help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2004-1418
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Semple, R. K.
Right arrow Articles by Aparicio, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Semple, R. K.
Right arrow Articles by Aparicio, S. A.
Related Collections
Right arrow Male Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 3 1849-1855
Copyright © 2005 by The Endocrine Society


CLINICAL CASE SEMINAR

Two Novel Missense Mutations in G Protein-Coupled Receptor 54 in a Patient with Hypogonadotropic Hypogonadism

R. K. Semple, J. C. Achermann, J. Ellery, I. S. Farooqi, F. E. Karet, R. G. Stanhope, S. O’Rahilly and S. A. Aparicio

Department of Clinical Biochemistry (R.K.S., I.S.F., S.O.) and Department of Medical Genetics and Division of Renal Medicine (F.E.K.), Addenbrooke’s Hospital, University of Cambridge, Cambridge CB2 2QQ, United Kingdom; Department of Medicine and Institute of Child Health (J.C.A.), University College London, London WC1N 1EH, United Kingdom; Paradigm Therapeutics Ltd. (J.E., S.A.A.), Cambridge CB4 0WA, United Kingdom; Department of Oncology (S.A.A.), Hutchison Medical Research Council Centre, University of Cambridge, Addenbrookes CB2 2XZ, United Kingdom; and Great Ormond Street Hospital for Children (R.G.S.), London WC1N 3JH, United Kingdom

Address all correspondence and requests for reprints to: Robert Semple, Department of Clinical Biochemistry, Addenbrooke’s Hospital, Cambridge CB2 2QR, United Kingdom. E-mail: rks16{at}cam.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
It has recently been shown that loss-of-function mutations of the G protein-coupled receptor (GPR)54 lead to isolated hypogonadotropic hypogonadism (IHH) in mice and humans. Such mutations are thought to be rare, even within the clinical IHH population, and only a handful of alleles have been described, making further screening of IHH populations imperative. We examined the genes encoding GPR54 and its putative endogenous ligand, kisspeptin-1, for mutations in a cohort of 30 patients with normosmic HH or delayed puberty. One subject with HH, of mixed Turkish-Cypriot and Afro-Caribbean ancestry, was found to be a compound heterozygote for two previously undescribed missense mutations in GPR54: cysteine 223 to arginine (C223R) in the fifth transmembrane helix and arginine 297 to leucine (R297L) in the third extracellular loop. Assessed in vitro using a previously described sensitive signaling assay in cells stably expressing GPR54, the C223R variant was found to exhibit profoundly impaired signaling, whereas the R297L variant showed a mild reduction in ligand-stimulated activity across the ligand dose range. These novel mutations provide further evidence that human HH may be caused by loss-of-function mutations in GPR54.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
HUMAN GONADAL FUNCTION is under the control of the anterior pituitary hormones LH and FSH, the release of which is, in turn, regulated by pulsatile secretion of hypothalamic GnRH. In the first few weeks after birth, this axis is functional, but by around 6 months of age, it becomes quiescent, thus entering the juvenile pause, which persists until puberty. The first detectable event at the initiation of puberty is an upsurge in the amplitude of GnRH pulses, leading to overnight LH pulsatility and subsequent maturation of the rest of the axis at puberty. The mechanisms of the childhood inhibition of GnRH release, and its eventual reactivation, are poorly understood but appear to include peripheral feedback suppression by sex steroids and the actions of ill-defined intrinsic central nervous system pathways (1).

Genetic defects in the hypothalamo-pituitary-gonadal axis are manifested clinically as hypogonadotropic hypogonadism (HH), with either primary failure to undergo puberty or severe delay in the process. Defects may broadly be categorized into those affecting embryonic migration of GnRH-secreting neurones, which lead to anosmia as well as HH (e.g. Kallmann syndrome due to KAL, or FGFR1 mutations), and those affecting the pulsatile release or function of GnRH from neurones that have migrated to their normal position. Patients suffering from the latter are normosmic. Around 40% of patients with autosomal recessive normosmic familial HH in one series were found to have mutations in the GnRH receptor gene, whereas only around 10–17% of sporadic cases are thought to harbor such mutations in GNRHR (2, 3).

In the last year, the G protein-coupled receptor (GPR)54 has been shown to be a gatekeeper gene for activation of the GnRH axis based on loss-of-function mutations in mice and humans. In humans, loss-of-function mutations in GPR54 have been described in two consanguineous pedigrees and two isolated subjects with HH (4, 5) (OMIM 604161). In tandem, mice bearing homozygous targeted disruptions of the Gpr54 gene have been found to exhibit a similar failure of sexual maturation (5). This shows that GPR54 is required for the normal function of this axis and suggests that the ligand, kisspeptin-1, may act as a novel neurohormonal regulator of the GnRH axis. The latter has recently received support from studies showing that peripheral and central administration of kisspeptin provokes GnRH release (6, 7, 8).

We now describe the genetic screening of the GPR54 gene as well as the KISS1 gene encoding its putative endogenous ligand, kisspeptin-1, in a cohort of 30 patients with normosmic HH, and report the clinical phenotype of a nonconsanguineous subject who shows compound heterozygosity for two novel missense mutations in the GPR54 gene. We have also documented the prevalence of single nucleotide polymorphisms (SNPs) in the GPR54 and KISS1 genes, one previously undescribed, in both the study population and a Caucasian control population.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects

Subjects for genetic screening were recruited from the clinics at Great Ormond Street Hospital (London, UK) and Addenbrooke’s Hospital (Cambridge, UK). Informed consent was obtained according to procedures approved by the local research ethics committee of each institution. Patient characteristics are outlined in Table 1Go. Isolated HH was defined as inappropriately low gonadotropin levels together with prepubertal concentrations of sex steroids. It was deemed idiopathic in which no family history of the condition was apparent, and congenital in which undescended testes with or without small penis were noted at birth. Constitutional delay of puberty (CDP) was defined as the absence of signs of puberty at 14 yr of age in boys, this being described as severe if signs were still not apparent at 15 yr. All patients were reportedly normosmic, had otherwise normal anterior pituitary function and no midline facial defects, and showed no evidence of structural brain pathology, where assessed. In all but three cases, the coding sequence of the GnRHR gene had been sequenced and found to be normal.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Description of cohort studied

 
The Caucasian control population used was derived from the Medical Research Council Ely Study cohort, recruited from a population sampling frame with a high response rate (74%), making it representative of an ethnically homogeneous Caucasian population in this area of Eastern England (9, 10). In addition, 50 Afro-Caribbean control subjects were also selected from an independently assembled cohort used in a study of the genetics of obesity. This group was entirely unselected with respect to reproductive and gonadal function, as was a group of 45 Turkish control subjects recruited as part of studies into obesity and renal tubular disease.

Genetic screening

Genomic DNA was isolated from whole blood using a QIAamp blood kit (Qiagen, Crawley, UK), and amplified using a GenomiPhi DNA amplification kit (Amersham Biosciences, Chalfont, UK). PCR was performed using BioTaq (Bioline, London, UK) and carried out as recommended by the manufacturer, with addition of dimethylsulfoxide where indicated. Thirty-five cycles (60 sec at 95 C, 60 sec at the annealing temperature, and 60 sec at 72 C) were performed using a PTC-225 Peltier thermal cycler (MJ Research, Watertown, MA). PCR products were verified electrophoretically and sequenced using ABI BigDye Terminator (version 3.1) reagents with electrophoresis on an ABI Prism 3100-Avant genetic analyzer (PE Applied Biosystems, Foster City, CA). Subsequent sequence analysis was performed using Sequencher software (Gene Codes, Ann Arbor, MI). Primers, annealing temperatures, and concentrations of MgCl2 and dimethylsulfoxide used for PCR are detailed in Table 2Go, together with sequencing primers where different.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Primers and reaction conditions used for sequencing

 
To distinguish compound heterozygosity for the two mutations described from heterozygosity for a double mutation, the GPR54 exon 4 forward primer and exon 5 reverse primer (Table 2Go) were used to amplify exons 4 and 5 and the intervening intron using reaction conditions as for exon 5. The PCR product was then cloned into a pGEM-T Easy Vector (Promega, Southampton, UK), and 16 separate clones were sequenced.

Creation of GPR54 mutant alleles and in vitro functional assays

Wild-type human GPR54 was amplified from human brain cDNA (Origene Technologies, Rockville, MD) using the GC-Rich PCR kit (Roche Diagnostics, Lewes, UK). The 5' primer TAATCAAAGCTTGCGATGCACACCGTGGCTACGTC and 3' primer ACATTAGGATCCTCACTTATCGTCGTCATCCTTGTAATCGAGAGGGGCGTTGTCCTCC (incorporating a 3' sequence encoding the FLAG epitope tag) were used. The resulting product was cloned into pCRBlunt (Invitrogen, Renfrew, UK) and sequence verified. Stable cell lines expressing the wild-type GPR54-FLAG or one of the two mutant species described were then created using the Flp-In system (Invitrogen). In brief, the GPR54-FLAG was subcloned into pcDNA5/FRT and the point mutations were introduced using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer’s instructions. All the resulting constructs were verified by direct sequencing. The Flp-In-293 cell line (Invitrogen) was maintained in DMEM supplemented with 10% Fetal Clone III (Hyclone, Cramlington, UK) and 2 mM L-glutamine. To create stable GPR54-expressing cell lines, Flp-In-293 cells were cotransfected with the pcDNA5/FRT-GPR54-FLAG constructs and the Flp recombinase-expressing plasmid pOG44 using polyfect (Qiagen), with subsequent selection by hygromycin B. Transcription of the inserted alleles was confirmed by RT-PCR (data not shown).

To assess signal transduction by the wild-type and mutant receptors, a sensitive calcium mobilization signaling assay was used as previously described (11, 12, 13), with calcium flux in response to kisspeptin-1 112–121 (Phoenix Pharmaceuticals, Belmont, CA) measured on a FlexStation using a FLIPR calcium assay kit (both from Molecular Devices, Sunnyvale, CA) in response to Kisspeptin-1 112–121 (Phoenix Pharmaceuticals). Data were analyzed using SoftMax Pro software (Molecular Devices). Experiments were performed in duplicate on 2 consecutive days, and SDs are indicated.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Genetic screening

Sequencing of the coding regions of the GPR54 (GenBank accession no. AY253981) and KISS1 (GenBank accession no. AY117143) genes in all 30 patients revealed the presence of two previously described SNPs in the GPR54 gene, and three previously described SNPs, one novel SNP, and one previously described insertional polymorphism in the KISS1 gene. The details of these common variants, and their frequency in both the study population and 180 Caucasian control alleles are shown in Table 3Go.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Prevalence of common sequence variants in GPR54 and KISS1

 
One boy with isolated HH was found to harbor two rare sequence variants in the GPR54 gene (Fig. 1Go): the first, a transversion c.667T>C in exon 4, results in substitution of a cysteine near the cytoplasmic end of the fifth transmembrane {alpha}-helix for arginine (C223R), whereas the second, a transversion c.891G>T in exon 5, leads to the substitution of an arginine in the third extracellular loop for leucine (R297L). Cloning a section of the GPR54 gene encompassing exons 4 and 5 and the intervening intron from the genomic DNA of the proband established that he was a compound heterozygote for these two changes. The cysteine at position 223 is highly conserved in mouse, rat, zebrafish, and pufferfish, whereas R297 is conserved in mouse and rat but not in zebrafish or pufferfish. Neither variant was detected in 180 Caucasian control chromosomes. The proband’s mother and father were of Turkish-Cypriot and Jamaican descent, respectively. Only his mother and younger brother were available for further study, and both were found to be heterozygous for the R297L variant but homozygous wild-type with respect to C223. The C223R variant was thus most likely inherited from his father, although de novo mutation cannot be ruled out. Screening of 100 control Afro-Caribbean alleles failed to reveal any further C223R changes, whereas R297L was not detected on screening 90 control Turkish alleles.



View larger version (43K):
[in this window]
[in a new window]
 
FIG. 1. Rare GPR54 sequence variants found in propositus. TM, Transmembrane {alpha} helix.

 
Case history

The proband (46, XY, birth weight 2.98 kg) was born at term after an uneventful pregnancy. He was noted to have a micropenis and undescended testes at birth, and serum gonadotropins were undetectable at 2 months of age (LH < 0.5 mIU/ml, FSH < 0.5 mIU/ml). His penis grew reasonably in response to three injections of depot testosterone, but whereas his right testis was identified in the scrotum, his left testis remained undescended.

At 15 months of age, he was admitted for further investigation of anterior pituitary function. His height/length was progressing consistently along the 50th percentile and weight along the 25th percentile. He had a normal GH response to glucagon stimulation [2.1 (basal) to 30.5 ng/ml (peak) (6.2–91.5 mU/liter; North-East Thames Radio-Immuno Assay, cut-off for the diagnosis of GH deficiency, 11.7 ng/ml]. He had a normal cortisol response to glucagon stimulation [19.8–47.0 µg/dl (554–1317 nmol/liter)], normal free T4 [1.37 µg/dl (17.5 nmol/liter)] and normal TSH response to TRH stimulation (0.5–7.3 mU/liter). He had normal basal prolactin, and undetectable basal gonadotrophins (LH < 0.5 mIU/ml, FSH < 0.5 mIU/ml). Results of a 3-d human chorionic gonadotropin (hCG) stimulation test (1000 IU daily) showed a limited testosterone response to stimulation (Table 4AGo). An ultrasound scan at this time identified both testes and bilateral hydroceles. The right testis was soft, measured 9 x 6 x 10 mm, and was within the scrotal sac. The left testis had a maximum diameter of 7 mm and was identified at the left inguinal ring. A prolonged course of hCG stimulation produced some increase in penile size but failed to stimulate descent of the left testis. Therefore, herniotomy and orchidopexy of a very small left testis were performed.


View this table:
[in this window]
[in a new window]
 
TABLE 4. Results of dynamic endocrine testing

 
His progress during childhood was uneventful. However, he showed progressive weight gain and linear growth from the age of 3.5 yr so that by 9.7 yr of age, he was relatively tall (height 148.6 cm, > 97th percentile; parental target height 25th percentile) and heavy (weight 49.9 kg, >> 97th percentile) but with a small penis and testes. Repeat endocrine evaluation at 10 yr of age showed a poor gonadotrophin response to LHRH stimulation (Table 4BGo) and suboptimal testosterone response to 3 wk stimulation with hCG (1000 IU twice weekly) (Table 4CGo). He was therefore started electively on low-dose testosterone replacement to induce puberty. No neuroimaging was performed.

The proband’s mother, who was heterozygous for R297L, had experienced menarche at 11 yr of age. She has regular menstrual cycles and detectable gonadotropins (LH 7.2 mIU/ml, FSH 8.3 mIU/ml). His father is believed to have normal reproductive function but was not available for testing. His younger brother, heterozygous for R297L but homozygous wild-type for C223 had normal genitalia and descended testes at birth. Of note, there was no known family history of hypogonadism or infertility in the father’s eight siblings.

Characterization of mutant GPR54 function

Using the proprietary Flp-In system, isogenic cell lines stably expressing either wild-type GPR54 or one of the two mutant GPR54s at the same level of transcription were generated. A sensitive fluorometric calcium mobilization assay was then used as described to assess the response of each GPR54 species to the kisspeptin 112–121 decapeptide, previously established to be a potent agonist for GPR54 (12, 14). In our hands (Fig. 2Go), this assay is highly sensitive for detecting GPR54 activity: calcium flux above baseline for wild-type GPR54 is detectable at subnanomolar concentrations of ligand, with maximal flux achieved at around 100 nM.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 2. Response of GPR54 variants to stimulation with kisspeptin 112–121 decapeptide. RFU, Relative fluorescence units. Experiments were performed in duplicate on 2 consecutive days, and SDs are indicated. Dose-response curves were generated using a four-parameter logistic equation. The resulting parameters and correlation coefficients are indicated.

 
The EC50 of the wild-type receptor was determined from 20 independent measurements. The (arithmetic) mean EC50 is 3.20 nM (lower 95% confidence interval 1.99 nM, upper 95% confidence interval 4.41 nM, SEM 0.56 nM). The range of EC50s was 0.2–9.8 nM. The C223R mutant was profoundly impaired in its signaling capability with an EC50 of 200 nM and maximal activity around 20% of wild-type GPR54. The function of R297L was only mildly affected, with a measured EC50 of 7 nM and a maximal activity of 85% of wild type (Fig. 2Go). A one-sample t test suggests this EC50 difference is significant, with P < 0.0001 and t = 6.6. Kolmogorov-Smirnoff determination of skewedness and kurtosis shows the control data fit a normal distribution, so a parametric t test is appropriate.


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Human GPR54 is a G protein-coupled receptor with homology to the family of galanin receptors, although galanin and galanin-like peptides do not bind the receptor with appreciable affinity. In the past year, homozygosity mapping and candidate gene analysis of large consanguineous pedigrees has led two groups to describe loss-of-function mutations in GPR54 in association with autosomal recessive HH (4, 5). In parallel, the independent generation and characterization of a Gpr54 knockout mouse model, which shows a phenocopy of human isolated HH, has demonstrated that the function of GPR54 is conserved in mammals and that GPR54 is absolutely required for the normal function of this axis (5).

Mouse and human studies to date suggest GPR54 has a role in the release of GnRH (5, 6), further weight having recently been added to this hypothesis by the demonstration that peripherally and centrally administered kisspeptins can provoke robust LH and FSH release (6, 7, 8). However, it is not yet clear whether kisspeptins subserve primarily autocrine, paracrine, or endocrine function. Intriguingly, the putative endogenous GPR54 ligand, an amidated proteolytic product of full-length kisspeptin-1, sometimes called metastin (12, 13, 14), is normally present only at low picomolar concentrations in plasma but rises some 10,000-fold by the end of pregnancy (15). Both kisspeptin-1 and GPR54 are widely expressed, with the highest GPR54 expression being reported in placenta, brain, pituitary, pancreas, and spinal cord, whereas the highest kisspeptin-1 expression is seen in placenta, with significant levels also in pancreas and testis (12, 13, 14). This widespread expression implies a more complex role for GPR54/kisspeptin-1 than appreciated at present, and studies of humans harboring loss-of-function mutations are likely to make a valuable contribution to further elucidation of its biology.

The current report adds to the spectrum of loss-of-function mutations in GPR54. Previous studies reported five different mutations in four families or individuals with HH. Homozygosity for a 155-bp deletion spanning the splice acceptor site of the intron 4-exon 5 junction and part of exon 5 was detected in a consanguineous pedigree with five affected members (4). This homozygous deletion cosegregated with HH in this family and was inferred to result in loss of receptor function due to truncation of the coding sequence at residue 267. A second rare sequence variant, this time a missense mutation, L102P, immediately after the second transmembrane helix, was also found in one family on screening three other kindreds with familial HH. However, no cosegregation or functional studies of this mutant were reported (4). Another report of loss of function of GPR54 in patients with HH described both a homozygous L148S point mutation in a conserved region of the second intracellular loop in a consanguineous Saudi kindred and compound heterozygosity for two mutations, R331X and X399R, in an unrelated Afro-Caribbean patient, which were proven to result in significant loss of GPR54 signaling in vitro (5). In total, the published reports to date describe the screening of 68 unrelated probands with normosmic HH (five familial; 63 idiopathic) and normal GnRH receptor gene sequence, of whom three had two proven hypofunctional or nonfunctional GPR54 alleles (two familial; one idiopathic). This is consistent with our finding of one such patient in a further 17 studied (three familial; 14 idiopathic: Table 1Go). Cumulative results now suggest that, in those in which GnRHR coding sequence mutations have been ruled out, around 2–3% (two of 77 studied) of idiopathic normosmic HH may be accounted for by GPR54 loss-of-function mutations, whereas at present 25% (two of eight studied) of familial cases have been found to have such mutations. However, no GPR54 mutations were identified in patients or families with CDP alone.

It is highly likely, although not conclusively proven, that compound heterozygosity for the C223R and R297L variants is the cause of the idiopathic HH seen in our proband. C233R is severely defective in its signaling capability and is not seen as a common variant in the Afro-Caribbean population. In contrast, the effect of the R297L mutation on signaling is only modest, although highly statistically significant, when studied in vitro. However it is a highly conserved residue in mammalian GPR54 and was not found in an ethnically matched control population. It is likely that its effects in combination with the severe dysfunction of the C233R variant are sufficient to lead to a clinical phenotype.

Although the patient we describe is not yet beyond the age of normal puberty, he had sufficient clinical and biochemical evidence of HH to warrant induction of puberty at an age appropriate for his peer group. For example, bilateral cryptorchidism and micropenis were noted at birth; he had undetectable gonadotropins at 2 months of age [when the hypothalamic-pituitary-gonadal axis is usually relatively active (16)]; and his response to exogenous GnRH stimulation at the age of 10 yr was poor. In addition, his testosterone response to stimulation for 3 wk with hCG at this time was relatively low. Although this may reflect the tropic effect of prolonged gonadotropin insufficiency or delayed orchidopexy, it remains possible that the GPR54/kisspeptin-1 system could have a direct effect on testicular function, too. Of note, GPR54 mRNA has previously been detected, albeit at low levels, in human testis (13, 14). Thus, the effect of recombinant gonadotropin stimulation on the induction of fertility in patients with GPR54 gene mutations remains to be seen.

The present report uses a GPR54 signaling assay that is substantially more sensitive than that used to evaluate previous pathogenic mutations. The assay reported originally was based on transient expression of GPR54, stimulation with kisspeptin-1 112–121 decapeptide, and determination of the generation of inositol triphosphate. Stimulation of inositol triphosphate levels was seen only at around 10 nM kisspeptin-1 112–121 for wild-type GPR54, with maximal activity around 100 µM (3). In contrast, this study employed real-time measurements of calcium flux, similar in principle to those previously used in the identification of kisspeptin as a bona fide GPR54 ligand (12, 13, 14). As seen in Fig. 2Go, this assay detects signaling at subnanomolar concentrations of the kisspeptin decapeptide, and activity is maximal at around 100 nM, some 2–3 orders of magnitude lower than the ligand concentration required to maximize inositol triphosphate generation in the previous assay.

In the absence of functional assessment of the GPR54 L102P variant, GPR54 C223R and R297L are the second- and third-point mutations after L148S reported to result in impaired GPR54 function because the 155-bp deletion, R331X, and X399R are all likely to have resulted in loss of function largely through impaired expression of mRNA and/or protein product. The new mutations may thus prove more informative with respect to understanding of the molecular determinants of GPR54 signaling. The dramatic loss of function of GPR54 C223R is unsurprising in view of likely disruption of the fifth transmembrane helix. Indeed, it will be of interest to establish whether receptor protein is expressed at wild-type level at the plasma membrane and, if so, whether ligand binding is preserved. R297L is situated in the final extracellular loop of GPR54 in a slightly less conserved region, and its effect on signaling is consequently relatively mild in vitro. It remains to be determined whether its additional loss of function in vivo is due to inefficient receptor synthesis or processing. Nevertheless, the dose-response characteristics of this mutation raise the possibility that supraphysiological doses of exogenous kisspeptin or an analog could be used to restore GnRH pulsatility and possibly fertility in this patient. A similar approach, using high doses of GnRH, has been used to induce ovulation in a woman with a partial loss-of-function mutation in the GnRH receptor (17). Furthermore, because we have not been able to establish whether the father of the propositus is indeed heterozygous for the C223R variant, we cannot conclude on phenotypic grounds that heterozygosity for this variant is not clinically expressed. Thus, dominant negativity of GPR54 C223R, or an interaction between C223R and R297L, cannot be formally excluded. However, although there are precedents for dominant-negative GPR mutations, often based on receptor misrouting or G protein sequestration, the dominant negativity is often more apparent in vitro than in vivo (18), and we believe it more likely in this case that it is the cumulative loss of function of the two variants that is responsible for the clinical phenotype.

In addition to identifying and characterizing two rare sequence variants in the GPR54 gene, we have also confirmed two previously described SNPs (Table 3AGo). One of these is nonsynonymous, with an alternative histidine to leucine change encoded in the cytoplasmic tail. A third SNP recorded in the dbSNP database was not confirmed (1155G>A; rs3746147). Analysis of KISS1 revealed four single nucleotide polymorphisms, three nonsynonymous, and one not previously recorded. In addition, an insertional polymorphism that leads to truncation of the kisspeptin-1 protein product by seven amino acids was also confirmed (Table 3BGo). Once again, a further SNP recorded in the dbSNP database was not confirmed (287C>G; rs1132112). All three nonsynonymous KISS1 sequence variants lead to amino acid changes in the amino-terminal part of the molecule. This is not directly involved in signaling but is likely to contribute to the regulation of processing and secretion of the active peptide. We have documented the frequency of occurrence of these variants in our study population and also in 180 Caucasian control chromosomes. This information could be used in future to guide case control studies looking at either indices of reproductive function or fertility or possibly indices of tumor invasion or metastasis in patients with malignancy, in view of the considerable interest in KISS1 as a metastasis-suppressing gene.

In summary, we have described two novel missense mutations in the G protein-coupled receptor GPR54 that result in impaired kisspeptin-1 stimulation of calcium flux. Compound heterozygosity for these mutations is associated with HH, detected at birth in the proband due to bilateral cryptorchidism and micropenis. Although not common, loss-of-function mutations in GPR54 appear to be a significant cause of HH in patients from diverse ethnic backgrounds.


    Acknowledgments
 
We are grateful to Drs. P. C. Hindmarsh and M. T. Dattani for referring patients for study and Dr. L. Lin for sequencing the GnRH receptor.


    Footnotes
 
This work was supported by the Raymond and Beverly Sackler Foundation (to R.K.S.). R.K.S. also holds a Wellcome Trust Clinical Research Training Fellowship, and J.C.A. and I.S.F. hold Wellcome Trust Clinician Scientist Fellowships.

First Published Online December 14, 2004

Abbreviations: CDP, Constitutional delay of puberty; GPR, G protein-coupled receptor; hCG, human chorionic gonadotropin; HH, hypogonadotropic hypogonadism; SNP, single nucleotide polymorphism.

Received July 25, 2004.

Accepted December 7, 2004.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Parent AS, Teilmann G, Juul A, Skakkebaek NE, Toppari J, Bourguignon JP 2003 The timing of normal puberty and the age limits of sexual precocity: variations around the world, secular trends, and changes after migration. Endocr Rev 24:668–693[Abstract/Free Full Text]
  2. Beranova M, Oliveira LM, Bedecarrats GY, Schipani E, Vallejo M, Ammini AC, Quintos JB, Hall JE, Martin KA, Hayes FJ, Pitteloud N, Kaiser UB, Crowley Jr WF, Seminara SB 2001 Prevalence, phenotypic spectrum, and modes of inheritance of gonadotropin-releasing hormone receptor mutations in idiopathic hypogonadotropic hypogonadism. J Clin Endocrinol Metab 86:1580–1588[Abstract/Free Full Text]
  3. Bo-Abbas Y, Acierno Jr JS, Shagoury JK, Crowley Jr WF, Seminara SB 2003 Autosomal recessive idiopathic hypogonadotropic hypogonadism: genetic analysis excludes mutations in the gonadotropin-releasing hormone (GnRH) and GnRH receptor genes. J Clin Endocrinol Metab 88:2730–2737[Abstract/Free Full Text]
  4. de Roux N, Genin E, Carel JC, Matsuda F, Chaussain JL, Milgrom E 2003 Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc Natl Acad Sci USA 100:10972–10976[Abstract/Free Full Text]
  5. Seminara SB, Messager S, Chatzidaki EE, Thresher RR, Acierno Jr JS, Shagoury JK, Bo-Abbas Y, Kuohung W, Schwinof KM, Hendrick AG, Zahn D, Dixon J, Kaiser UB, Slaugenhaupt SA, Gusella JF, O’Rahilly S, Carlton MB, Crowley Jr WF, Aparicio SA, Colledge WH 2003 The GPR54 gene as a regulator of puberty. N Engl J Med 349:1614–1627[Abstract/Free Full Text]
  6. Gottsch ML, Cunningham MJ, Smith JT, Popa SM, Acohido BV, Crowley WF, Seminara S, Clifton DK, Steiner RA 2004 A role for kisspeptins in the regulation of gonadotropin secretion in the mouse. Endocrinology 145:4073–4077[Abstract/Free Full Text]
  7. Navarro VM, Castellano JM, Fernandez-Fernandez R, Barreiro ML, Roa J, Sanchez-Criado JE, Aguilar E, Dieguez C, Pinilla L, Tena-Sempere M 2004 Developmental and hormonally regulated messenger ribonucleic acid expression of KiSS-1 and its putative receptor GPR54 in rat hypothalamus and potent LH releasing activity of KiSS-1 peptide. Endocrinology 145:4565–4574[Abstract/Free Full Text]
  8. Matsui H, Takatsu Y, Kumano S, Matsumoto H, Ohtaki T 2004 Peripheral administration of metastin induces marked gonadotropin release and ovulation in the rat. Biochem Biophys Res Commun 320:383–388[CrossRef][Medline]
  9. Wareham NJ, Byrne CD, Williams R, Day NE, Hales CN 1999 Fasting proinsulin concentrations predict the development of type 2 diabetes. Diabetes Care 22:262–270[Abstract/Free Full Text]
  10. Williams DR, Wareham NJ, Brown DC, Byrne CD, Clark PM, Cox BD, Cox LJ, Day NE, Hales CN, Palmer CR, Shackleton JR, Wang TWM 1995 Undiagnosed glucose intolerance in the community: the Isle of Ely Diabetes Project. Diabet Med 12:30–35[Medline]
  11. Clements MK, McDonald TP, Wang R, Xie G, O’Dowd BF, George SR, Austin CP, Liu Q 2001 FMRFamide-related neuropeptides are agonists of the orphan G-protein-coupled receptor GPR54. Biochem Biophys Res Commun 284:1189–1193[CrossRef][Medline]
  12. Muir AI, Chamberlain L, Elshourbagy NA, Michalovich D, Moore DJ, Calamari A, Szekeres PG, Sarau HM, Chambers JK, Murdock P, Steplewski K, Shabon U, Miller JE, Middleton SE, Darker JG, Larminie CG, Wilson S, Bergsma DJ, Emson P, Faull R, Philpott KL, Harrison DC 2001 AXOR12, a novel human G protein-coupled receptor, activated by the peptide KiSS-1. J Biol Chem 276:28969–28975[Abstract/Free Full Text]
  13. Kotani M, Detheux M, Vandenbogaerde A, Communi D, Vanderwinden JM, Le Poul E, Brezillon S, Tyldesley R, Suarez-Huerta N, Vandeput F, Blanpain C, Schiffmann SN, Vassart G, Parmentier M 2001 The metastasis suppressor gene KiSS-1 encodes kisspeptins, the natural ligands of the orphan G protein-coupled receptor GPR54. J Biol Chem 276:34631–34636[Abstract/Free Full Text]
  14. Ohtaki T, Shintani Y, Honda S, Matsumoto H, Hori A, Kanehashi K, Terao Y, Kumano S, Takatsu Y, Masuda Y, Ishibashi Y, Watanabe T, Asada M, Yamada T, Suenaga M, Kitada C, Usuki S, Kurokawa T, Onda H, Nishimura O, Fujino M 2001 Metastasis suppressor gene KiSS-1 encodes peptide ligand of a G-protein-coupled receptor. Nature 411:613–617[CrossRef][Medline]
  15. Horikoshi Y, Matsumoto H, Takatsu Y, Ohtaki T, Kitada C, Usuki S, Fujino M 2003 Dramatic elevation of plasma metastin concentrations in human pregnancy: metastin as a novel placenta-derived hormone in humans. J Clin Endocrinol Metab 88:914–919[Abstract/Free Full Text]
  16. Andersson AM, Toppari J, Haavisto AM, Petersen JH, Simell T, Simell O, Skakkebaek NE 1998 Longitudinal reproductive hormone profiles in infants: peak of inhibin B levels in infant boys exceeds levels in adult men. J Clin Endocrinol Metab 83:675–681[Abstract/Free Full Text]
  17. Seminara SB, Beranova M, Oliveira LM, Martin KA, Crowley Jr WF, Hall JE 2000 Successful use of pulsatile gonadotropin-releasing hormone (GnRH) for ovulation induction and pregnancy in a patient with GnRH receptor mutations. J Clin Endocrinol Metab 85:556–562[Abstract/Free Full Text]
  18. Leanos-Miranda A, Ulloa-Aguirre A, Ji TH, Janovick JA, Conn PM 2003 Dominant-negative action of disease-causing gonadotropin-releasing hormone receptor (GnRHR) mutants: a trait that potentially coevolved with decreased plasma membrane expression of GnRHR in humans. J Clin Endocrinol Metab 88:3360–3367[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Integr. Comp. Biol.Home page
W. P. Williams III, E. M. Gibson, C. Wang, S. Tjho, N. Khattar, G. E. Bentley, K. Tsutsui, and L. J. Kriegsfeld
Proximate mechanisms driving circadian control of neuroendocrine function: Lessons from the young and old
Integr. Comp. Biol., November 1, 2009; 49(5): 519 - 537.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. S. Kauffman, V. M. Navarro, J. Kim, D. K. Clifton, and R. A. Steiner
Sex differences in the regulation of Kiss1/NKB neurons in juvenile mice: implications for the timing of puberty
Am J Physiol Endocrinol Metab, November 1, 2009; 297(5): E1212 - E1221.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. E. Oakley, D. K. Clifton, and R. A. Steiner
Kisspeptin Signaling in the Brain
Endocr. Rev., October 1, 2009; 30(6): 713 - 743.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
R. M Reynolds, J. J Logie, A. K Roseweir, A. J McKnight, and R. P Millar
A role for kisspeptins in pregnancy: facts and speculations
Reproduction, July 1, 2009; 138(1): 1 - 7.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
A.K. Roseweir and R.P. Millar
The role of kisspeptin in the control of gonadotrophin secretion
Hum. Reprod. Update, March 1, 2009; 15(2): 203 - 212.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. L. Wacker, D. B. Feller, X.-B. Tang, M. C. DeFino, Y. Namkung, J. S. Lyssand, A. J. Mhyre, X. Tan, J. B. Jensen, and C. Hague
Disease-causing Mutation in GPR54 Reveals the Importance of the Second Intracellular Loop for Class A G-protein-coupled Receptor Function
J. Biol. Chem., November 7, 2008; 283(45): 31068 - 31078.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
E. Gianetti and S. Seminara
Kisspeptin and KISS1R: a critical pathway in the reproductive system
Reproduction, September 1, 2008; 136(3): 295 - 301.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
I. Dumalska, M. Wu, E. Morozova, R. Liu, A. van den Pol, and M. Alreja
Excitatory Effects of the Puberty-Initiating Peptide Kisspeptin and Group I Metabotropic Glutamate Receptor Agonists Differentiate Two Distinct Subpopulations of Gonadotropin-Releasing Hormone Neurons
J. Neurosci., August 6, 2008; 28(32): 8003 - 8013.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. L. Keen, F. H. Wegner, S. R. Bloom, M. A. Ghatei, and E. Terasawa
An Increase in Kisspeptin-54 Release Occurs with the Pubertal Increase in Luteinizing Hormone-Releasing Hormone-1 Release in the Stalk-Median Eminence of Female Rhesus Monkeys in Vivo
Endocrinology, August 1, 2008; 149(8): 4151 - 4157.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
C. A Lents, N. L Heidorn, C R. Barb, and J J. Ford
Central and peripheral administration of kisspeptin activates gonadotropin but not somatotropin secretion in prepubertal gilts
Reproduction, June 1, 2008; 135(6): 879 - 887.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
M. G. Teles, S. D.C. Bianco, V. N. Brito, E. B. Trarbach, W. Kuohung, S. Xu, S. B. Seminara, B. B. Mendonca, U. B. Kaiser, and A. C. Latronico
A GPR54-Activating Mutation in a Patient with Central Precocious Puberty
N. Engl. J. Med., February 14, 2008; 358(7): 709 - 715.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Lapatto, J. C. Pallais, D. Zhang, Y.-M. Chan, A. Mahan, F. Cerrato, W. W. Le, G. E. Hoffman, and S. B. Seminara
Kiss1 / Mice Exhibit More Variable Hypogonadism than Gpr54 / Mice
Endocrinology, October 1, 2007; 148(10): 4927 - 4936.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
D. Marot, I. Bieche, C. Aumas, S. Esselin, C. Bouquet, S. Vacher, G. Lazennec, M. Perricaudet, F. Kuttenn, R. Lidereau, et al.
High tumoral levels of Kiss1 and G-protein-coupled receptor 54 expression are correlated with poor prognosis of estrogen receptor-positive breast tumors
Endocr. Relat. Cancer, September 1, 2007; 14(3): 691 - 702.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. S. Kauffman, J. H. Park, A. A. McPhie-Lalmansingh, M. L. Gottsch, C. Bodo, J. G. Hohmann, M. N. Pavlova, A. D. Rohde, D. K. Clifton, R. A. Steiner, et al.
The Kisspeptin Receptor GPR54 Is Required for Sexual Differentiation of the Brain and Behavior
J. Neurosci., August 15, 2007; 27(33): 8826 - 8835.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
X. d'Anglemont de Tassigny, L. A. Fagg, J. P. C. Dixon, K. Day, H. G. Leitch, A. G. Hendrick, D. Zahn, I. Franceschini, A. Caraty, M. B. L. Carlton, et al.
Hypogonadotropic hypogonadism in mice lacking a functional Kiss1 gene
PNAS, June 19, 2007; 104(25): 10714 - 10719.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. Tenenbaum-Rakover, M. Commenges-Ducos, A. Iovane, C. Aumas, O. Admoni, and N. de Roux
Neuroendocrine Phenotype Analysis in Five Patients with Isolated Hypogonadotropic Hypogonadism due to a L102P Inactivating Mutation of GPR54
J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 1137 - 1144.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
I. S. Farooqi, T. Wangensteen, S. Collins, W. Kimber, G. Matarese, J. M. Keogh, E. Lank, B. Bottomley, J. Lopez-Fernandez, I. Ferraz-Amaro, et al.
Clinical and Molecular Genetic Spectrum of Congenital Deficiency of the Leptin Receptor
N. Engl. J. Med., January 18, 2007; 356(3): 237 - 247.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
T. M Plant
The role of KiSS-1 in the regulation of puberty in higher primates
Eur. J. Endocrinol., November 1, 2006; 155(suppl_1): S11 - S16.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
W. S. Dhillo, P. Savage, K. G. Murphy, O. B. Chaudhri, M. Patterson, G. M. Nijher, V. M. Foggo, G. S. Dancey, H. Mitchell, M. J. Seckl, et al.
Plasma kisspeptin is raised in patients with gestational trophoblastic neoplasia and falls during treatment
Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E878 - E884.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. L. Thompson, K. G. Murphy, M. Patterson, G. A. Bewick, G. W. H. Stamp, A. E. Curtis, J. H. Cooke, P. H. Jethwa, J. F. Todd, M. A. Ghatei, et al.
Chronic subcutaneous administration of kisspeptin-54 causes testicular degeneration in adult male rats
Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E1074 - E1082.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
M. Tena-Sempere
GPR54 and kisspeptin in reproduction
Hum. Reprod. Update, September 1, 2006; 12(5): 631 - 639.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. M. Plant, S. Ramaswamy, and M. J. DiPietro
Repetitive Activation of Hypothalamic G Protein-Coupled Receptor 54 with Intravenous Pulses of Kisspeptin in the Juvenile Monkey (Macaca mulatta) Elicits a Sustained Train of Gonadotropin-Releasing Hormone Discharges
Endocrinology, February 1, 2006; 147(2): 1007 - 1013.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S.-K. Han, M. L. Gottsch, K. J. Lee, S. M. Popa, J. T. Smith, S. K. Jakawich, D. K. Clifton, R. A. Steiner, and A. E. Herbison
Activation of Gonadotropin-Releasing Hormone Neurons by Kisspeptin as a Neuroendocrine Switch for the Onset of Puberty
J. Neurosci., December 7, 2005; 25(49): 11349 - 11356.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
F. Lanfranco, J. Gromoll, S. von Eckardstein, E. M Herding, E. Nieschlag, and M. Simoni
Role of sequence variations of the GnRH receptor and G protein-coupled receptor 54 gene in male idiopathic hypogonadotropic hypogonadism
Eur. J. Endocrinol., December 1, 2005; 153(6): 845 - 852.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
W. S. Dhillo, O. B. Chaudhri, M. Patterson, E. L. Thompson, K. G. Murphy, M. K. Badman, B. M. McGowan, V. Amber, S. Patel, M. A. Ghatei, et al.
Kisspeptin-54 Stimulates the Hypothalamic-Pituitary Gonadal Axis in Human Males
J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6609 - 6615.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. M. Castellano, V. M. Navarro, R. Fernandez-Fernandez, R. Nogueiras, S. Tovar, J. Roa, M. J. Vazquez, E. Vigo, F. F. Casanueva, E. Aguilar, et al.
Changes in Hypothalamic KiSS-1 System and Restoration of Pubertal Activation of the Reproductive Axis by Kisspeptin in Undernutrition
Endocrinology, September 1, 2005; 146(9): 3917 - 3925.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Semple, R. K.
Right arrow Articles by Aparicio, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Semple, R. K.
Right arrow Articles by Aparicio, S. A.
Related Collections
Right arrow Male Endocrinology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals