help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2004-1936
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Djouadi, F.
Right arrow Articles by Bastin, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Djouadi, F.
Right arrow Articles by Bastin, J.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
Hazardous Substances DB
*PALMITIC ACID
*SODIUM PALMITATE
*TRITIUM
Related Collections
Right arrow Metabolism
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 3 1791-1797
Copyright © 2005 by The Endocrine Society

Peroxisome Proliferator Activated Receptor {delta} (PPAR{delta}) Agonist But Not PPAR{alpha} Corrects Carnitine Palmitoyl Transferase 2 Deficiency in Human Muscle Cells

Fatima Djouadi, Flore Aubey, Dimitri Schlemmer and Jean Bastin

Institut National de la Santé et de la Recherche Médicale Unité 393, Hôpital Necker-Enfants Malades, 75015 Paris, France

Address all correspondence and requests for reprints to: Jean Bastin, Ph.D., Institut National de la Santé et de la Recherche Médicale Unité 393, Hôpital Necker-Enfants Malades, 149, rue de Sèvres, 75015 Paris, France. E-mail: bastin{at}necker.fr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Type 2 carnitine palmitoyl transferase (CPT2) is involved in the transfer of long-chain fatty acid into the mitochondria. CPT2-deficient patients carry gene mutations associated with different clinical presentations, correlating with various levels of fatty acid oxidation (FAO) and residual CPT2 enzyme activity. We tested the hypothesis that pharmacological stimulation of peroxisome proliferator-activated receptors (PPAR) can stimulate FAO in CPT2-deficient muscle cells. Accordingly, we show that a 48-h treatment of CPT2-deficient myoblasts by bezafibrate restored FAO in patient cells. Specific agonists of PPAR{delta} (GW{delta} 0742), and, to a lower extent, PPAR{alpha} (GW{alpha} 7647) also stimulated FAO in control myoblasts. However, when tested in CPT2-deficient myoblasts, only the {delta}-agonist was able to restore FAO, whereas the {alpha}-agonist had no effect. GW{delta} 0742 increased CPT2 mRNA levels, whereas no change in CPT2 transcripts was found in response to GW{alpha} 7647. Bezafibrate and GW{delta} 0742 increased residual CPT2 activity and normalized long-chain acylcarnitine production by deficient cells. Finally, CPT1-B mRNA was also stimulated after PPAR agonist treatment, and this likely takes part in drug-induced increase of FAO in control muscle cells. In conclusion, this study clearly suggests that PPARs could be therapeutic targets for correction of inborn ß-oxidation defects in human muscle. Furthermore, these data also illustrate a selective control of ß-oxidation enzyme gene expression by PPAR{delta}, with no contribution of PPAR{alpha}.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PEROXISOME PROLIFERATOR ACTIVATED receptors (PPARs) are a family of ligand-activated transcription factors known to regulate fatty acid (FA) metabolism by controlling the expression of specific target genes (1, 2). During the last decade, two members of this family, namely PPAR{alpha} and PPAR{gamma}, have been extensively studied. PPAR{alpha}, highly expressed in liver, heart, muscle, and kidney, has been shown to regulate FA oxidation (FAO), whereas PPAR{gamma}, mainly enriched in adipose tissue, is involved in adipocyte differentiation and lipid storage (2). The interest for the third sibling, PPARß/{delta}, is more recent. PPAR{delta} is expressed in many tissues including skeletal muscle (2). Besides its role in epidermal maturation (3), several studies have suggested its possible implication in inflammation (2). Given their roles in pivotal cell metabolic processes including lipid and glucose homeostasis, PPARs are implicated in the modulation of several metabolic disorders including: glucose intolerance, hyperinsulinemia, dyslipidemia, hypertension, and atherosclerosis (4, 5). For this reason, development of PPAR agonists has become, over the last few years an active field of research for pharmaceutical industries. Thus, fibrate class of lipid-lowering drugs is used for the treatment of dyslipidemia via their activation of PPAR{alpha}, whereas the thiazolidinedione class of insulin-sensitizing drugs known to act via PPAR{gamma} is used for the treatment of type 2 diabetes (2, 4). Therapeutic properties of PPAR agonists are related to their regulatory effects on FA metabolism. Surprisingly, however, almost no attention has been paid to potential applications of PPAR agonists in the field of inherited FAO disorders.

Because the first description of carnitine palmitoyl transferase (CPT) 2 deficiency in 1973 (6), more than 20 FAO defects have been described that may affect various steps of FA transfer or ß-oxidation into the mitochondria (7, 8). In most of these defects, disease-causing mutations have been characterized that may result in absent or nonfunctional protein or are compatible with production of enzyme with variable levels of residual activity (7). This is the case for the defect in CPT2, an inner mitochondrial membrane enzyme that catalyzes the transfer of long-chain FAs from cytosol to the mitochondrial matrix, in concert with its outer membrane counterpart, CPT1. CPT2 deficiency, one of the most common inborn error of FAO, has been divided in three major clinical phenotypes (9). The more frequent presentation is metabolic myopathy in teenagers and/or young adults. It is characterized by myalgia, muscle weakness, and recurrent attacks of rhabdomyolysis, usually triggered by exercise, fasting, or infection. This muscular form of CPT2 deficiency is usually considered as relatively mild as long as life-threatening complications, e.g. renal insufficiency, are prevented. In contrast, the infantile form of CPT2 deficiency is more severe, and possibly associates myopathy, cardiomyopathy, and acute liver failure. Heart beat disorders frequently observed in this presentation are life threatening, exposing to risk of sudden death during infancy. Finally, a neonatal form, generally lethal during the first month of life has also been described, characterized by brain dysgenesis and cystic renal dysplasia, in addition to other infantile-form symptoms (9).

These different disease phenotypes correlate to a certain extent with specific genotypes and the severity of the metabolic block, assessed from patient cell studies (10). Thus, the severe hepatocardiomuscular form is generally associated with mutations in exon 4 or 5 of the CPT2 gene, which encode the putative catalytical core of the enzyme, and this goes together with barely detectable enzyme activity and FAO flux. In contrast, the milder adult form is characterized by a low but significant residual FAO capacity, related to an altered but still functional enzyme activity, with mutations generally found in exons 1, 2, or 3 of the CPT2 gene (9).

Taken together, these data consistently suggest that, at least in some cases, it could be possible to improve patient condition by treatment based on stimulation of residual CPT2 enzyme activity or FAO capacity. PPAR agonists might conceivably be efficient to achieve this goal and new applications found for correction of ß-oxidation enzyme genetic defect. Because CPT2 defect is primarily associated with myopathy, we tested the effects of PPAR{alpha} and PPAR{delta} agonists on FAO in myoblasts of CPT2-deficient patients and compared their effects at various levels of the FAO pathway.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

Culture media and fetal bovine serum were from Invitrogen (Cergy-Pontoise, France). Ultroser was purchased from BioSepra (Cergy-Saint-Christophe, France). 3H-palmitate was from PerkinElmer (Norwalk, CT). Carnitine, BSA, and bezafibrate were from Sigma (Meylan, France). GW{delta} 0742 and GW{alpha} 7647 were obtained from Dr. Kevin Buchan (GlaxoSmithKline, Research Triangle Park, NC).

Molecular analysis of CPT2-deficient patients

The three CPT2-deficient patients had a typical muscle-type disease with an age of onset around 10 yr, characterized by myalgia since childhood and recurrent attack of rhabdomyolysis. CPT2 deficiency was diagnosed by a low CPT2 enzyme activity measured on lymphocytes as previously described (11). Mutation analysis of patients was performed on genomic DNAs extracted according to a standard method. Sequences of all primers used in this study have been reported elsewhere (12). The five CPT2 exons with flanking intronic regions were amplified. PCR products were then sequenced using the Big Dye terminator cycle sequencing kit (ABI Prism; PE Applied, Biosystems, Foster City, CA).

Primary cultures of human muscle cells and treatments

Informed consent was obtained from all subjects of this study. Control human muscle biopsies were obtained from individuals who underwent surgery for orthopedic corrections. Muscle biopsies were obtained from the three patients with adult mild form of CPT2 defect described in the previous paragraph. The biopsies were mainly taken from the vastus lateralis part of musculus quadriceps. The satellite cells were isolated from the biopsy by digestion of the tissue with proteolytic enzymes (0.1% trypsin and 0.05% collagenase) and grown in Ham’s F-10 medium with 20% fetal calf serum, 1% Ultroser, 1 mM carnitine, 100 U/ml penicillin, and 0.1 mg/ml streptomycin (myoblast growth medium), as previously described in detail (13). For some experiments, myoblasts were allowed to differentiate into myotubes for 12 d in DMEM containing 2% horse serum, 1 mM carnitine, and 1% antibiotics. Cells were grown at 37 C in a humidified atmosphere of 5% CO2 and subcultured for the various experiments. The medium was changed every 4 d. Stock solution of the different PPAR agonists and bezafibrate were done in dimethyl sulfoxide (DMSO) and stored at –20 C. The final concentrations were obtained by dilution with culture media. DMSO (less than 0.1%) or PPAR-selective compounds or bezafibrate were added to the cells for 48 h.

Determination of FAO

FAO was measured by quantitating the production of 3H2O from (9,10-3H) palmitate as described previously (13), with slight modifications. Briefly, the cells were trypsinized, counted, and plated (5 x 103 cells/well in 24-well coated microplates) and allowed to grow for 6 d in myoblast growth medium. Tritiated water release experiments were performed in triplicate. Cultured muscle cell layers were washed three times with Dulbecco’s PBS. Then 200 µl (9,10(n)-3H) palmitic acid (60 Ci/mmol; NEN Life Science Products, Boston, MA) bound to FA-free albumin (final concentration, 125 µM; palmitate to albumin 1:1) and 1 mM carnitine were added per well. Incubation was carried out for 2 h at 37 C. After incubation, the mixture was removed and added to a tube containing 200 µl cold 10% trichloroacetic acid. The tubes were centrifuged 10 min at 2200 x g at 4 C and aliquots of supernatants (350 µl) were removed, mixed with 55 µl of 6 N NaOH, and applied to ion-exchange resin. The columns were washed twice with 750 µl water and the eluates were counted. Cell protein content was determined by the Lowry method (14). Palmitate oxidation rates by fibroblasts were expressed as nanomoles of 3H FA oxidized per hour per milligram of cell protein (nanomoles 3H FA per H per milligram protein).

CPT2 enzyme activity

CPT2 activity was determined by measuring the palmitoyl-L-(methyl-14C) carnitine formed from L-(methyl-14C) carnitine and palmitoyl-coenzyme A after solubilization of mitochondrial membranes in 0.5 M KCl 1% Tween 20 (pH 7.2) as previously described (11). The assay was performed at 30 C for 8 min with 200 µl of myoblasts extracts in 500 µl of a medium containing 100 mM Tris (pH 7.2), 2.5 mM reduced glutathione, 0.4% Tween 20, 0.23 M KCl, 1 mM palmitoyl-coenzyme A, and 2.5 mM L-(methyl-14C) carnitine (56 mCi/mmol; Amersham, Les Ulis, France). CPT2 activity was expressed as nanomoles palmitoyl-L-(methyl-14C) carnitine formed per minute per milligram of cell protein (nanomoles 14C-PalCar per minute per milligram protein).

Real-time quantitative PCR

Total RNA was prepared using TriZol reagent according to the manufacturer’s protocol (Life Technologies, Paisley, UK), treated with DNase I (Ambion, UK) and quantified using the SYBR Green I kit from Roche Diagnostics (Mannheim, Germany). The real-time quantitative PCR (RTQ-PCR) was performed using a LightCycler instrument (Roche Diagnostics) according to the manufacturer’s instructions. RTQ-PCR primers were designed using the sequences available in GenBank and spanned an intron/exon boundary. The sequences for human CPTI were: forward, TTCCTTGCTGAGGTGCTCTCG and reverse, TTCTCGCCTGCAATCATGTAGG. The sequence used for analysis of human CPT2 was published previously (11). RNA samples were normalized for comparison by determining ß-actin levels by RTQ-PCR. The results of RTQ-PCR are given in arbitrary units and expressed as fold changes in mRNA levels in cells treated with various compounds, relative to vehicle-treated controls.

Analysis of acylcarnitine

Electrospray ionization tandem mass spectrometry (MS-MS) was used to study acylcarnitine profiles in palmitate-loaded myoblasts. Briefly, cells were cultured in 24-well plates as described for determination of FAO, and 6 d after plating, the culture medium (1 ml/well) was replaced by fresh myoblast growth medium containing palmitate bound to BSA in a 4:1 molar ratio to reach a final palmitate concentration of 200 µM. Myoblasts were cultured 48 h, and this culture medium was then collected and stored at –80 C until analysis. Extraction of acylcarnitines was performed on 100-µl culture medium aliquots added with 5 µl deuterium-labeled acylcarnitines solution (Cambridge Isotope Laboratories, Woburn, MA) used as internal standard. Six calibration solutions were prepared by adding unlabeled palmitoyl-L-carnitine and octanoyl-L-carnitine (final concentration range, 12–120 nM) to 100 µl growth medium containing palmitate bound to BSA containing deuterated internal standard. One milliliter of ethanol was added to the 100-µl samples, and after vigorous mixing and centrifugation (5', 13,000 rpm), the supernatant was evaporated at 45 C under nitrogen. The extracts were finally dissolved in 200 µl of mobile phase (Acetonitril/H2O 1:1 containing 0.25% formic acid) for MS-MS analysis.

Thirty microliters of each sample were injected into a API3000 triple quadruple mass spectrometer (Sciex, Applied Biosystems) using a HP 1100 autosampler (Agilent Technology, France). Analysis was performed in positive ionization mode. Mass spectra of acyl carnitines were obtained by continuous scanning of precursor of m/z 85 (15) between 169 and 415 m/z with a dual time of 0.65 sec. Electrospray ionization was performed at 450 C and 4000 V. Nitrogen was used as nebulization, curtain, and collision gas. Parameters used were: 45 V declustering potential, 340 V focus potential, 10 V entrance potential, 42 V collision energy, and 8V cell exit potential. The concentrations of acylcarnitines were processed using the Analyst 1.3.2. system (Sciex, Applied Biosystems), measuring the intensities of analyte/internal standard ratio, and concentration data from the external calibrated solutions. Cell proteins were measured by the Lowry method (14).

Expression of results and statistical analysis

Data are means ± SD. Differences between vehicle and PPAR agonists or bezafibrate-treated cells were analyzed by one-way ANOVA and the Fisher test; P < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Molecular analysis of CPT2-deficient patients

Compared with the reference sequence of CPT2 gene, several nucleotide substitutions were detected in the patients’ DNAs. The molecular analysis of patient 1 permitted to identify two heterozygous nucleotide substitutions, namely C338T (exon 3) and A1883C (exon 5) predictive of S113L and Y628S mutations, respectively (Fig. 1Go). These two mutations have already been reported in other CPT2-deficient patients (9). Patient 2 carried the same S113L mutation as patient 1, associated with a T563C (exon 4) missense mutation predictive of an F188S mutation. This latter mutation was never identified before. Finally, CPT2 gene analysis of patient 3 showed the presence of S113L in a homozygous state.



View larger version (54K):
[in this window]
[in a new window]
 
FIG. 1. Mutation analysis of the CPT2 gene. Partial sequences of genomic DNA of patient 1, 2, and 3. The arrows show the positions of the mutations.

 
Dose-response effects of PPAR{alpha}- or PPAR{delta}-selective agonists on FAO in control or CPT2-deficient muscle cells

The effects of PPAR agonists on 3H-palmitate oxidation were first compared in myoblasts from control individuals (Fig. 2AGo) or one CPT2-deficient patient (Fig. 2BGo). In control cells, the PPAR{delta} agonist produced maximal FAO stimulation (+45%, P < 0.001), and this was already achieved at the lowest dose tested (0.01 µM). Similar stimulatory effects of the PPAR{delta} agonist GW{delta} 0742 were observed in patient myoblasts at the three doses tested (+42%; P < 0.001). Exposure of control myoblasts to GW{alpha} 7647 produced no change in FAO at 0.01 or 0.1 µM, whereas higher doses (1 or 2 µM) induced a moderate but significant FAO increase (+23%; P < 0.01). In CPT2-deficient cells, in contrast, treatment by the PPAR{alpha} agonist induced no significant change in FAO, whatever dose used.



View larger version (61K):
[in this window]
[in a new window]
 
FIG. 2. Effects of PPAR agonists on FAO. A and B, Dose-response studies of GW{alpha} 7647 and GW{delta} 0742 in control (A) and CPT2-deficient (B) myoblasts (MB) treated for 48 h. C, Effect of maximal doses of GW{alpha} 7647 and GW{delta} 0742 on 3H-palmitate oxidation in CPT2-deficient myotubes (MT). 3H-palmitate oxidation measurements were performed at least in triplicates. The results are means ± SD. ***, P < 0.001, compared with the DMSO-treated MB. §, P < 0.001, compared with DMSO-treated myotubes.

 
These observations were confirmed in myotubes differentiated from patient myoblasts (Fig. 2CGo). Consistent with other reports, we found an increase (x2.3) in FAO capacity after muscle cell differentiation (16). In CPT2-deficient myotubes, as observed in myoblasts, treatment by 0.01 µM GW{delta} 0742 induced a robust increase (+60% P < 0.001) in 3H-palmitate oxidation, whereas GW{alpha} 7647 had no effect. Control myotubes responded similarly to control myoblasts, exhibiting a 32% increase in FAO after treatment with GW{alpha} 7647 and a 55% FAO increase with GW{delta} 0742 (data not shown).

PPAR{delta}-specific agonist GW{delta} 0742 restores normal levels of FAO in CPT2-deficient myoblasts

FAO rates were then measured in myoblasts from three different patients treated by optimal doses of GW{alpha} 7647 or GW{delta} 0742 or by 200 µM bezafibrate. As shown in Fig. 3Go, exposure to GW{alpha} 7647 induced no changes in FAO capacities in any of the patient cell lines. In contrast, treatment by GW{delta} 0742 or bezafibrate resulted in a significant increase in 3H-palmitate oxidation in all deficient cells. Thus, palmitate oxidation of myoblasts from patients 1–3 treated by 10 nM GW{delta} 0742 for 48 h was 1.6-, 1.6-, and 1.5-fold higher than vehicle-treated myoblasts (P < 0.001). Similar levels of FAO were reached in patient myoblasts whether treated by GW{delta} 0742 or bezafibrate, and these values were comparable with those measured in control myoblasts treated in parallel, demonstrating that complete restoration of FAO capacities could be achieved in the three CPT2-deficient cell lines.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 3. PPAR{delta} agonist and bezafibrate correct FAO in CPT2-deficient myoblasts. Myoblasts were treated for 48 h with GW{alpha} 7647 (1 µM), GW{delta} 0742 (10 nM), bezafibrate (200 µM), or vehicle only (DMSO). The assays were performed at least in triplicate, and the results are means ± SD. ***, P < 0.001, compared with DMSO-treated myoblasts.

 
PPAR{delta} agonist but not PPAR{alpha} agonist stimulates CPT2 gene expression

To further investigate the PPAR{delta}-specific response of CPT2-deficient myoblasts, we evaluated the effects of PPAR agonists on gene expression of the CPT shuttle. Whereas CPT2 is ubiquitously expressed and encoded by one gene, CPT1 exists as three distinct isoforms called liver (CPT1-A); muscle (CPT1-B) (17), and brain (CPT1-C) (18), encoded by three different genes. We thus performed in parallel the analysis of CPT2 and CPT1-B transcript levels in treated cells. The results reported in Table 1Go show that treatment by GW{delta} 0742 resulted in a stimulation (+38 to +59%; P < 0.001) of CPT2 gene expression in control and patient cells as well, and similar results were obtained after cell treatment by bezafibrate (+30 to +61%; P < 0.001). GW{alpha} 7647, in contrast, induced no change in CPT2 mRNA in patient or control myoblasts.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Effects of selective PPAR{alpha} and PPAR{delta} agonists and of bezafibrate on CPT2 and CPT1-B gene expression

 
Contrary to CPT2, the CPT1-B gene was found up-regulated in myoblasts in response to the three compounds tested. Indeed, GW{delta} 0742 appeared as a potent stimulator of CPT1-B gene expression in CPT2-deficient (+244 to +294%) or control (+282%) myoblasts. Comparable CPT1-B mRNA inductions (+200 to +336%) were observed in patient or control cells treated by bezafibrate. Finally, the GW{alpha} agonist also led to significant increases in CPT1-B gene expression in myoblasts, although to a lesser extent (+60 to +94%), compared with the two other compounds tested.

PPAR{delta} agonist and bezafibrate stimulates CPT2 enzyme activity

To determine whether stimulation of CPT2 gene expression actually resulted in changes at the protein level, we measured CPT2 activity in myoblasts treated with either GW{delta} 0742 or bezafibrate (Fig. 4Go). This showed that exposure of patient myoblasts to GW{delta} 0742 or bezafibrate led to raise residual CPT2 enzyme activity 1.8-fold in these deficient cells. In parallel, CPT2 enzyme activity was also induced by about 20% in control myoblasts treated similarly.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 4. Effect of GW{delta} 0742 and bezafibrate on CPT2 enzyme activity. Control and CPT2-deficient myoblasts were incubated for 48 h with GW{delta} 0742 (10 nM) and bezafibrate (200 µM) and then harvested for CPT2 enzyme activity measurement as described in Materials and Methods. All determinations were performed in duplicate. Results are means ± SD of two separate experiments. ***, P < 0.001 vs. vehicle (DMSO).

 
Bezafibrate corrects C16:0 acylcarnitine profiles

Analysis of acylcarnitine intermediates from blood samples is widely used for neonatal screening of FAO defects (15). Another recently developed application consists of incubation of cultured cells with palmitate and carnitine, followed by analysis of acylcarnitine intermediates by MS-MS (19). Thus, specific acylcarnitine profiles by MS-MS are now available for most of the known FAO disorders (19, 20). CPT2 deficiency is characterized by a marked elevation of C16-acylcarnitine species together with a reduction of C8-acylcarnitine signal (21).

Because bezafibrate gave results similar to GW{delta} 0742 for all biochemical parameters studied and given its better stimulatory effect on CPT1-B mRNA, we investigated the effect of bezafibrate on C8-acylcarnitine and C16-acylcarnitine intermediates in control and CPT2-deficient myoblasts. The results obtained indicate that, compared with control, CPT2-deficient myoblasts exhibited the expected accumulation in C16-acylcarnitine and the slight diminution of C8-acylcarnitine (Fig. 5Go). The production of C16-acylcarnitine in patient cells was 3-fold (patient 3) to 4.9-fold (patient 2) higher than in control cells. Forty-eight hours of treatment of CPT2-deficient cells with bezafibrate normalized C16-acylcarnitine production to control levels. Interestingly, bezafibrate also reduced the C8-acylcarnitine production in both control and CPT2-deficient cells.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 5. MS-MS analysis of C8-acylcarnitine and C16-acylcarnitine species in cultured human myoblasts. Myoblasts were incubated in medium containing L-carnitine and palmitate for 48 h. Extraction and quantitative analysis of acylcarnitines were then performed as described in Materials and Methods. Determinations were performed in triplicate. Results are means ± SD from two different experiments. **, P < 0.01 and ***, P < 0.001, compared with the control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Synthetic agonists of PPAR initially developed as hypolipidemic or antidiabetic agents are now known to coordinately regulate different metabolic pathways in distinct target tissues (2). These regulatory effects allow adaptation in cell, organ, and whole-body energy homeostasis. For these reasons, possible applications of PPAR agonists in the fields of obesity or metabolic syndrome therapy have focused much attention in recent years. Data obtained in the present study clearly suggest that PPARs could also be therapeutic targets for correction of inborn errors of mitochondrial FAO, responsible for various forms of metabolic myopathies.

In a recent study, we demonstrated that exposure of CPT2-deficient patient fibroblasts to bezafibrate led to restore normal FAO capacities in these cells (11). Because genetic defect in CPT2 is clinically characterized by myopathic symptoms and the PPAR signaling pathway is known to be cell specific, it was essential to determine whether correction of CPT2-defect can be obtained in patient muscle cells. Here we show that a 48-h treatment of CPT2-deficient myoblasts by bezafibrate, a dual agonist of the {alpha}- and {delta}-PPAR isoforms (22), induced complete correction of FAO flux in these deficient cells. These effects of bezafibrate were obtained in three patient cell lines carrying distinct gene mutations compatible with the adult presentation of the disease.

Correction of FAO was clearly related to a bezafibrate-induced stimulation of CPT2 gene expression, leading to an increase in residual CPT2 enzyme activity in deficient myoblasts. Untreated patient myoblasts revealed abnormally high levels of long-chain acylcarnitines, a sensitive index of metabolic blockade in the FAO pathway, which returned to basal levels after exposure to bezafibrate. Therefore, stimulation of residual CPT2 enzyme activity by bezafibrate allowed to restore normal reaction equilibrium at the CPT2 step and prevented the production of toxic metabolites by deficient muscle cells. In fact, acylcarnitine accumulation is considered one of the main factors involved in the pathogenesis of FAO defect (23). Normalization of acylcarnitines is therefore a major issue in support of therapeutic properties of PPAR agonists in patient cells.

Altogether, data obtained in this study therefore establish that pharmacological stimulation of PPARs provides an efficient way to restore normal FAO flux in CPT2-deficient cells. To delineate which PPAR isoform was involved in bezafibrate effects, we studied the effects of high-affinity ligands of the various PPAR isoforms in muscle cells. Results obtained show that the {delta}- and, to a lower extent, the {alpha}-specific agonists were able to stimulate palmitate oxidation in control myoblasts. However, when tested in CPT2-deficient myoblasts, only the {delta}-specific agonist was able to restore FAO flux, whereas the {alpha}-specific agonist had no effect. PPAR{alpha} and PPAR{delta} were both expressed in a similar pattern (respective ratio 1:5) in patient and control cells, whereas PPAR{gamma} was extremely low (data not shown). This PPAR isoform distribution is in agreement with the one reported by Chevillotte et al. (24) in human cultured myotubes. The differential effects of the agonists appeared therefore unrelated to possible alterations of PPAR signaling pathway or abundance in patient cells. Similar experiments were then performed in myotubes differentiated from patient myoblasts and confirmed that GW{alpha} 7647 did not increase FAO, whereas a robust stimulation of FAO occurred in myotubes in response to GW{delta} 0742. Responses to various agonists were therefore not affected by the proliferation/differentiation state of cultured muscle cells and could not be attributed to a particularly low level of PPAR{alpha} gene expression in this cell system. Overall, the specific stimulatory effects of GW{delta} 0742 in deficient cells were clearly related to its inductive effects on CPT2 gene expression, whereas no change in CPT2 transcripts was noted in response to the GW{alpha} agonist.

It can thus be concluded that corrective effects of bezafibrate are related to its ability to activate the PPAR{delta} signaling pathway in CPT2-deficient myoblasts, whereas activation of PPAR{alpha} is inefficient. Because, however, control myoblasts treated by the GW{alpha} agonist exhibited increased FAO rates, we hypothesized that this was possibly due to PPAR{alpha}-dependent stimulation of genes other than CPT2 in the FAO pathway. In keeping with this, myoblasts treated by GW{alpha} 7647 showed higher levels of CPT1-B gene expression and possibly several others genes involved in FAO. Interestingly, CPT1B gene expression was clearly stimulated in response to GW{alpha} 7647 and GW{delta} 0742 as well (or bezafibrate), in contrast to CPT2.

The CPT1-CPT2 system is an essential regulatory step of FAO flux within the mitochondria. Numerous data point out the importance of CPT1 regulation, either via short-term modulation by malonyl-coenzyme A (25) or control of its transcript levels via PPAR or other nuclear receptors (26). The CPT2 gene has comparatively received less attention as a possible regulatory step of mitochondrial FAO pathway. In this regard, the present data point out that control of FAO flux in human myoblasts can clearly be exerted by pharmacological manipulations targeted to CPT1 or CPT2 as well. Furthermore, these data establish that the various PPARs can selectively target to one or both of the enzyme steps to modulate FAO, depending on the selective activation of {alpha}- or {delta}-PPAR isoform.

PPAR{alpha} was long thought to be the master regulator of FAO in muscle, like in other tissues with high FA use (27). However, a dual control of muscle ß-oxidation by the {alpha}- and {delta}-PPAR isoforms was first suggested a few years ago by Muoio et al. (28), who showed that both {alpha}- and {delta}-agonist stimulated oleate oxidation in human myotubes to a similar extent. Very recent reports go beyond this notion and rather support a prominent role of the {delta}-isoform in the control of muscle mitochondrial ß-oxidation, as suggested by the present study. Accordingly, Wang et al. (29) found that C2C12 myotubes treated by a PPAR{delta} agonist exhibited significant increases in FAO, with little or no effects of a PPAR{alpha} agonist. Similarly, Tanaka et al. (30) showed that PPAR{delta} treatment induced FAO in L6 myotubes as well as mouse skeletal muscle, whereas little or no induction was observed by PPAR{alpha} agonists.

Regarding the effect of the various agonists on gene expression in human skeletal muscle cells, our results are in agreement with those of Muoio et al. (28) reporting a 2.2- and 2.8-fold stimulation of CPT1-B to GW{alpha} 7647 and GW{delta} 0742, respectively. Thus, PPAR{delta} is capable of activating known PPAR{alpha} target genes, illustrating a possible overlapping regulation of FAO genes by both {alpha}- and {delta}-isoforms in muscle. Importantly, however, this study provides the first data, suggesting that CPT2 and possibly another ß-oxidation enzyme gene, might be under specific control of PPAR{delta} and would not respond to PPAR{alpha} agonists.

In conclusion, these data point out a major role of PPAR{delta} in FAO regulation in human muscle and clearly suggest possible therapeutic applications of PPAR agonist for correction of inborn errors of metabolism.


    Acknowledgments
 
We thank Dr. P. Laforet and Dr. B. Eymard for providing the patient biopsies.


    Footnotes
 
This work was supported by a grant from the Association Française contre les Myopathies.

First Published Online December 21, 2004

Abbreviations: CPT, Carnitine palmitoyl transferase; DMSO, dimethyl sulfoxide; FA, fatty acid; FAO, fatty acid oxidation; MS-MS, tandem mass spectrometry; PPAR, peroxisome proliferator activated receptor; RTQ-PCR, real-time quantitative PCR.

Received September 30, 2004.

Accepted December 9, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Berger J, Moller DE 2002 The mechanisms of action of PPARs. Annu Rev Med 53:409–435[CrossRef][Medline]
  2. Lee CH, Olson P, Evans RM 2003 Minireview: lipid metabolism, metabolic diseases, and peroxisome proliferator-activated receptors. Endocrinology 144:2201–2207[Abstract/Free Full Text]
  3. Peters JM, Lee SS, Li W, Ward JM, Gavrilova O, Everett C, Reitman ML, Hudson LD, Gonzalez FJ 2000 Growth, adipose, brain, and skin alterations resulting from targeted disruption of the mouse peroxisome proliferator-activated receptor ß({Delta}). Mol Cell Biol 20:5119–5128[Abstract/Free Full Text]
  4. Barbier O, Torra IP, Duguay Y, Blanquart C, Fruchart JC, Glineur C, Staels B 2002 Pleiotropic actions of peroxisome proliferator-activated receptors in lipid metabolism and atherosclerosis. Arterioscler Thromb Vasc Biol 22:717–726[Abstract/Free Full Text]
  5. Vamecq J, Latruffe N 1999 Medical significance of peroxisome proliferator-activated receptors. Lancet 354:141–148[CrossRef][Medline]
  6. Di Mauro S, Di Mauro P 1973 Muscle carnitine palmitoyl transferase deficiency and myoglobinuria. Science 182:929–931[Abstract/Free Full Text]
  7. Gregersen N, Andresen BS, Corydon MJ, Corydon TJ, Olsen RK, Bolund L, Bross P 2001 Mutation analysis in mitochondrial fatty acid oxidation defects: Exemplified by acyl-CoA dehydrogenase deficiencies, with special focus on genotype-phenotype relationship. Hum Mutat 18:169–189[CrossRef][Medline]
  8. Rinaldo P, Matern D, Bennett MJ 2002 Fatty acid oxidation disorders. Annu Rev Physiol 64:477–502[CrossRef][Medline]
  9. Thuillier L, Rostane H, Droin V, Demaugre F, Brivet M, Khadom N, Prip-Buus C, Gobin S, Saudubray JM, Bonnefont JP 2003 Correlation between genotype, metabolic data, and clinical presentation in carnitine palmitoyltransferase 2 deficiency. Hum Mutat 5:493–501
  10. Gregersen N, Bross P, Andresen BS 2004 Genetic defects in fatty acid ß-oxidation and acyl-CoA dehydrogenases. Molecular pathogenesis and genotype-phenotype relationships. Eur J Biochem 271:470–482[Medline]
  11. Djouadi F, Bonnefont JP, Thuillier L, Droin V, Kadhom N, Munnich A, Bastin J 2003 Correction of fatty acid oxidation in carnitine palmitoyl transferase II-deficient cultured skin fibroblasts by bezafibrate. Pediatr Res 54:446–451[CrossRef][Medline]
  12. Thuillier L, Sevin C, Demaugre F, Brivet M, Rabier D, Droin V, Aupetit J, Abadi N, Kamoun P, Saudubray JM, Bonnefont JP 2000 Genotype/phenotype correlation in carnitine palmitoyl transferase II deficiency: lessons from a compound heterozygous patient. Neuromuscul Disord 10:200–205[CrossRef][Medline]
  13. Djouadi F, Bonnefont JP, Munnich A, Bastin J 2003 Characterization of fatty acid oxidation in human muscle mitochondria and myoblasts. Mol Genet Metab 78:112–118[CrossRef][Medline]
  14. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ 1951 Protein measurement with the folin phenol reagent. J Biol Chem 193:265–275[Free Full Text]
  15. Carpenter KH, Wiley V 2002 Application of tandem mass spectrometry to biochemical genetics and newborn screening. Clin Chim Acta 322:1–10[CrossRef][Medline]
  16. Muoio DM, Way JM, Tanner CJ, Winegar DA, Kliewer SA, Houmard JA, Kraus WE, Dohm GL 2002 Peroxisome proliferator-activated receptor-{alpha} regulates fatty acid utilization in primary human skeletal muscle cells. Diabetes 51:901–909[Abstract/Free Full Text]
  17. van der Leij FR, Huijkman NC, Boomsma C, Kuipers JR, Bartelds B 2000 Genomics of the human carnitine acyltransferase genes. Mol Genet Metab 71:139–153[CrossRef][Medline]
  18. Price N, van der Leij F, Jackson V, Corstorphine C, Thomson R, Sorensen A, Zammit V 2002 A novel brain-expressed protein related to carnitine palmitoyltransferase I. Genomics 80:433–442[CrossRef][Medline]
  19. Roe CR, Roe DS 1999 Recent developments in the investigations of inherited metabolic disorders using cultured human cells. Mol Genet Metab 68:243–257[CrossRef][Medline]
  20. Tyni T, Pourfarzam M, Turnbull DM 2002 Analysis of mitochondrial fatty acid oxidation intermediates by tandem mass spectrometry from intact mitochondria prepared from homogenates of cultured fibroblasts, skeletal muscle cells, and fresh muscle. Pediatr Res 52:64–70[Medline]
  21. Shen JJ, Matern D, Millington DS, Hillman S, Feezor MD, Bennett MJ, Qumsiyeh M, Kahler SG, Chen YT, Van Hove JL 2000 Acylcarnitines in fibroblasts of patients with long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency and other fatty acid oxidation disorders. J Inherit Metab Dis 23:27–44[CrossRef][Medline]
  22. Peters JM, Aoyama T, Burns AM, Gonzalez FJ 2003 Bezafibrate is a dual ligand for PPAR{alpha} and PPARß: studies using null mice. Biochim Biophys Acta 1632:80–89[Medline]
  23. Sim KG, Hammond J, Wilcken B 2002 Strategies for the diagnosis of mitochondrial fatty acid ß-oxidation disorders. Clin Chim Acta 323:37–58[CrossRef][Medline]
  24. Chevillotte E, Rieusset J, Roques M, Desage M, Vidal H 2001 The regulation of uncoupling protein-2 gene expression by {omega}-6 polyunsaturated fatty acids in human skeletal muscle cells involves multiple pathways, including the nuclear receptor peroxisome proliferator-activated receptor ß. J Biol Chem 276:10853–10860[Abstract/Free Full Text]
  25. McGarry JD, Brown NF 1997 The mitochondrial carnitine palmitoyltransferase system. From concept to molecular analysis. Eur J Biochem 244:1–14[Medline]
  26. Brandt JM, Djouadi F, Kelly DP 1998 Fatty acids activate transcription of the muscle carnitine palmitoyltransferase I gene in cardiac myocytes via the peroxisome proliferator-activated receptor {alpha}. J Biol Chem 273:23786–23792[Abstract/Free Full Text]
  27. Kelly DP 2003 PPARs of the heart, three is a crowd. Circ Res 92:482–484[Free Full Text]
  28. Muoio DM, MacLean PS, Lang DB, Li S, Houmard JA, Way JM, Winegar DA, Corton JC, Dohm GL, Kraus WE 2002 Fatty acid homeostasis and induction of lipid regulatory genes in skeletal muscles of peroxisome proliferator-activated receptor (PPAR) {alpha} knock-out mice. Evidence for compensatory regulation by PPAR {Delta}. J Biol Chem 277:26089–26097[Abstract/Free Full Text]
  29. Wang YX, Lee CH, Tiep S, Yu RT, Ham J, Kang H, Evans RM 2003 Peroxisome-proliferator-activated receptor {Delta} activates fat metabolism to prevent obesity. Cell 113:159–170[CrossRef][Medline]
  30. Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchiyama Y, Sumi K, Iguchi H, Ito S, Doi T, Hamakubo T, Naito M, Auwerx J, Yanagisawa M, Kodama T, Sakai J 2003 Activation of peroxisome proliferator-activated receptor {Delta} induces fatty acid ß-oxidation in skeletal muscle and attenuates metabolic syndrome. Proc Natl Acad Sci USA 100:15927–15929



This article has been cited by other articles:


Home page
NEJMHome page
J.-P. Bonnefont, J. Bastin, A. Behin, and F. Djouadi
Bezafibrate for an Inborn Mitochondrial Beta-Oxidation Defect
N. Engl. J. Med., February 19, 2009; 360(8): 838 - 840.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Bastin, F. Aubey, A. Rotig, A. Munnich, and F. Djouadi
Activation of Peroxisome Proliferator-Activated Receptor Pathway Stimulates the Mitochondrial Respiratory Chain and Can Correct Deficiencies in Patients' Cells Lacking Its Components
J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1433 - 1441.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Stefan, C. Thamer, H. Staiger, F. Machicao, J. Machann, F. Schick, C. Venter, A. Niess, M. Laakso, A. Fritsche, et al.
Genetic Variations in PPARD and PPARGC1A Determine Mitochondrial Function and Change in Aerobic Physical Fitness and Insulin Sensitivity during Lifestyle Intervention
J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1827 - 1833.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
F. Djouadi, F. Aubey, D. Schlemmer, J.P.N. Ruiter, R.J.A. Wanders, A.W. Strauss, and J. Bastin
Bezafibrate increases very-long-chain acyl-CoA dehydrogenase protein and mRNA expression in deficient fibroblasts and is a potential therapy for fatty acid oxidation disorders
Hum. Mol. Genet., September 15, 2005; 14(18): 2695 - 2703.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Djouadi, F.
Right arrow Articles by Bastin, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Djouadi, F.
Right arrow Articles by Bastin, J.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
Hazardous Substances DB
*PALMITIC ACID
*SODIUM PALMITATE
*TRITIUM
Related Collections
Right arrow Metabolism


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals