adipocytes vs. whole human AT cultures) (29), and we have previously demonstrated that coincubation with IL-6sR seems to be necessary in the latter in vitro model using human AT (30). The findings presented suggest that the higher MCP-1 release from obese subjects may be the result of paracrine activation within the AT by other adipokines also known to be elevated in the obese state (9, 35, 36).

Antidiabetic compounds such as TZDs are known to decrease MCP-1 production in human vascular endothelial cells (33), epithelial cells (37), and plasma from obese subjects (38), probably by inhibition or decrease in the generation of reactive oxygen species acting through intracellular pathways such as the nuclear transcription factor-{kappa}B (38) or the p38 MAPK (25). In the present paper, it is demonstrated for the first time that oral antidiabetic agents such as TZDs (e.g. ciglitazone, troglitazone, and pioglitazone) and the biguanide, metformin, reduce MCP-1 release in SAT and VAT. The in vitro findings are in line with two recent papers in which obese type 2 diabetic subjects treated with rosiglitazone or obese nondiabetic subjects treated with metformin displayed a significant reduction in the inflammatory markers MCP-1 and migration inhibitory factor (MIF)-1 (39, 40). TZDs and metformin are used in the treatment of obesity-related type 2 diabetes, and the agreement between the in vitro results presented in the present paper and the in vivo results (39, 40) further substantiate an antiinflammatory effect of these compounds. Both MCP-1 and MIF-1 are suggested to be involved in the development of atherosclerosis (41), suggesting that treatment with these antidiabetic agents may be of therapeutic value beyond glycemic control.

The finding that MCP-1, IL-6, and IL-8 production is approximately 7- to 8-fold higher in the SV fraction compared with the adipocyte fraction is essentially in line with a recent report on IL-6 and IL-8 release in these two AT fractions (11). By the use of macrophage-specific markers (e.g. CD68 and CD14), a novel association was found between AT-resident macrophages and adiposity in VAT samples. In addition, a correlation was found between macrophage markers and adiposity in SAT samples, which essentially is in accordance with two recent papers (26, 42). The background for the increased macrophage infiltration of the human AT in obesity is still not elucidated. However, circulating mononuclear cells from obese subjects are in a proinflammatory state (higher production of TNF-{alpha}, IL-6, and MIF-1) (43), implicating that these cells when trapped in the AT may be part of the inflammatory process within the AT. The adipokines MCP-1 and IL-8 have the ability to attract monocytes/macrophages (44), and their receptors are expressed in both the adipocyte fraction and the SV fraction of human AT (13), suggesting that the two chemokines may be of importance in the recruitment/attraction of monocytes to the AT as indicated by Wiesberg et al. (26). However, the relationship and interaction between MCP-1 and IL-8 from the adipocyte fraction and the SV fraction including the impact of adipocytes from obese vs. lean subjects requires further investigations.

In conclusion, the present paper demonstrates that MCP-1 is produced in both the adipocyte fraction and the SV fraction of human AT. MCP-1 release is higher in obese subjects and in VAT although the MCP-1 production seems to be attributable to the number of macrophages resident in the AT. However, regardless from which cell types within the AT theses adipokines are derived, visceral obesity is associated with a general low-grade inflammatory process and an increased risk of developing type 2 diabetes and cardiovascular disease (1, 2, 44), and the attenuation of MCP-1 release by the antidiabetic compounds, metformin, and TZDs supports the hypothesis that these compounds have antiinflammatory properties improving the low-grade inflammatory state observed in obesity.


    Acknowledgments
 
We thank Lenette Pedersen and Pia Hornbek for technical assistance.


    Footnotes
 
This work was supported by the Novo Nordic Foundation, by the Konsul J. Fogh-Nielsens Legat, by Aarhus University, and by The Danish Medical Research Council (22-02-0527 to J.M.B.).

First Published Online January 25, 2005

Abbreviations: AT, Adipose tissue; BMI, body mass index; CT, threshold cycle; ETYA, 5,8,11,14-eicosatetraynoic acid; IL-6sR, IL-6 soluble receptor; MCP, monocyte chemoattractant protein; MIF, migration inhibitory factor; PPAR, peroxisome proliferator-activated receptor; rp, Pearson correlation coefficient; SAT, sc AT; SV, stromal-vascular; TZD, thiazolidinedione; VAT, visceral AT.

Received August 30, 2004.

Accepted January 14, 2005.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Dandona P, Aljada A, Bandyopadhyay A 2004 Inflammation: the link between insulin resistance, obesity and diabetes. Trends Immunol 25:4–7[CrossRef][Medline]
  2. Despres JP, Lemieux I, Prud’homme D 2001 Treatment of obesity: need to focus on high risk abdominally obese patients. BMJ 322:716–720.[Free Full Text]
  3. Hotta K, Funahashi T, Arita Y, Takahashi M, Matsuda M, Okamoto Y, Iwahashi H, Kuriyama H, Ouchi N, Maeda K, Nishida M, Kihara S, Sakai N, Nakajima T, Hasegawa K, Muraguchi M, Ohmoto Y, Nakamura T, Yamashita S, Hanafusa T, Matsuzawa Y 2000 Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb Vasc Biol 20:1595–1599[Abstract/Free Full Text]
  4. Kern PA, Ranganathan S, Li C, Wood L, Ranganathan G 2001 Adipose tissue tumor necrosis factor and interleukin-6 expression in human obesity and insulin resistance. Am J Physiol Endocrinol Metab 280:E745–E751
  5. Bruun JM, Pedersen SB, Richelsen B 2001 Regulation of interleukin 8 production and gene expression in human adipose tissue in vitro. J Clin Endocrinol Metab 86:1267–1273[Abstract/Free Full Text]
  6. Straczkowski M, Dzienis-Straczkowska S, Stepien A, Kowalska I, Szelachowska M, Kinalska I 2002 Plasma interleukin-8 concentrations are increased in obese subjects and related to fat mass and tumor necrosis factor-{alpha} system. J Clin Endocrinol Metab 87:4602–4606[Abstract/Free Full Text]
  7. Hotamisligil GS, Spiegelman BM 1994 Tumor necrosis factor {alpha}: a key component of the obesity-diabetes link. Diabetes 43:1271–1278[Abstract]
  8. Fried SK, Bunkin DA, Greenberg AS 1998 Omental and subcutaneous adipose tissues of obese subjects release interleukin-6: depot difference and regulation by glucocorticoid. J Clin Endocrinol Metab 83:847–850[Abstract/Free Full Text]
  9. Bruun JM, Lihn AS, Madan AK, Pedersen SB, Schiott KM, Fain JN, Richelsen B. 2004 Higher production of IL-8 in visceral vs. subcutaneous adipose tissue. Implication of nonadipose cells in adipose tissue. Am J Physiol Endocrinol Metab 286:E8–E13
  10. Lihn AS, Bruun JM, He G, Pedersen SB, Jensen PF, Richelsen B 2004 Lower expression of adiponectin mRNA in visceral adipose tissue in lean and obese subjects. Mol Cell Endocrinol 219:9–15[CrossRef][Medline]
  11. Fain JN, Cheema PS, Bahouth SW, Lloyd HM 2003 Resistin release by human adipose tissue explants in primary culture. Biochem Biophys Res Commun 300:674–678[CrossRef][Medline]
  12. Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, Sole J, Nichols A, Ross JS, Tartaglia LA, Chen H 2003 Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. J Clin Invest 112:1821–1830[CrossRef][Medline]
  13. Gerhardt CC, Romero IA, Cancello R, Camoin L, Strosberg AD 2001 Chemokines control fat accumulation and leptin secretion by cultured human adipocytes. Mol Cell Endocrinol 175:81–92[CrossRef][Medline]
  14. Baldwin AS 2001 Jan Series introduction: the transcription factor NF-{kappa}B and human disease. J Clin Invest 107:3–6[CrossRef][Medline]
  15. Terkeltaub R, Boisvert WA, Curtiss LK 1998 Chemokines and atherosclerosis. Curr Opin Lipidol 9:397–405[CrossRef][Medline]
  16. Sartipy P, Loskutoff DJ 2003 Monocyte chemoattractant protein 1 in obesity and insulin resistance. Proc Natl Acad Sci USA 100:7265–7270[Abstract/Free Full Text]
  17. Takahashi K, Mizuarai S, Araki H, Mashiko S, Ishihara A, Kanatani A, Itadani H, Kotani H 2003 Adiposity elevates plasma MCP-1 levels leading to the increased CD11b-positive monocytes in mice. J Biol Chem 278:46654–46660[Abstract/Free Full Text]
  18. de Lemos JA, Morrow DA, Sabatine MS, Murphy SA, Gibson CM, Antman EM, McCabe CH, Cannon CP, Braunwald E 2003 Association between plasma levels of monocyte chemoattractant protein-1 and long-term clinical outcomes in patients with acute coronary syndromes. Circulation 107:690–695[Abstract/Free Full Text]
  19. Nomura S, Shouzu A, Omoto S, Nishikawa M, Fukuhara S 2000 Significance of chemokines and activated platelets in patients with diabetes. Clin Exp Immunol 121:437–443[CrossRef][Medline]
  20. Christiansen T, Richelsen B, Bruun JM 2005 Monocyte chemoattractant protein-1 is produced in isolated adipocytes, associated with adiposity and reduced after weight loss in morbid obese subjects. Int J Obes Relat Metab Disord 29:146–150[CrossRef][Medline]
  21. Ross R 1986 The pathogenesis of atherosclerosis: an update. N Engl J Med 314:488–500[Medline]
  22. Inoue S, Egashira K, Ni W, Kitamoto S, Usui M, Otani K, Ishibashi M, Hiasa K, Nishida K, Takeshita A 2002 Anti-monocyte chemoattractant protein-1 gene therapy limits progression and destabilization of established atherosclerosis in apolipoprotein E-knockout mice. Circulation 106:2700–2706[Abstract/Free Full Text]
  23. Tabata T, Mine S, Kawahara C, Okada Y, Tanaka Y 2003 Monocyte chemoattractant protein-1 induces scavenger receptor expression and monocyte differentiation into foam cells. Biochem Biophys Res Commun 305:380–385[CrossRef][Medline]
  24. Shin WS, Szuba A, Rockson SG 2002 The role of chemokines in human cardiovascular pathology: enhanced biological insights. Atherosclerosis 160:91–102[CrossRef][Medline]
  25. Takaishi H, Taniguchi T, Takahashi A, Ishikawa Y, Yokoyama M 2003 High glucose accelerates MCP-1 production via p38 MAPK in vascular endothelial cells. Biochem Biophys Res Commun 305:122–128[CrossRef][Medline]
  26. Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL, Ferrante Jr AW 2003 Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest 112:1796–1808[CrossRef][Medline]
  27. Chen SP, Cheung W, Heng CK, Jordan SC, Yap HK 2003 Childhood nephrotic syndrome in relapse is associated with down-regulation of monocyte CD14 expression and lipopolysaccharide-induced tumour necrosis factor-{alpha} production. Clin Exp Immunol 134:111–119[CrossRef][Medline]
  28. Crichton MB, Nichols JE, Zhao Y, Bulun SE, Simpson ER 1996 Expression of transcripts of interleukin-6 and related cytokines by human breast tumors, breast cancer cells, and adipose stromal cells. Mol Cell Endocrinol 118:215–220[CrossRef][Medline]
  29. Jones SA, Rose-John S 2002 The role of soluble receptors in cytokine biology: the agonistic properties of the sIL-6R/IL-6 complex. Biochim Biophys Acta 1592:251–263[Medline]
  30. Bruun JM, Lihn AS, Verdich C, Pedersen SB, Toubro S, Astrup A, Richelsen B 2003 Regulation of adiponectin by adipose tissue-derived cytokines: in vivo and in vitro investigations in humans. Am J Physiol Endocrinol Metab 285:E527–E533
  31. Kato F, Tanaka M, Nakamura K 1999 Rapid fluorometric assay for cell viability and cell growth using nucleic acid staining and cell lysis agents. Tox In Vitro 13:923–929[CrossRef]
  32. Bruun JM, Pedersen SB, Richelsen B 2000 Interleukin-8 production in human adipose tissue. Inhibitory effects of anti-diabetic compounds, the thiazolidinedione ciglitazone and the biguanide metformin. Horm Metab Res 32:537–541[Medline]
  33. Murao K, Imachi H, Momoi A, Sayo Y, Hosokawa H, Sato M, Ishida T, Takahara J 1999 Thiazolidinedione inhibits the production of monocyte chemoattractant protein-1 in cytokine-treated human vascular endothelial cells. FEBS Lett 454:27–30[CrossRef][Medline]
  34. Fasshauer M, Klein J, Kralisch S, Klier M, Lossner U, Bluher M, Paschke R 2004 Monocyte chemoattractant protein 1 expression is stimulated by growth hormone and interleukin-6 in 3T3–L1 adipocytes. Biochem Biophys Res Commun 317:598–604[CrossRef][Medline]
  35. Hotamisligil GS, Arner P, Caro JF, Atkinson RL, Spiegelman BM 1995 Increased adipose tissue expression of tumor necrosis factor-{alpha} in human obesity and insulin resistance. J Clin Invest 95:2409–2415
  36. Bastard JP, Jardel C, Bruckert E, Blondy P, Capeau J, Laville M, Vidal H, Hainque B 2000 Elevated levels of interleukin 6 are reduced in serum and subcutaneous adipose tissue of obese women after weight loss. J Clin Endocrinol Metab 85:3338–3342[Abstract/Free Full Text]
  37. Momoi A, Murao K, Imachi H, Ishida T, Cao WM, Sato M, Takahara J 2001 Inhibition of monocyte chemoattractant protein-1 expression in cytokine-treated human lung epithelial cells by thiazolidinedione. Chest 120:1293–1300[Abstract/Free Full Text]
  38. Ghanim H, Garg R, Aljada A, Mohanty P, Kumbkarni Y, Assian E, Hamouda W, Dandona P 2001 Suppression of nuclear factor-{kappa}B and stimulation of inhibitor {kappa}B by troglitazone: evidence for an anti-inflammatory effect and a potential antiatherosclerotic effect in the obese. J Clin Endocrinol Metab 86:1306–1312[Abstract/Free Full Text]
  39. Dandona P, Aljada A, Ghanim H, Mohanty P, Tripathy C, Hofmeyer D, Chaudhuri A 2004 Increased plasma concentration of macrophage migration inhibitory factor (MIF) and MIF mRNA in mononuclear cells in the obese and the suppressive action of metformin. J Clin Endocrinol Metab 89:5043–5047[Abstract/Free Full Text]
  40. Mohanty P, Aljada A, Ghanim H, Hofmeyer D, Tripathy D, Syed T, Al-Haddad W, Dhindsa S, Dandona P 2004 Evidence for a potent antiinflammatory effect of rosiglitazone. J Clin Endocrinol Metab 89:2728–2735[Abstract/Free Full Text]
  41. Hsueh WA, Law RE 2001 PPAR{gamma} and atherosclerosis: effects on cell growth and movement. Arterioscler Thromb Vasc Biol 21:1891–1895[Abstract/Free Full Text]
  42. Curat CA, Miranville A, Sengenes C, Diehl M, Tonus C, Busse R, Bouloumie A 2004 From blood monocytes to adipose tissue-resident macrophages: induction of diapedesis by human mature adipocytes. Diabetes 53:1285–1292[Abstract/Free Full Text]
  43. Ghanim H, Aljada A, Hofmeyer D, Syed T, Mohanty P, Dandona P 2004 Circulating mononuclear cells in the obese are in a proinflammatory state. Circulation 110:1564–1571[Abstract/Free Full Text]
  44. Boisvert WA 2004 Modulation of atherogenesis by chemokines. Trends Cardiovasc Med 14:161–165[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
J. C. Strum, J. H. Johnson, J. Ward, H. Xie, J. Feild, A. Hester, A. Alford, and K. M. Waters
MicroRNA 132 Regulates Nutritional Stress-Induced Chemokine Production through Repression of SirT1
Mol. Endocrinol., November 1, 2009; 23(11): 1876 - 1884.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S. Asamizu, M. Urakaze, C. Kobashi, M. Ishiki, A. K. Norel Din, S. Fujisaka, Y. Kanatani, A. Bukahari, S. Senda, H. Suzuki, et al.
Angiotensin II enhances the increase in monocyte chemoattractant protein-1 production induced by tumor necrosis factor-{alpha} from 3T3-L1 preadipocytes
J. Endocrinol., August 1, 2009; 202(2): 199 - 205.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
S. Sam, S. Haffner, M. H. Davidson, R. B. D'Agostino Sr., S. Feinstein, G. Kondos, A. Perez, and T. Mazzone
Relation of Abdominal Fat Depots to Systemic Markers of Inflammation in Type 2 Diabetes
Diabetes Care, May 1, 2009; 32(5): 932 - 937.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
B.-S. Youn, S.-I. Bang, N. Kloting, J. W. Park, N. Lee, J.-E. Oh, K.-B. Pi, T. H. Lee, K. Ruschke, M. Fasshauer, et al.
Serum Progranulin Concentrations May Be Associated With Macrophage Infiltration Into Omental Adipose Tissue
Diabetes, March 1, 2009; 58(3): 627 - 636.
[Abstract] [Full Text] [PDF]


Home page
JPEN J Parenter Enteral NutrHome page
C. Compher and K. O. Badellino
Obesity and Inflammation: Lessons From Bariatric Surgery
JPEN J Parenter Enteral Nutr, November 1, 2008; 32(6): 645 - 647.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. A. Phillips, T. P. Ciaraldi, Deborah. K. Oh, M. K. Savu, and R. R. Henry
Adiponectin secretion and response to pioglitazone is depot dependent in cultured human adipose tissue
Am J Physiol Endocrinol Metab, October 1, 2008; 295(4): E842 - E850.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Stienstra, C. Duval, S. Keshtkar, J. van der Laak, S. Kersten, and M. Muller
Peroxisome Proliferator-activated Receptor {gamma} Activation Promotes Infiltration of Alternatively Activated Macrophages into Adipose Tissue
J. Biol. Chem., August 15, 2008; 283(33): 22620 - 22627.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Huber, F. W. Kiefer, M. Zeyda, B. Ludvik, G. R. Silberhumer, G. Prager, G. J. Zlabinger, and T. M. Stulnig
CC Chemokine and CC Chemokine Receptor Profiles in Visceral and Subcutaneous Adipose Tissue Are Altered in Human Obesity
J. Clin. Endocrinol. Metab., August 1, 2008; 93(8): 3215 - 3221.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Westerbacka, A. Corner, M. Kolak, J. Makkonen, U. Turpeinen, A. Hamsten, R. M. Fisher, and H. Yki-Jarvinen
Insulin regulation of MCP-1 in human adipose tissue of obese and lean women
Am J Physiol Endocrinol Metab, May 1, 2008; 294(5): E841 - E845.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. Takahashi, S. Yamaguchi, T. Shimoyama, H. Seki, K. Miyokawa, H. Katsuta, T. Tanaka, K. Yoshimoto, H. Ohno, S. Nagamatsu, et al.
JNK- and I{kappa}B-dependent pathways regulate MCP-1 but not adiponectin release from artificially hypertrophied 3T3-L1 adipocytes preloaded with palmitate in vitro
Am J Physiol Endocrinol Metab, May 1, 2008; 294(5): E898 - E909.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
E. L Madsen, A. Rissanen, J. M Bruun, K. Skogstrand, S. Tonstad, D. M Hougaard, and B. Richelsen
Weight loss larger than 10% is needed for general improvement of levels of circulating adiponectin and markers of inflammation in obese subjects: a 3-year weight loss study
Eur. J. Endocrinol., February 1, 2008; 158(2): 179 - 187.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Stokes and A. Surprenant
Purinergic P2Y2 Receptors Induce Increased MCP-1/CCL2 Synthesis and Release from Rat Alveolar and Peritoneal Macrophages
J. Immunol., November 1, 2007; 179(9): 6016 - 6023.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H. R. Zhou, E.-K. Kim, H. Kim, and K. J. Claycombe
Obesity-associated mouse adipose stem cell secretion of monocyte chemotactic protein-1
Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1153 - E1158.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. Y. Kim, Y. Wu, and C. M. Smas
Characterization of ScAP-23, a new cell line from murine subcutaneous adipose tissue, identifies genes for the molecular definition of preadipocytes
Physiol Genomics, October 19, 2007; 31(2): 328 - 342.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
J. M Bruun, B. Stallknecht, J. W Helge, and B. Richelsen
Interleukin-18 in plasma and adipose tissue: effects of obesity, insulin resistance, and weight loss
Eur. J. Endocrinol., October 1, 2007; 157(4): 465 - 471.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. M. Pou, J. M. Massaro, U. Hoffmann, R. S. Vasan, P. Maurovich-Horvat, M. G. Larson, J. F. Keaney Jr, J. B. Meigs, I. Lipinska, S. Kathiresan, et al.
Visceral and Subcutaneous Adipose Tissue Volumes Are Cross-Sectionally Related to Markers of Inflammation and Oxidative Stress: The Framingham Heart Study
Circulation, September 11, 2007; 116(11): 1234 - 1241.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. Maury, K. Ehala-Aleksejev, Y. Guiot, R. Detry, A. Vandenhooft, and S. M. Brichard
Adipokines oversecreted by omental adipose tissue in human obesity
Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E656 - E665.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Murdolo, A. Hammarstedt, M. Sandqvist, M. Schmelz, C. Herder, U. Smith, and P.-A. Jansson
Monocyte Chemoattractant Protein-1 in Subcutaneous Abdominal Adipose Tissue: Characterization of Interstitial Concentration and Regulation of Gene Expression by Insulin
J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2688 - 2695.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Y. Kim, K. Tillison, S. Zhou, Y. Wu, and C. M. Smas
The major facilitator superfamily member Slc37a2 is a novel macrophage- specific gene selectively expressed in obese white adipose tissue
Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E110 - E120.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Harman-Boehm, M. Bluher, H. Redel, N. Sion-Vardy, S. Ovadia, E. Avinoach, I. Shai, N. Kloting, M. Stumvoll, N. Bashan, et al.
Macrophage Infiltration into Omental Versus Subcutaneous Fat across Different Populations: Effect of Regional Adiposity and the Comorbidities of Obesity
J. Clin. Endocrinol. Metab., June 1, 2007; 92(6): 2240 - 2247.
[Abstract] [Full Text] [PDF]


Home page
AMERICAN JOURNAL OF LIFESTYLE MEDICINEHome page
M. G. Flynn, B. K. McFarlin, and M. M. Markofski
State of the Art Reviews: The Anti-Inflammatory Actions of Exercise Training
American Journal of Lifestyle Medicine, May 1, 2007; 1(3): 220 - 235.
[Abstract] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. Fantuzzi and T. Mazzone
Adipose Tissue and Atherosclerosis: Exploring the Connection
Arterioscler Thromb Vasc Biol, May 1, 2007; 27(5): 996 - 1003.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
E.-M. Sedlmeier, H. Grallert, C. Huth, H. Lowel, C. Herder, K. Strassburger, G. Giani, H-E. Wichmann, H. Hauner, T. Illig, et al.
Gene variants of monocyte chemoattractant protein 1 and components of metabolic syndrome in KORA S4, Augsburg
Eur. J. Endocrinol., March 1, 2007; 156(3): 377 - 385.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. M. Sharma and B. Staels
Peroxisome Proliferator-Activated Receptor {gamma} and Adipose Tissue--Understanding Obesity-Related Changes in Regulation of Lipid and Glucose Metabolism
J. Clin. Endocrinol. Metab., February 1, 2007; 92(2): 386 - 395.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. Lacasa, S. Taleb, M. Keophiphath, A. Miranville, and K. Clement
Macrophage-Secreted Factors Impair Human Adipogenesis: Involvement of Proinflammatory State in Preadipocytes
Endocrinology, February 1, 2007; 148(2): 868 - 877.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. K. Brake, E. O. Smith, H. Mersmann, C. W. Smith, and R. L. Robker
ICAM-1 expression in adipose tissue: effects of diet-induced obesity in mice
Am J Physiol Cell Physiol, December 1, 2006; 291(6): C1232 - C1239.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. M. Bruun, J. W. Helge, B. Richelsen, and B. Stallknecht
Diet and exercise reduce low-grade inflammation and macrophage infiltration in adipose tissue but not in skeletal muscle in severely obese subjects
Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E961 - E967.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
V. Sander, C. G. Luchetti, M. E. Solano, E. Elia, G. Di Girolamo, C. Gonzalez, and A. B. Motta
Role of the N, N'-dimethylbiguanide metformin in the treatment of female prepuberal BALB/c mice hyperandrogenized with dehydroepiandrosterone.
Reproduction, March 1, 2006; 131(3): 591 - 602.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
C. Herder, S. Muller-Scholze, P. Rating, W. Koenig, B. Thorand, B. Haastert, R. Holle, T. Illig, W. Rathmann, J. Seissler, et al.
Systemic monocyte chemoattractant protein-1 concentrations are independent of type 2 diabetes or parameters of obesity: results from the Cooperative Health Research in the Region of Augsburg Survey S4 (KORA S4)
Eur. J. Endocrinol., February 1, 2006; 154(2): 311 - 317.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Dahlman, M. Kaaman, T. Olsson, G. D. Tan, A. S. T. Bickerton, K. Wahlen, J. Andersson, E. A. Nordstrom, L. Blomqvist, A. Sjogren, et al.
A Unique Role of Monocyte Chemoattractant Protein 1 among Chemokines in Adipose Tissue of Obese Subjects
J. Clin. Endocrinol. Metab., October 1, 2005; 90(10): 5834 - 5840.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Suganami, J. Nishida, and Y. Ogawa
A Paracrine Loop Between Adipocytes and Macrophages Aggravates Inflammatory Changes: Role of Free Fatty Acids and Tumor Necrosis Factor {alpha}
Arterioscler Thromb Vasc Biol, October 1, 2005; 25(10): 2062 - 2068.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Boschmann, S. Engeli, F. Adams, K. Gorzelniak, G. Franke, S. Klaua, U. Kreuzberg, S. Luedtke, R. Kettritz, A. M. Sharma, et al.
Adipose Tissue Metabolism and CD11b Expression on Monocytes in Obese Hypertensives
Hypertension, July 1, 2005; 46(1): 130 - 136.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. E. Malavazos, E. Cereda, L. Morricone, M. M. Corsi, and B. Ambrosi
Monocyte Chemoattractant Protein-1 in Adipose Tissue
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3128 - 3128.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*METFORMIN HYDROCHLORIDE
Related Collections
Right arrow Metabolism


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals