| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Institut National de la Santé et de la Recherche Médicale, Equipe Mixte 01-05, Department of Cell Regulation and Dynamics, Commissariat à l’Energie Atomique (F.d.F., G.L.M., G.D., O.C., J.-J.F.), 38054 Grenoble, France; Departments of Integrative Biology (F.d.F.) and Endocrinology (O.C.) and Transcriptome Analysis Platform, Genopole Rhône-Alpes (M.E.A., F.B.), University Hospital of Grenoble, 38043 Grenoble, France; COMETE: The French Network for Studies on Human Adrenal Cortical and Medullary Tumors (F.d.F., N.C., G.L.M., G.D., J.B., X.B., P.-F.P., E.B., C.G., O.C., J.-J.F.), European Hospital Georges Pompidou, 75908 Paris, France; Institut National de la Santé et de la Recherche Médicale, Equipe de Recherche Méthodologique 02-06, University of Méditerranée (R.H.), 13288 Marseille, France; Department of Endocrinology, Cochin Hospital (J.B., X.B.), 75014 Paris, France; Department of Hypertension, European Hospital Georges Pompidou (P.-F.P.), 75908 Paris, France; Department of Endocrine Cancerology, Gustave-Roussy Institute (E.B.), 94805 Villejuif, France; and Laboratory of Functional Endocrine Explorations, Trousseau Hospital (C.G.), 75571 Paris, France
Address all correspondence and requests for reprints to: Dr. Jean-Jacques Feige, Institut National de la Santé et de la Recherche Médicale, Equipe Mixte 01-05, Department of Cellular Responses and Dynamics, Angiogenesis Laboratory, Commissariat à l’Energie Atomique Grenoble, 17 rue des Martyrs, F-38054 Grenoble Cedex 9, France. E-mail: jjfeige{at}cea.fr.
 |
Abstract |
|---|
 Top Abstract IntroductionPatients and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Despite some recent progress, understanding of the biology of adrenocortical tumors is still incomplete. Clonal composition analyses and comparative genomic hybridization experiments have established that adrenocortical tumorigenesis is a multistep process resulting from sequential genetic alterations leading to progression from normal to adenomatous and, eventually, malignant phenotypes (5, 6, 7, 8). Several studies have demonstrated an increased frequency of DNA copy number changes in large malignant tumors that are infrequent in small benign lesions. The most common modification, observed in 85% of carcinomas, is overexpression of the IGF-II gene, which is associated with paternal isodisomy at the 11p15 locus (9, 10). However, the high number of chromosomal alterations and dysregulation of gene expression that are observed suggest that each tumor is potentially distinct from all others at the molecular and clinical levels (8, 9, 11, 12). Prognosis is thus not likely to be associated with abnormal expression of a single gene, but, rather, with the combined disturbances of several genes. Massively parallel molecular analyses should be developed to identify such combinations of misexpressed genes. The recently developed cDNA array technology, which allows simultaneous analysis of mRNA expression levels of hundreds of genes, may be the method of choice. Several recent studies have demonstrated that the determination of gene expression signatures among clinically and histologically homogeneous groups of tumors permits the identification of subgroups with different evolution prognoses (13, 14, 15, 16, 17, 18).
The classification of adrenocortical tumors between adenomas and carcinomas relies on several criteria, including size of the resected tumor mass, degree of invasiveness, and histopathological examination. Tumors presenting with local or regional invasion and/or metastases (McFarlane stages III and IV) are unequivocally classified as malignant. Conversely, in the case of purely localized tumors, the diagnosis is based on histopathological examination using the criteria defined by Weiss (19, 20). However, in approximately 30% of these tumors (1
Weiss score 3), histopathology is unable to provide an unambiguous answer. There is, therefore, a crucial need for additional reliable analyses that could help the clinician in diagnostic and subsequent therapeutic decisions. In a recent retrospective study of a large cohort of patients with sporadic adrenocortical tumors, the analysis of three molecular alterations (loss of heterozygosity at the 17p13 locus, uniparental disomy at the 11p15 locus, and overexpression of the IGF-II gene) revealed that they were independent predictors of shorter disease-free survival in univariate analysis (9). In a multivariate analysis, histological grade (relative risk, 4.2) and 17p13 loss of heterozygosity (relative risk, 21.5) appeared to be independently associated with recurrence (9).
The aim of this study was to take advantage of the cDNA array technology to identify predictor sets of genes whose over- or underexpression in adrenocortical tumors would help, on the one hand, to discriminate between benign and malignant tumors and, on the other hand, to identify the subgroup of patients bearing carcinomas at high risk of recurrence, in whom adjuvant therapy may be applied. For this purpose, using cDNA microarrays, we analyzed the expression of 230 candidate genes in a series of 57 sporadic adrenocortical tumors from adult patients who had been carefully followed up by five medical centers within the French clinical network COMETE (COrtico and MEdullo-surrénales Tumeurs Endocrines). We identified two clusters of genes whose levels of expression appeared to be good predictors of malignancy. Their combination improved their predictive value to a level similar to, but not better than, the pathological score of Weiss. In addition, we identified a set of 14 genes (including ITGB2, GZMA, and ATF1) that allowed us to significantly predict metastatic recurrence among the 13 carcinomas included in the analysis.
|
Patients and Methods |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Samples of primary sporadic adrenocortical tumors were obtained from 57 adult patients (14 men and 43 women) referred to and followed by the Endocrine Departments of Cochin, Georges Pompidou, Gustave Roussy, Armand-Trousseau, and Albert Michallon Hospitals (Paris, Villejuif, and Grenoble, France). We excluded cases with Conn adenomas, i.e. with tumors 20 mm or smaller with pure aldosterone hypersecretion. Written informed consent for germline and somatic DNA analysis was obtained from each patient, and the study was formally approved by an institutional review board (CCPPRB Paris-Cochin, July 1996). Access to the collected information was obtained from all patients in accordance with national ethic rules. The median age of the patients at the time of diagnosis was 41 yr (range, 18–79 yr). After surgical resection, tumors were dissected; a fragment was processed for paraffin inclusion and additional histopathological examination, and adjacent pieces were immediately frozen in liquid nitrogen and stored either in liquid nitrogen or at –80 C until RNA extraction and additional molecular analysis. Tumors were classified according to Weiss criteria; for each tumor, a Weiss score between 0 and 9 was determined according to the presence or absence of nine predefined histological features (19, 20). The group of tumors analyzed in this study included 33 adenomas (Weiss score, 3) and 24 carcinomas (Weiss score, 
4). The major characteristics of the patients included in this study and of their tumors are summarized in Table 1
.
|
Quantitative RT-PCR
Two micrograms of total RNA were reverse transcribed for 30 min at 37 C with SuperScript II ribonuclease H reverse transcriptase (Invitrogen Life Technologies, Cergy Pontoise, France) under conditions recommended by the manufacturer. Aliquots (1/25th of the RT reaction volume) were subjected to quantitative real-time PCR on a Light Cycler apparatus (Roche, Meylan, France). The PCRs were performed using the following primers: GCATCGTTGAGGAGTGCTGTTTC and GGGGTATCTGGGGAAGTTGTCC for IGF-II, TCCACCCACCTGGCTTCAT and GCAGGACCTGGGCTTGTG for 3ß-hydroxysteroid dehydrogenase/
5–4-isomerase type I (HSD3B1), and GGCAAATGCTTTCGCCTCTGGGTC and TTGTTGGTTTTCGGAACTGAGC for 18S ribosomal RNA and SYBR Green PCR core reagents (LightCycler-FastStart Master SYBR Green I, Roche) according to the manufacturer’s instructions. PCR conditions were: step 1, 95 C for 10 min; and step 2, 40 cycles consisting of 95 C for 15 sec, 57 C for 6 sec (IGF-II) or 59 C for 5 sec (HSD3B1 and 18S), and 72 C for 12 sec (IGF-II) or for 10 sec (HSD3B1 and 18S). The samples were analyzed in duplicate, and the results were normalized to 18S expression levels.
Preparation of cDNA microarrays
Gene expression was analyzed by hybridization of arrays with radiolabeled probes. The arrays contained PCR amplification products of 230 human cDNA clones obtained from the IMAGE consortium through either the RZPD (Berlin, Germany) or the Human Genome Mapping Project Resource Center (Hinxton, UK). These included 187 cancer-related genes (including genes encoding cell cycle control proteins, growth factors, growth factor receptors, transcription factors, cell adhesion molecules, and proteins involved in cell invasion, angiogenesis, and chemoresistance), 34 adrenal cortex-specific genes (including genes encoding hormone receptors, components of the cAMP signaling pathway, steroidogenic enzymes, and components of the IGF-II system), and nine control genes. Their identities were verified by restriction mapping and/or 5' tag sequencing of plasmid DNA. The use of control clones, PCR amplification, and robotical spotting onto Nytran-N+ membranes (Schleicher & Schuell) were performed as described previously (22). The list of spotted genes is available upon request.
Data analysis and statistical methods
Hybridization signals (mean values of duplicate spots) were recorded and quantified with a ß-imager (BAS 5000, Fuji, Tokyo, Japan). The values were then corrected with Image Gauge software for the amount of spotted DNA and the variability of experimental conditions, normalized as a ratio to the total amount of membrane-bound radioactivity, log-transformed, and displayed as relative values median-centered in each row and column (14, 22). Average linkage hierarchical clustering was then applied to determine the closest proximity between tumor samples and between gene expression levels using the Cluster program (with Pearson correlation as the similarity metric), and the results were displayed using the TreeView program (23). Genes distinguishing clinical parameters (adenoma vs. carcinoma; recurrences) were identified by t test.
Survival analysis was performed using the Kaplan-Meier method (24) and compared between groups using the log-rank test (univariate analysis). The calculations were performed using StatView software.
|
Results |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
The mRNAs from 57 human adrenocortical tumor samples were hybridized with cDNA arrays carrying the 230 selected genes. The overall expression patterns of these 57 tumors were analyzed with hierarchical clustering and displayed in a color-coded matrix (Fig. 1A). Tumor samples are classified on the horizontal axis and genes on the vertical axis; both are ordered on the basis of similarity of their expression profiles. Overall similarity of gene expression profiles is shown as a dendrogram, where branch length is inversely correlated with similarity. As shown in Fig. 1B, the two groups of tumors separated on the basis of the expression profiles of all genes contained clearly distinct percentages of adenomas (green squares) vs. carcinomas (red squares). Supervised analysis allowed highlighting two clusters of genes associated with the adenoma/carcinoma distinction (Fig. 1, red curve). They are indicated by colored lines on the dendrogram at the left in Fig. 1. Statistical analysis of the expression of each gene belonging to these two clusters revealed that they were significantly distinct between adenomas and carcinomas (Fig. 1A, right panel). The identity of the genes from each cluster is presented in Table 2. The IGF-II cluster contains eight genes that encode growth factors (IGF-II and TGFß2), growth factor receptors [fibroblast growth factor receptor type 1 (FGFR1), FGFR4, macrophage stimulating 1 receptor (MST1R), and TGFBR1), as well as KCNQ1OT1 (also known as LIT1, i.e. long QT internal transcript1) and glyceraldehyde-3-phosphate dehydrogenase (GAPD), a presupposed housekeeping gene. The steroidogenesis cluster contains 14 genes. Six of them encode proteins directly involved in the steroid biosynthesis pathway: steroidogenic acute regulatory protein (StAR), CYP11A (cholesterol side-chain cleavage enzyme), HSD3B1, CYP11B1 (steroid 11ß-hydroxylase), CYP21A2 (steroid 21-hydroxylase), and CYP17 (steroid 17
-hydroxylase). It also contains protein phosphatase 1A, S100B (S100 calcium-binding protein, ß-chain), glypican 3, inhibin -chain, cAMP response element modulator, retinoblastoma 1, nonmetastatic protein 23, and TGFß type 3 receptor.
|
|
). The level of expression of the IGF-II cluster allowed us to separate a subpopulation (low expression), among which 90% of the tumors were adenomas, from another (high expression), among which 75% were carcinomas. In contrast, considering the steroidogenesis cluster, a low level of expression correlated with carcinomas (81% in the low expressing group), whereas a high level of expression correlated with adenomas (93% in the high-expressing group).
|
indicated a good correlation between the two methods.
|
Of the 57 patients whose tumor RNAs were analyzed on DNA microarrays, eight had incomplete surgery, and nine had insufficient follow-up. We could, however, include 40 patients in a retrospective study of recurrence-free survival. In this group the median duration of follow-up was 33 months (range, 4–97 months). For patients without recurrence, the minimal follow-up period was 12 months. The Kaplan-Meier estimate of disease-free survival was 82.5% at 2 yr (Fig. 4A). During the follow-up period, four patients died of metastatic recurrence. Seven patients (17.5%) underwent recurrence 2–10.5 months after initial surgery (median, 6.7 months).
|
were used to classify each individual tumor into two groups characterized by low or high expression of the considered cluster. The curves shown in Fig. 4, B and C, clearly indicate that the IGF-II (P < 0.01) and steroidogenesis (P < 0.01) clusters were significant predictors of malignancy. They were not as good predictors, however, as the pathological grade (Weiss score; Fig. 4E), because the rate of recurrence among the group of tumors presenting a Weiss score of 4 or greater was 54%, whereas it was only about 40% among the groups that presented either a high level of expression of the IGF-II gene cluster or a low expression level of the steroidogenesis cluster. However, the combination of these two latter gene clusters allowed identification of a subpopulation of tumors with low expression of the steroidogenesis cluster and high expression of the IGF-II cluster that presented the same risk of postsurgical recurrence as the group of tumors with a Weiss score of 4 or more (Fig. 4, D and E). This observation is the first demonstration in adrenocortical tumors that the analysis of the pattern of expression of a limited number of genes (22 genes in total) is as predictive as the pathological grading. Analysis of the steroid secretion profiles
Another question that can be addressed in this study is the relationship between the steroid secretion profiles and the genetic expression profiles of these tumors. Among the tumor population studied, 23 overproduced glucocorticoids, two overproduced mineralocorticoids, 17 had a mixed secretion profile, and eight were nonsecreting. Three tumors overproduced androgens, and two overproduced estrogens. As shown in Fig. 5, most glucocorticoid-secreting tumors (19 of 23, 82%) presented a high level of expression of the steroidogenesis cluster. Unexpectedly however, most (16 of 19, 84%) of these differentiated tumors presented a low level of expression of the IGF-II cluster. In contrast, most tumors with a mixed steroid production profile and most nonsecreting tumors preferentially expressed the IGF-II cluster at a high level and the steroidogenesis cluster at a low level. This may reflect the previous observation that glucocorticoid overproduction is observed more frequently in adenomas than in carcinomas (2, 4).
|
We then separately analyzed the group of carcinomas (Weiss score, 4) and asked whether we could identify a gene cluster whose expression level could allow us to discriminate between recurring and nonrecurring tumors. Unfortunately, only 13 of these 24 carcinomas could be included in a retrospective study of recurrence-free survival, because tumors that were already metastatic before surgery had to be excluded from the analysis. Supervised analysis using a t test at 3% risk led to the identification of 14 genes whose expression levels were clearly distinct between recurring and nonrecurring tumors (Table 3 and Fig. 6A). These genes were not associated with any particular cluster (Fig. 1A, blue curve), probably because of the small number of samples. As shown in Fig. 6B, the group of recurring carcinomas could be perfectly separated from the group of nonrecurring tumors on the basis of overexpression (six genes) or underexpression (eight genes) of these genes.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Two independent clusters of genes (the IGF-II and steroidogenesis clusters) were independently found to significantly discriminate between two populations of tumors with distinct clinical outcomes. Their combination allowed us to identify a subpopulation of tumors with both a high expression level of the IGF-II cluster and a low expression level of the steroidogenesis cluster that have a higher probability of metastatic recurrence over a period of 24 months (60% of this group of tumors recurred). Analysis of the expression level of this group of 22 genes appeared almost as powerful as the well-recognized histological score of Weiss at identifying the true carcinomas. Although it may appear disappointing that such a sophisticated genetic analysis using cDNA microarrays does not overperform the routinely used histopathological method in terms of prediction power, one should acknowledge that the possibility to miniaturize this technique opens new fields for the diagnostic analysis of adrenocortical tumors. We show here that analysis of the expression level of a group of 22 genes is sufficient to predict metastatic recurrence with the same index of confidence as the histological score of Weiss. Because 1 µg total tumor RNA is certainly sufficient to carry out this genetic analysis (2 µg RNA were used in the present study), these results open the way to the molecular diagnostic performed before the surgery on a needle biopsy of the tumor. As recently reviewed, fine-needle aspirations appear as a sensitive and accurate method to collect biological material for the diagnosis of adrenocortical masses (25).
The identity of the genes that cosegregate with IGF-II in the so-called IGF-II cluster is extremely interesting. Two genes encode FGFRs of the FGF family: FGFR1 and FGFR4. The fibroblast growth factors FGF-1 and FGF-2 are expressed in the adrenal cortex. They are the most powerful mitogens for adult steroidogenic adrenocortical cells (26) as well as for the human adrenocortical tumor cell line NCI-H295R (27). They are also known to stimulate the proliferation of endothelial and mesenchymal cells. They bind to a family of four tyrosine kinase receptors, among which FGFR1 and FGFR4 are the most strongly expressed in the adrenal cortex (28, 29). The overexpression of these two FGFRs in adrenocortical cancers is thus likely to participate in their increased proliferation and vascularization. Then FGFRs potentially represent new targets for novel therapeutic approaches of adrenocortical carcinoma, a type of cancer that is resistant to conventional antimitotic agents (30). Two genes encode TGFß2, a member of the TGFß superfamily, and its signaling serine/threonine kinase receptor, TGFß-R1. TGFß1 is an autocrine factor produced by the adrenal cortex (31, 32). It has no effect on the proliferation of steroidogenic cells, but it strongly inhibits their steroidogenic activities through down-regulation of StAR and CYP17 expression (33, 34). Although TGFß2 has been less characterized in this tissue, it is known to share the same type 1 and type 2 receptors as TGFß1, to signal through the phosphorylation of the same Smad proteins (Smad2 and Smad3), and to have similar inhibitory effects on adrenocortical steroidogenesis (our unpublished observations). It is tempting to speculate that the overexpression of TGFß2 and its type 1 receptor in adrenocortical carcinomas may participate in the dedifferentiation of these tumors. Indeed, in our study, six of eight nonsecreting tumors presented with a high level of expression of the IGF-II cluster. Two previous studies have analyzed TGFß1 expression in adrenocortical tumors and have characterized a decreased expression of both the protein and the mRNA in carcinomas compared with normal tissue and adenomas (35, 36). In our study, both TGFß1 and TGFß2 cDNA probes were present on the arrays, but only TGFß2 appeared to cosegregate with other genes and to be overexpressed in carcinomas. Complementary experiments are required to establish whether there is a shift in expression from TGFß1 toward TGFß2 during adrenocortical tumor progression. One gene (MST1R) encodes Ron, a tyrosine kinase receptor for macrophage-stimulating protein-1 that has been reported to be expressed in the adrenal glands at both the embryonic and the adult stages (37). In adrenomedullary PC12 cells, macrophage-stimulating protein 1 has been shown to be a potent mitogen. It is difficult, however, to speculate about its possible effect in adrenocortical tumors until experiments are carried out in this cell system.
Another gene of this cluster is KCNQ1OT1, which belongs to the same 11p15.5 region as the IGF-II gene. KCNQ1OT1 encodes a noncoding antisense transcript within intron 10 of the KCNQ1 gene and might be involved in the regulation of parental imprinting of the centromeric domain of the 11p15 region. The KCNQ1OT1 and IGF-II genes are the only known genes in the 11p15 region that are maternally imprinted and paternally expressed. We previously showed that the main mechanism for overexpression of the IGF-II gene in malignant adrenocortical tumors was a paternal isodisomy (loss of the maternal allele and duplication of the paternal allele) (10, 21). It is therefore not surprising to find the concomitant expression of these two genes in the IGF-II cluster. The last gene belonging to this cluster is GAPD, encoding GAPD, a presupposed housekeeping gene. It has been reported previously that GAPD is up-regulated under a variety of circumstances, including hypoxia and apoptosis (38, 39), two events that are likely to occur in the center of solid tumors. It is therefore not so surprising to find this gene overexpressed in the population of adrenocortical carcinomas. It should be noted that this overexpression could not result from a technological artifact, because GAPD overexpression would be unlikely to nonrandomly occur in one particular subpopulation of tumors.
Of the 14 genes present in the steroidogenesis cluster, six encode enzymes or proteins directly involved the steroid biosynthesis pathway: the mitochondrial protein StAR, which facilitates the transfer of cholesterol to the inner mitochondrial membrane; the cytochromes P450scc (cholesterol desmolase), P450c17 (17-hydroxylase), P450c21 (21-hydroxylase), P450c11B1 (11ß-hydroxylase), and HSD3B. However, the correlation between the level of expression of these different enzymes in each individual tumor and their steroid secretion profile is not trivial. This indicates that the level of expression of some regulatory proteins, acting at the posttranscriptional level to modulate protein expression and/or enzymatic activity, has to be taken into consideration to fully explain the steroidogenic profiles of the tumors.
Another original observation in this study is the identification of a group of 14 genes whose expression level allowed us to perfectly discriminate recurring from nonrecurring tumors among the 13 carcinomas analyzed. Among these genes is ITGB2, encoding integrin ß2, a common subunit for several receptors specifically expressed at the surface of leukocytes (40). Integrin ß2 associates with distinct -subunits to form Lß2, Mß2, Dß2, or Xß2 integrins. These integrins are receptors for intracellular adhesion molecules 1–4 (ICAM1–4) and fibrinogen. Integrin Lß2 (leukocyte function-associated antigen-1) plays an important role in the rolling of leukocytes at the surface of the endothelium and their extravasation, as a receptor for ICAM-1 and ICAM-2 (41). This increased expression of ITGB2 is therefore likely to reflect an increased tumor infiltration by leukocytes. Granzyme A, which is encoded by a gene belonging to this same cluster, is a trypsin-like serine protease that is secreted by T lymphocytes and participates in target cell lysis during cell-mediated immune responses (42, 43). The expression of GZMA, like that of ITGB2, is likely to reflect infiltration by immune cells. The inflammatory status of the carcinoma at the time of resection could thus represent an important parameter to take in consideration for the prediction of metastatic evolution. The third gene in this cluster that is expressed with markedly distinct intensities between recurring and nonrecurring carcinomas is activating transcription factor-1. This gene encodes a cAMP-dependent transcription factor of the cAMP response element-binding protein family that is ubiquitously expressed. It was recently shown to be expressed in the human tumor cell line NCI-H295R, where, together with cAMP response element modulator-
, it functionally compensates for the lack of cAMP response element-binding protein (44).
In conclusion, this is the first study to report the parallel analysis of the expression profiles of hundreds of genes in human sporadic adrenocortical tumors in correlation with clinical follow-up of the cancer patients. The deliberate selection of a limited number of known genes with established biological functions (230 in this study) prevents us from extrapolating too much about the etiology of the disease. Certainly, a pangenomic analysis may be more successful in identifying new genes associated with adrenocortical tumorigenicity. During the course of the preparation of this manuscript, two such studies appeared in the literature (45, 46). Giordano et al. (45) analyzed the expression of 10,500 unique genes in a series of 11 adrenocortical carcinomas and four adenomas and compared these expression profiles with that of normal adrenal cortex tissue. However, no prognostic analysis based on clinical follow-up was carried out in this extensive work. Interestingly, several of the most differentially expressed genes identified in this large-scale study were also found in our clusters, including IGF-II, FGFR1, and CYP11B1. In the most recent study, Bourdeau et al. (46) analyzed the expression of a similar number of genes in a series of eight ACTH-independent macronodular adrenal hyperplasia and identified candidate genes up- and down-regulated in this rare disorder. The approach that we used has proven successful in identifying a set of 22 predictor genes that are reasonably good indicators of malignancy. It has also identified a cluster of 14 genes that seems to have a prognostic ability to identify the subpopulation of carcinomas that are at risk of postsurgical recurrence. Given the small size of this latter group of carcinomas analyzed, these results will deserve additional validation in a larger population and through the use of complementary techniques, such as in situ hybridization or immunohistochemistry.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
First Published Online December 21, 2004
Abbreviations: FGFR, Fibroblast growth factor receptor; GAPD, glyceraldehyde-3-phosphate dehydrogenase; HSD3B1, 3ß-hydroxysteroid dehydrogenase/5–4-isomerase type I; ICAM, intracellular adhesion molecule; StAR, steroidogenic acute regulatory protein.
Received June 7, 2004.
Accepted December 8, 2004.
|
References |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
-hydroxylase expression in bovine adrenocortical cells. Endocrinology 128:357–362 in the human adrenocortical cancer cell line H295R. J Clin Endocrinol Metab 85:345–354This article has been cited by other articles:
 |
|
 |
|
  C. Laurell, D. Velazquez-Fernandez, K. Lindsten, C. Juhlin, U. Enberg, J. Geli, A. Hoog, M. Kjellman, J. Lundeberg, B. Hamberger, et al. Transcriptional profiling enables molecular classification of adrenocortical tumours Eur. J. Endocrinol., July 1, 2009; 161(1): 141 - 152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P S H Soon, A J Gill, D E Benn, A Clarkson, B G Robinson, K L McDonald, and S B Sidhu Microarray gene expression and immunohistochemistry analyses of adrenocortical tumors identify IGF2 and Ki-67 as useful in differentiating carcinomas from adenomas Endocr. Relat. Cancer, June 1, 2009; 16(2): 573 - 583. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. de Reynies, G. Assie, D. S. Rickman, F. Tissier, L. Groussin, F. Rene-Corail, B. Dousset, X. Bertagna, E. Clauser, and J. Bertherat Gene Expression Profiling Reveals a New Classification of Adrenocortical Tumors and Identifies Molecular Predictors of Malignancy and Survival J. Clin. Oncol., March 1, 2009; 27(7): 1108 - 1115. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. R Fenton, M. Eliasziw, A. W Lyon, S. C Tough, and D. A Hanley Reply to HM Macdonald et al Am. J. Clinical Nutrition, March 1, 2009; 89(3): 927 - 927. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bielinska, H. Parviainen, S. Kiiveri, M. Heikinheimo, and D. B. Wilson REVIEW PAPER: Origin and Molecular Pathology of Adrenocortical Neoplasms Vet. Pathol., March 1, 2009; 46(2): 194 - 210. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. J. Giordano, R. Kuick, T. Else, P. G. Gauger, M. Vinco, J. Bauersfeld, D. Sanders, D. G. Thomas, G. Doherty, and G. Hammer Molecular Classification and Prognostication of Adrenocortical Tumors by Transcriptome Profiling Clin. Cancer Res., January 15, 2009; 15(2): 668 - 676. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Q. Almeida, M. C. B. V. Fragoso, C. F. P. Lotfi, M. G. Santos, M. Y. Nishi, M. H. S. Costa, A. M. Lerario, C. C. Maciel, G. E. Mattos, A. A. L. Jorge, et al. Expression of Insulin-Like Growth Factor-II and Its Receptor in Pediatric and Adult Adrenocortical Tumors J. Clin. Endocrinol. Metab., September 1, 2008; 93(9): 3524 - 3531. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. G. Fernandez-Ranvier, J. Weng, R.-F. Yeh, E. Khanafshar, I. Suh, C. Barker, Q. Y. Duh, O. H. Clark, and E. Kebebew Identification of Biomarkers of Adrenocortical Carcinoma Using Genomewide Gene Expression Profiling Arch Surg, September 1, 2008; 143(9): 841 - 846. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Volante, C Buttigliero, E Greco, A Berruti, and M Papotti Pathological and molecular features of adrenocortical carcinoma: an update J. Clin. Pathol., July 1, 2008; 61(7): 787 - 793. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. S. H. Soon, K. L. McDonald, B. G. Robinson, and S. B. Sidhu Molecular Markers and the Pathogenesis of Adrenocortical Cancer Oncologist, May 1, 2008; 13(5): 548 - 561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Doghman, M. Arhatte, H. Thibout, G. Rodrigues, J. De Moura, S. Grosso, A. N. West, M. Laurent, J.-C. Mas, A. Bongain, et al. Nephroblastoma Overexpressed/Cysteine-Rich Protein 61/Connective Tissue Growth Factor/Nephroblastoma Overexpressed Gene-3 (NOV/CCN3), a Selective Adrenocortical Cell Proapoptotic Factor, Is Down-Regulated in Childhood Adrenocortical Tumors J. Clin. Endocrinol. Metab., August 1, 2007; 92(8): 3253 - 3260. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. D. Delhanty, P. M. van Koetsveld, C. Gauna, B. van de Zande, G. Vitale, L. J. Hofland, and A. J. van der Lely Ghrelin and its unacylated isoform stimulate the growth of adrenocortical tumor cells via an anti-apoptotic pathway Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E302 - E309. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. G. Romero, S. Rilli, M. W. Plonczynski, L. L. Yanes, M. Y. Zhou, E. P. Gomez-Sanchez, and C. E. Gomez-Sanchez Adrenal transcription regulatory genes modulated by angiotensin II and their role in steroidogenesis Physiol Genomics, June 19, 2007; 30(1): 26 - 34. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Libe, A. Fratticci, and J. Bertherat Adrenocortical cancer: pathophysiology and clinical management Endocr. Relat. Cancer, March 1, 2007; 14(1): 13 - 28. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. N. West, G. A. Neale, S. Pounds, B. C. Figueredo, C. Rodriguez Galindo, M. A. D. Pianovski, A. G. Oliveira Filho, D. Malkin, E. Lalli, R. Ribeiro, et al. Gene Expression Profiling of Childhood Adrenocortical Tumors Cancer Res., January 15, 2007; 67(2): 600 - 608. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Assie, G. Antoni, F. Tissier, B. Caillou, G. Abiven, C. Gicquel, S. Leboulleux, J.-P. Travagli, C. Dromain, X. Bertagna, et al. Prognostic Parameters of Metastatic Adrenocortical Carcinoma J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 148 - 154. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E P Slater, S M Diehl, P Langer, B Samans, A Ramaswamy, A Zielke, and D K Bartsch Analysis by cDNA microarrays of gene expression patterns of human adrenocortical tumors. Eur. J. Endocrinol., April 1, 2006; 154(4): 587 - 598. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Horvath, L. Mathyakina, Q. Vong, V. Baxendale, A. L. Y. Pang, W.-Y. Chan, and C. A. Stratakis Serial Analysis of Gene Expression in Adrenocortical Hyperplasia Caused by a Germline PRKAR1A Mutation J. Clin. Endocrinol. Metab., February 1, 2006; 91(2): 584 - 596. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. S. Kirschner Emerging Treatment Strategies for Adrenocortical Carcinoma: A New Hope J. Clin. Endocrinol. Metab., January 1, 2006; 91(1): 14 - 21. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Libe and J. Bertherat Molecular genetics of adrenocortical tumours, from familial to sporadic diseases Eur. J. Endocrinol., October 1, 2005; 153(4): 477 - 487. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. H. Bassett, B. Mayhew, K. Rehman, P. C. White, F. Mantero, G. Arnaldi, P. M. Stewart, I. Bujalska, and W. E. Rainey Expression Profiles for Steroidogenic Enzymes in Adrenocortical Disease J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5446 - 5455. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Bornstein and P. J. Hornsby What Can We Learn from Gene Expression Profiling for Adrenal Tumor Management? J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1900 - 1902. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
