This Article Abstract Full Text (PDF) All Versions of this Article: 90/3/1323    most recent Author Manuscript (PDF) Submit a related Letter to the Editor Purchase Article View Shopping Cart Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Vallette-Kasic, S. Articles by Drouin, J. Search for Related Content PubMed PubMed Citation Articles by Vallette-Kasic, S. Articles by Drouin, J. Related Collections Adrenal and Hypertension Pediatric Endocrinology

Congenital Isolated Adrenocorticotropin Deficiency: An Underestimated Cause of Neonatal Death, Explained by TPIT Gene Mutations

Laboratoire de Génétique Moléculaire, Institut de Recherches Cliniques de Montréal (S.V.-K., A.-M.P., J.D.), Montréal, Canada H2W 1R7; Laboratoire ICNE, Institut Jean Roche (T.B., M.G., A.B., A.E.), 13916 Marseille, France; Centre Hospitalier Lyon-Sud (M.D., M.N.), 69495 Lyon, France; Hôtel-Dieu (G.M., P.D.), 63058 Clermont-Ferrand, France; Hôpital St. Justine (C.D., G.V.V.), Montréal, Canada H3T 1C5; University Medical Center (M.D.V.), 3508 AB Utrecht, The Netherlands; Department of Pediatric Endocrinology, University Children’s Hospital, Klinikum der Christian Albrechts, University of Kiel (F.G.R., C.-J.P., W.G.S.), D-24105 Kiel, Germany; Departments of Pediatric Endocrinology and Neonatology, Faculty of Medicine, Ankara University (M.B., B.At.), 06100 Ankara, Turkey; University of Leuven (F.d.Z., D.B.), Leuven, B-3000 Belgium; Children’s Hospitals and Clinics (J.K.), St. Paul, Minnesota 55455; University of Iowa Hospitals and Clinics (P.D.), Iowa City, Iowa 52242; University of Wurzburg (M.F., S.H., B.Al.), Wurzburg, 97070 Germany; Department of Metabolic and Endocrine Diseases, University Medical Center Nijmegen (C.N.), 6500 HB Nijmegen, The Netherlands; Department of Pediatrics, University of Kuopio (L.D.), FIN-70211 Kuopio, Finland; University of Helsinki (M.H.), Helsinki, FIN-00014 Finland; Centre Hospitalier (B.P.), 59241 Armentières, France; Hôpital Jeanne de Flandre (J.W.), 59037 Lille, France; Connecticut Children’s Medical Center (S.Y.), Hartford, Connecticut 06106-1914; Hôpital Bicêtre (R.B.), 94270 Paris, France; Hospital de Ninos Dr. Ricardo Gutiérrez (J.J.H.), Buenos Aires, Argentina; and Dalhousie University/IWK Health Center (E.C., C.R.), Halifax, Canada B3H 4J1

Address all correspondence and requests for reprints to: Dr. Jacques Drouin, Laboratoire de Génétique Moléculaire, Institut de Recherches Cliniques de Montréal, 110 avenue des Pins Ouest, Montréal, Québec, Canada H2W 1R7. E-mail: jacques.drouin{at}ircm.qc.ca.

	Abstract

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Tpit is a T box transcription factor important for terminal differentiation of pituitary proopiomelanocortin-expressing cells. We demonstrated that human and mouse mutations of the TPIT gene cause a neonatal-onset form of congenital isolated ACTH deficiency (IAD). In the absence of glucocorticoid replacement, IAD can lead to neonatal death by acute adrenal insufficiency. This clinical entity was not previously well characterized because of the small number of published cases. Since identification of the first TPIT mutations, we have enlarged our series of neonatal IAD patients to 27 patients from 21 unrelated families. We found TPIT mutations in 17 of 27 patients. We identified 10 different TPIT mutations, with one mutation found in five unrelated families. All patients appeared to be homozygous or compound heterozygous for TPIT mutations, and their unaffected parents are heterozygous carriers, confirming a recessive mode of transmission. We compared the clinical and biological phenotype of the 17 IAD patients carrying a TPIT mutation with the 10 IAD patients with normal TPIT-coding sequences. This series of neonatal IAD patients revealed a highly homogeneous clinical presentation, suggesting that this disease may be an underestimated cause of neonatal death. Identification of TPIT gene mutations as the principal molecular cause of neonatal IAD permits prenatal diagnosis for families at risk for the purpose of early glucocorticoid replacement therapy.

	Introduction

Top Abstract Introduction Subjects and Methods Results Discussion References

 
OVER THE PAST decades, congenital pituitary hormone deficiencies have been described in humans and animals (1). These deficiencies have been associated with mutations in the genes coding for the pituitary hormones, the receptors of hypothalamic hypophysiotropic hormones, or the hypothalamic hormones themselves. In addition, transcription factors controlling early events of pituitary organogenesis have been implicated in combined pituitary hormone deficiencies (1). Other transcription factors, such as Pit-1, steroidogenic factor-1, Dax-1, and Tpit, associated with terminal differentiation of particular lineages (2), have been implicated in partial or isolated pituitary hormone deficiencies. Of these, Tpit is the most cell-restricted transcription factor, and mutations of the human TPIT gene were found in rare cases of pituitary ACTH deficiency (3, 4).

During mouse pituitary development, the T box transcription factor Tpit appears 6–12 h before proopiomelanocortin (POMC) in corticotroph [around d 12.5 of embryonic development (e12.5)] and melanotroph (e14.5) cells (3). Tpit is essential for cell-specific transcription of the POMC gene (3) and for terminal differentiation of mouse corticotrophs and melanotrophs (5). In humans, early pituitary development is similar to that in rodents, but the intermediate lobe disappears at the 16th wk of gestation. There are thus no melanotroph cells in the human adult pituitary. TPIT expression is normally restricted to human pituitary corticotroph cells, but we also demonstrated that TPIT is a specific marker of corticotroph adenomas (6).

In mice and humans, POMC is also expressed in nonpituitary tissues, and different biologically active peptides, such as ACTH in corticotrophs and MSH in melanotrophs, are produced by proteolytic processing of POMC in each expressing tissue (7). Accordingly, mutations in the POMC gene itself were linked to different phenotypes (8, 9), each being associated with a site of POMC expression. Indeed, a deficiency of pituitary POMC causes a complete deficiency of plasma ACTH, with resulting adrenal insufficiency and very low/undetectable plasma cortisol. The absence of hypothalamic POMC was associated with obesity as a result of the implication of the melanocortin system in mediation of the leptin pathway (10). Finally, children carrying POMC gene mutations are red-haired, lacking black pigment formation presumably as a result of the loss of skin POMC (8).

Concordant with the highly pituitary-specific expression of Tpit in POMC-expressing cells (3), we showed that Tpit-deficient mice are a very faithful model of isolated ACTH deficiency (IAD). Immunohistochemistry of mouse Tpit^–/– pituitaries showed an almost complete absence of POMC-expressing cells associated with a hypoplastic intermediate lobe (5). Tpit^–/– mice have very low plasma ACTH levels, undetectable plasma corticosterone levels, and hypoplastic adrenal glands (4). Consistent with the absence of Tpit in hypothalamic POMC neurons (3), these mice are not obese like the POMC^–/– mutant mice (9), but they are hypopigmented, because in rodents, pituitary POMC is important for control of pigmentation.

In confirmation of the specific role of Tpit in differentiation of the corticotroph lineage in humans, we identified TPIT gene mutations in children with IAD (3, 4). Neonatal IAD appeared to be an extremely rare condition, because only four case reports had been published in the clinical literature (11, 12, 13, 14, 15). We originally investigated a limited number of human IAD and only found TPIT gene mutations in early-onset (neonatal) IAD, but never in cases of juvenile onset (4). In the present study we investigated a large series of neonatal IAD patients to define this clinical entity. We identified TPIT gene mutations as the principal molecular cause of neonatal IAD and demonstrated a highly homogeneous clinical presentation that may be responsible for neonatal deaths.

	Subjects and Methods

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Patients

We screened 27 IAD patients for TPIT gene anomalies. Patients were included on the basis of neonatal-onset ACTH deficiency in the absence of other pituitary hormone deficiency and any identified cause of hypocortisolism. Procedures involving patients and/or patient samples were reviewed and approved by the IRCM human ethics review committee, and accordingly, informed consent was obtained from patients.

Hormonal studies

Hormone assays were performed using several commercial RIA kits, and normal values for each center were taken into account. Plasma ACTH and cortisol concentrations were measured at 0800 h using different RIA kits. Plasma ACTH and cortisol responses were studied after iv CRH injection test (50 µg) in a subset of patients (n = 13), with ACTH and cortisol measurements 15, 30, 45, 60, 90, and 120 min after injection. The cortisol response to an iv ACTH bolus (250 µg) was assessed with plasma cortisol measurements after 30 and 60 min in a subset of 10 patients. To better evaluate adrenal function in a subset of patients (n = 4), the cortisol response was also assessed after repetitive im injections of exogenous ACTH (0.5 mg/m² every 12 h over 3 d). Other anterior pituitary hormone plasma concentrations were measured at baseline and after routine stimulation tests.

Genomic analysis of the TPIT gene

DNA was extracted from peripheral lymphocytes and PCR-amplified using eight sets of flanking intronic primers for direct sequencing of exons. Primer sequences were described by Pulichino et al. (4). Amplification was carried out in a 50-µl reaction, using 200 ng genomic DNA, 250 ng of each primer, and the Vent polymerase (New England Biolabs, Beverley, MA), as previously described (4). PCR products were purified on agarose gel using the Qiagen gel extraction kit (Chatsworth, CA). Internal primers were used for sequencing using a CEQ 2000 sequencer from Beckman Coulter (Fullerton, CA). Mutations were confirmed by repeat PCR and subsequent sequencing of PCR products.

Cell culture, transfection, and plasmids

GH₃ cells were cultured in DMEM supplemented with 10% fetal calf serum and antibiotics. Cells (n = 250,000) were transfected in 12-well dishes with Lipofectamine (Invitrogen Life Technologies, Inc., Carlsbad, CA) using 500 ng reporter plasmid and 0–100 ng expression plasmid up to a total of 750 ng/assay. Cells were harvested 48 h later. The Tpit reporter and expression plasmids have been described previously (3). The Tpit mutants were generated using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA).

Gel retardation assays and Western blotting

Gel shift assays were performed as previously described (3) using 5 µl in vitro translated protein lysates (wheat germ extract, Promega Corp., Madison, WI). The probe used was a palindromic T box-binding consensus site (GATCCAATTTCACACCTAGGTGTGAAATT). Western blots were performed as previously described (16) with rabbit anti-Tpit (1:1000) (3).

	Results

Top Abstract Introduction Subjects and Methods Results Discussion References

 
TPIT gene mutations in early-onset isolated ACTH deficiency

To obtain an assessment of the prevalence of TPIT gene mutations and to define clinically early-onset IAD with/without TPIT gene mutations, we collected DNA from a series of 27 patients belonging to 21 unrelated families who were all diagnosed with early-onset IAD. These families are of diverse ethnic origin from around the world. Using PCR amplification of the eight exons of the TPIT gene and direct DNA sequencing, we identified TPIT gene mutations in 17 patients (Fig. 1 and Table 1). All of these mutations affected coding sequences. The remaining 10 IAD patients had no TPIT gene anomalies in the coding sequences (Table 2). These 10 patients were from eight different families, and three of these families were either consanguineous or had evidence of hereditary transmitted IAD (families XIV, XV, and XVI). Nonexonic and flanking sequences were not determined; it is therefore possible that mutations affecting TPIT expression are present in these regions of the gene. Alternatively, other gene mutations may account for IAD in these patients. To compare the two groups of neonatal IAD patients (with and without TPIT mutations), we gathered available clinical data for all patients.

View larger version (45K): [in this window] [in a new window]   FIG. 1. DNA sequence and pedigree of new patients with TPIT mutations. For each family, the black symbol represents the mutant allele revealed by DNA sequencing below.

The patients carrying a TPIT gene mutation were born to apparently healthy parents, consanguineous in five of 13 families (Table 1). In three of 13 families, a sudden neonatal death had occurred in another sibling. The autopsy performed in one case (brother of patient 8) revealed very small adrenals and normal pituitary morphology without ACTH immunoreactivity (11, 12). The diagnosis of corticotroph deficiency was made between birth and 2 yr of age, but the first symptoms appeared in the neonatal period in all cases. Severe hypoglycemia, often associated with seizures and failure to thrive, was the major factor leading to the diagnosis of IAD. Glycemia at diagnosis ranged from 0.4–2.2 mmol/liter. Eleven of 17 neonates suffered from prolonged cholestatic jaundice, associated with hepatomegaly in four cases. Hepatic needle biopsy performed in five cases revealed cholestatic hepatitis. Symptoms of adrenal insufficiency as well as cholestatic jaundice disappeared after cortisol replacement therapy in all cases. Growth was normal during cortisol treatment in all cases, but one patient apparently had transitory GH deficiency that may have been responsible for persistent hypoglycemia after glucocorticoid replacement (patient 3). Skin pigmentation and food intake were normal in all cases. The eight oldest patients entered puberty spontaneously between 10 and 13 yr of age (patients 2, 8, 11, and 13–17). Except for corticotropic activity, all other pituitary functions were normal at baseline and after stimulation tests (data not shown). Pituitary morphology was normal at magnetic resonance imaging in seven patients, but patient 16 appeared to have a hypoplastic pituitary. In addition, the pituitary stalk was normal, and no patient had posterior pituitary ectopia (data not shown).

Plasma ACTH levels at diagnosis were below the normal range and in most cases did not respond significantly to an iv CRH challenge (Fig. 2A). Plasma cortisol levels were also below normal values and did not respond significantly to acute CRH or ACTH challenge (Fig. 3A). In two patients, repeated im ACTH injection over 3 d resulted in significant plasma cortisol responses (Fig. 3A, patients 4 and 11), suggesting that adrenal function could be recovered. 17-Hydroxyprogesterone and aldosterone measurements showed normal levels in three of three and four of four tested cases, respectively (data not shown). Adrenarche did not take place in three patients (3, 15, 17) in whom plasma dehydroepiandrosterone sulfate levels were measured. Collectively, these data support a diagnosis of IAD associated with hypoplastic adrenals, which is very similar to the phenotype of Tpit^–/– mutant mice (5).

View larger version (29K): [in this window] [in a new window]   FIG. 2. Basal and CRH-induced plasma ACTH levels of neonatal IAD patients. Plasma ACTH levels before () and after (overlapping ) CRH injection. The normal range (20–60 pg/ml) of resting plasma ACTH is shown by the gray zone. Available data are shown for IAD patients with (A) and without (B) TPIT mutations.

View larger version (47K): [in this window] [in a new window]   FIG. 3. Basal, CRH-induced, and ACTH-induced plasma cortisol levels of neonatal IAD patients. Plasma cortisol levels were measured in basal conditions at 0800 h after an iv CRH injection or an iv ACTH injection and in some cases after repeated im ACTH injections. The normal range of basal cortisol (250–600 nmol/liter) is shown by the gray zone. Available data are shown for IAD patients with (A) and without (B) TPIT mutations.

The IAD patients without TPIT gene anomalies in the coding sequence had a clinical phenotype (Table 2) very similar to that of TPIT mutant patients. Glycemia at diagnosis ranged from 0.4–2.5 mmol/liter. All patients had normal food intake and pigmentation. In two of the eight families, a neonatal death had occurred in a sibling. The same pathologist (P.D.) who performed autopsy on the brother of patient 8 (12) also performed this for patient 25. Similar anomalies were observed in both cases: very small adrenals and normal pituitary morphology without ACTH immunoreactivity.

These patients also had low baseline plasma ACTH levels and very little response to acute CRH (Fig. 2B). Basal plasma cortisol was very low for all of these patients (Fig. 3B). Patients 23 and 27 were different in that they had ACTH levels in the normal range despite very low cortisol levels; taken together, these values can be considered inappropriate. This patient group appeared more heterogeneous. Indeed, one patient had a cortisol response to CRH (patient 27); another (patient 24) had a significant cortisol response to acute ACTH, but little response to CRH; finally, two patients (no. 18 and 22) displayed normal cortisol responses to chronic ACTH treatment. In summary, although patients 18, 19, 20, 25, and 26 appeared quite similar to the first group of IAD patients, patients 21, 22, 23, 24, and 27 differed in at least one biological parameter. Additional investigation will be required to understand those differences.

TPIT gene mutations cause loss of function and recessive transmission of IAD

Ten different mutations were identified within the coding exons of the TPIT gene (Table 1). We reported some of these mutations previously (3, 4), and in the present report we identified three new TPIT mutations (Fig. 1), a 37-bp deletion in exon 2 (family XIII), a nonsense mutation (Q28X) resulting in a stop codon (family I), and a missense T195A mutation (family VIII). An 11th TPIT mutation was identified by Metherell et al. (17) in a compound heterozygote patient carrying the delA allele together with an M86R missense mutation. This patient series reveals a high prevalence mutation in exon 6: a 1-bp (A) deletion at nucleotide position 782 (delA), found in six unrelated families (families VIII–XII and a patient of Metherell et al.). This deletion could have arisen independently in different families; however, we are led to believe otherwise because all carriers of the nt742delA mutation also have a polymorphism of the third before last nucleotide of intron A. This polymorphism (TC) was only observed in these samples and in none of about 50 other DNA samples analyzed. This is highly suggestive of a founder effect. All six families carrying the nt742delA mutation are of European descent, but are currently living in France, Holland, the U.S., Canada, Germany, and Wales. The ancestral allele would thus go back at least a few centuries if indeed a common founder existed.

Twelve patients were homozygous for a TPIT mutation (Table 1), and five patients were found or suspected to be compound heterozygotes (patients 8, 10, and 15–17). Analysis of the parent’s DNA indicated that they were all heterozygous carriers of TPIT gene mutations, and all were unaffected (Fig. 1). Similarly, unaffected siblings of IAD patients were either heterozygous for TPIT mutations or homozygous for the normal sequence. This distribution indicates a recessive mode of transmission. It is noteworthy that patients 15 and 16 are heterozygous for the delA allele and that patient 17 is heterozygous for a 37-bp deletion in exon 2 inherited from his mother (Fig. 1). The remaining TPIT coding sequences were normal in these three cases, as was the other allele. We suspect that these patients are compound heterozygotes carrying another TPIT mutation that is presumably outside the coding sequences. Sufficient genomic DNA was not available for these patients to perform a full-scale genomic analysis of the TPIT locus. The five cases of proven or suspected compound heterozygosity reported here (Table 1) taken together with the patient of Metherell et al. (17) represent a high prevalence that is probably indicative of a greater than expected frequency of TPIT mutant alleles in the human population.

To determine the mechanism of deficiency produced by the T195A missense mutation, this mutation was inserted in plasmid expression vectors and tested by transfection for transcriptional activity and DNA-binding ability. The T195A mutant protein was found to be completely devoid of activity in transfected cells (Fig. 4A) and to have no in vitro DNA-binding activity (Fig. 4B). These findings are consistent with residue 195 facing DNA in the Brachyury crystal structure (4, 18). Interestingly, Thr¹⁹⁵ is conserved in T boxes from mammals to Drosophila, sea urchin, Caenorhabditis elegans, and Xenopus.

View larger version (41K): [in this window] [in a new window]   FIG. 4. TPIT missense T195A mutation causes loss of function. A, The T195A mutant protein is devoid of transcriptional activity when assayed by transient transfection into GH3 cells using a Tpit/Pitx (pituitary homeobox transcription factor)-dependent reporter plasmid. Data are presented as the mean ± SEM of five experiments, each performed in duplicate. B, DNA-binding ability of T195A mutant protein was assessed by gel retardation using in vitro translated proteins and a palindromic consensus binding site for T box proteins as probe. Synthesis of equivalent amounts of mutant and wild-type proteins was assessed by Western blot (top of each panel). No binding was observed for this mutant. C, Summary of different TPIT mutations found in cases of early-onset IAD.

	Discussion

Top Abstract Introduction Subjects and Methods Results Discussion References

Congenital IAD patients with TPIT gene anomalies presented with a homogeneous clinical phenotype (Table 3). Severe hypoglycemia was found at diagnosis in all cases, and this was associated with seizures in about half the patients. Prolonged cholestatic jaundice was observed in more than half the cases (11 of 17). Cholestatic jaundice and hypoglycemia have been associated with many pituitary hormone deficiencies, particularly isolated or combined GH deficiencies (19, 20, 21). The endocrine profile of TPIT IAD patients is characterized by very low plasma ACTH levels and no significant response to CRH. Similarly, plasma cortisol levels are extremely low and do not respond to either acute CRH or ACTH, but may respond to a repeated 3-d im ACTH challenge. All other pituitary functions are normal, as is the morphology of the pituitary gland assessed by either magnetic resonance imaging or pathological examination, the latter only showing an absence of ACTH immunostaining. This inherited condition is often associated with consanguinity in the family (five of 13 families), but this study also revealed a relatively high frequency of compound heterozygotes carrying different TPIT gene mutations. This is suggestive of a greater than expected frequency of TPIT mutant alleles in the human population. Because heterozygous carriers of these mutations are unaffected, there is no selection against carriers.

We have not identified a single parameter that may serve to distinguish neonatal IADs that are associated with TPIT mutations from those that are not. Indeed, the neonatal IAD patients without TPIT mutations are in general very similar to those with TPIT mutations, with few exceptions. One clinical parameter may differ in the two groups, although the small number of informative patients warrants caution; cholestatic jaundice was observed in 11 of 11 of informative TPIT mutant patients, whereas it was present in only one of five informative non-TPIT patients. This observation is intriguing because it does not correlate with hypoglycemia or another parameter. Additional investigation would be required to determine the significance of this observation. A subset of Table 2 patients may indeed have impaired TPIT expression that was not revealed through analysis of TPIT-coding sequences. Mutations outside of coding sequences (for example, within promoter or enhancer regulatory regions) may cause significant loss of expression, resulting in similar clinical presentation as in patients with the coding sequence mutations. A subgroup of IAD patients without TPIT mutations clearly demarcated themselves upon clinical investigation, with some showing responsiveness to acute CRH or ACTH stimulation. Clearly, these patients should be investigated for loss of function in other genes.

TPIT gene mutations cause loss of function and recessive transmission of IAD

TPIT mutations that result in insertion of stop codons (Q28X, R179X, and R286X) or to frameshift and premature stop codon (nt782delA and nt247del37bp) are thought to lead to loss of function because of nonsense mRNA decay caused by the presence of a stop codon in the penultimate or an earlier exon of the gene (22, 23). Functional studies of the four missense mutations revealed a defect in transcriptional ability because of the loss of DNA binding (5). Thus, the molecular mechanism of TPIT mutations is loss of function.

It is noteworthy that two compound heterozygotes involving different mutations were identified (patients 8 and 10), and three others (patients 15–17) are suspected to be heterozygous. In these three patients, we found only one mutant TPIT allele, and the other allele appeared normal. In each case, the family history is consistent with the proband being compound heterozygous, because parents or siblings carrying the mutant TPIT allele are unaffected. Another mutation could be in the promoter region or the regulatory sequences, but we have yet to identify such a mutation. Additional investigation of TPIT regulatory sequences is required before we can meaningfully address this question.

Neonatal corticotroph deficiency, an underestimated cause of neonatal death?

Neonatal IAD may be underestimated as a cause of neonatal death. In our series, about 25% of the investigated families (five of 21) suffered a neonatal death independently of whether they carried TPIT mutations. Corticotroph deficiency is most often acquired, secondary to corticosteroid treatment, pituitary tumors, or apoplexy. Congenital isolated ACTH deficiency was thought to be very rare in humans. A few cases had been described with onsets from the perinatal period to the early teen years (11, 13, 14, 15). We investigated the TPIT gene sequence in three of these cases and found a TPIT gene mutation in two of three families (patients 8, 13, and 14). We investigated TPIT-coding sequences in the daughter (patient 21) of the third reported case (14), and we did not find any mutation. However, in this family (XVI), the father and daughter had IAD, suggesting an autosomal dominant mode of transmission. To date, all TPIT gene mutations that caused IAD had a neonatal onset and an autosomal recessive mode of transmission.

We have reported the largest series of congenital IAD and demonstrated that the molecular mechanism involved TPIT in the majority of the cases. This disease appeared to be underestimated as a cause of neonatal death. Five families in our series suffered a neonatal death in the absence of accurate diagnosis. Because glucocorticoid replacement therapy could have prevented these deaths, it is clear that knowledge provided by the molecular mechanism of this homogeneous clinical entity can provide prenatal or early neonatal diagnosis for families at risk and lead to significant prevention of lethality. This diagnosis could be achieved through measurement of maternal plasma estriol levels during pregnancy or by molecular investigation after birth. Indeed, noninvasive prenatal diagnosis could be achieved through measurement of estriol levels in the plasma or urine of pregnant woman, because decreased maternal estriol indicates fetal adrenal insufficiency whether its origin is central or adrenal (11, 24).

	Acknowledgments

 
Some samples were collected in France via the GENHYPOPIT network, Programme Hospitalier de Recherches Cliniques 2003, GIF-Maladies Rares (Institut National de la Santé et de la Recherche Médicale-GISMR0201) coordinated by Thierry Brue. J.K. and P.D. are grateful to DNA Core at University at Iowa for preparation of DNA samples. The expert assistance of Jacques Lavigne at the Institut de Recherches Cliniques de Montréal (IRCM) Molecular Biology Core service for DNA sequencing was greatly appreciated. Lise Laroche provided expert secretarial assistance, as always.

	Footnotes

 
This work was supported by the Canadian Institutes of Health Research (to S.V.-K. and A.-M.P.). Work in the Laboratory of Molecular Genetics of IRCM was funded by a grant from the National Cancer Institute of Canada with funds provided by the Canadian Cancer Society.

First Published Online December 21, 2004

Abbreviations: e12.5, Embryonic d 12.5; IAD, isolated ACTH deficiency; POMC, proopiomelanocortin.

Received July 5, 2004.

Accepted November 23, 2004.

	References

Top Abstract Introduction Subjects and Methods Results Discussion References

 

1. Cohen LE, Radovick S 2002 Molecular basis of combined pituitary hormone deficiencies. Endocr Rev 23:431–442[Abstract/Free Full Text]
2. Pulichino AM, Vallette-Kasic S, Drouin J 2004 Transcriptional regulation of pituitary gland development: binary choices for cell differentiation. Curr Opin Endocrinol Diabetes 11:13–17
3. Lamolet B, Pulichino AM, Lamonerie T, Gauthier Y, Brue T, Enjalbert A, Drouin J 2001 A pituitary cell-restricted T-box factor, Tpit, activates POMC transcription in cooperation with Pitx homeoproteins. Cell 104:849–859[CrossRef][Medline]
4. Pulichino AM, Vallette-Kasic S, Couture C, Gauthier Y, Brue T, David M, Malpuech G, Deal C, Van Vliet G, De Vroede M, Riepe FG, Partsch CJ, Sippell WG, Berberoglu M, Atasay B, Drouin J 2003 Human and mouse Tpit gene mutations cause early onset pituitary ACTH deficiency. Genes Dev 17:711–716[Abstract/Free Full Text]
5. Pulichino AM, Vallette-Kasic S, Tsai JPY, Couture C, Gauthier Y, Drouin J 2003 Tpit determines alternate fates during pituitary cell differentiation. Genes Dev 17:738–747[Abstract/Free Full Text]
6. Vallette-Kasic S, Figarella-Branger D, Grino M, Pulichino AM, Dufour H, Grisoli F, Enjalbert A, Drouin J, Brue T 2003 Differential regulation of proopiomelanocortin and pituitary-restricted transcription factor (TPIT), a new marker of normal and adenomatous human corticotrophs. J Clin Endocrinol Metab 88:3050–3056[Abstract/Free Full Text]
7. Solomon S 1999 POMC-derived peptides and their biological action. Ann NY Acad Sci 885:22–40[Abstract/Free Full Text]
8. Krude H, Biebermann H, Luck W, Horn R, Brabant G, Gruters A 1998 Severe early-onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans. Nat Genet 19:155–157[CrossRef][Medline]
9. Yaswen L, Diehl N, Brennan MB, Hochgeschwender U 1999 Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin. Nat Med 5:1066–1070[CrossRef][Medline]
10. Flier JS 2004 Obesity wars: molecular progress confronts an expanding epidemic. Cell 116:337–350[CrossRef][Medline]
11. Malpuech G, Vanlieferinghen P, Dechelotte P, Gaulme J, Labbe A, Guiot F 1988 Isolated familial adrenocorticotropin deficiency: prenatal diagnosis by maternal plasma estriol assay. Am J Med Genet 29:125–130[CrossRef][Medline]
12. Dechelotte P, Darcha C, Labbe A, Vanlieferinghen P, Beaufrere AM, Malpuech G 1994 Congenital adrenal hypoplasia due to isolated familial ACTH deficiency. Pediatr Pathol 14:377–380[Medline]
13. Kyllo JH, Collins MM, Vetter KL, Cuttler L, Rosenfield RL, Donohoue PA 1996 Linkage of congenital isolated adrenocorticotropic hormone deficiency to the corticotropin releasing hormone locus using simple sequence repeat polymorphisms. Am J Med Genet 62:262–267[CrossRef][Medline]
14. Carey DE 1985 Isolated ACTH deficiency in childhood: lack of response to corticotropin-releasing hormone alone and in combination with arginine vasopressin. J Pediatr 107:925–928[CrossRef][Medline]
15. Soo SC, Bain M, Gibson S, White A, Johnstone AP, Nussey S 1994 Isolated congenital ACTH deficiency: a cleavage enzyme defect? Clin Endocrinol (Oxf) 40:555–556[Medline]
16. Tremblay JJ, Lanctôt C, Drouin J 1998 The pan-pituitary activator of transcription, Ptx-1 (pituitary homeobox1), acts in synergy with SF-1 and Pit1 and is an upstream regulator of the Lim-homeodomain gene Lim3/Lhx3. Mol Endocrinol 12:428–441[Abstract/Free Full Text]
17. Metherell LA, Savage MO, Dattani M, Walker J, Clayton PE, Clark AJL 2003 Absence of TPIT (Tbx19) gene mutations in most patients with isolated ACTH deficiency. Horm Res 60 (Suppl 2):152–153
18. Muller CW, Herrmann BG 1997 Crystallographic structure of the T domain-DNA complex of the Brachyury transcription factor. Nature 389:884–888[CrossRef][Medline]
19. Pena-Almazan S, Buchlis J, Miller S, Shine B, MacGillivray M 2001 Linear growth characteristics of congenitally GH-deficient infants from birth to one year of age. J Clin Endocrinol Metab 86:5691–5694[Abstract/Free Full Text]
20. Huet F, Carel JC, Nivelon JL, Chaussain JL 1999 Long-term results of GH therapy in GH-deficient children treated before 1 year of age. Eur J Endocrinol 140:29–34[Abstract]
21. Scommegna S, Galeazzi D, Picone S, Farinelli E, Agostino R, Bozzao A, Boscherini B, Cianfarani S 2004 Neonatal identification of pituitary aplasia: a life-saving diagnosis. Review of five cases. Horm Res 62:10–16[CrossRef][Medline]
22. Hentze MW, Kulozik AE 1999 A perfect message: RNA surveillance and nonsense-mediated decay. Cell 96:307–310[CrossRef][Medline]
23. Frischmeyer PA, Dietz HC 1999 Nonsense-mediated mRNA decay in health and disease. Hum Mol Genet 8:1893–1900[Abstract/Free Full Text]
24. Hensleigh PA, Moore WV, Wilson K, Tulchinsky D 1978 Congenital X-linked adrenal hypoplasia. Obstet Gynecol 52:228–232[Abstract/Free Full Text]

This article has been cited by other articles:

				P.-L. Lavoie, L. Budry, A. Balsalobre, and J. Drouin Developmental Dependence on NurRE and EboxNeuro for Expression of Pituitary Proopiomelanocortin Mol. Endocrinol., July 1, 2008; 22(7): 1647 - 1657. [Abstract] [Full Text] [PDF]

				S. Vallette-Kasic, C. Couture, A. Balsalobre, Y. Gauthier, L. Metherell, M. Dattani, and J. Drouin The TPIT Gene Mutation M86R Associated with Isolated Adrenocorticotropin Deficiency Interferes with Protein: Protein Interactions J. Clin. Endocrinol. Metab., October 1, 2007; 92(10): 3991 - 3999. [Abstract] [Full Text] [PDF]

				D. Kelberman and M. T. Dattani Hypothalamic and pituitary development: novel insights into the aetiology Eur. J. Endocrinol., August 1, 2007; 157(suppl_1): S3 - S14. [Abstract] [Full Text] [PDF]

				X. Zhu, A. S. Gleiberman, and M. G. Rosenfeld Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks Physiol Rev, July 1, 2007; 87(3): 933 - 963. [Abstract] [Full Text] [PDF]

				R. J. Weil, A. O. Vortmeyer, L. K. Nieman, H. L. DeVroom, J. Wanebo, and E. H. Oldfield Surgical Remission of Pituitary Adenomas Confined to the Neurohypophysis in Cushing's Disease J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2656 - 2664. [Abstract] [Full Text] [PDF]

				N. Weintrob, J. Drouin, S. Vallette-Kasic, E. Taub, D. Marom, Y. Lebenthal, G. Klinger, E. Bron-Harlev, and M. Shohat Low Estriol Levels in the Maternal Triple-Marker Screen as a Predictor of Isolated Adrenocorticotropic Hormone Deficiency Caused by a New Mutation in the TPIT Gene Pediatrics, February 1, 2006; 117(2): e322 - e327. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 90/3/1323    most recent Author Manuscript (PDF) Submit a related Letter to the Editor Purchase Article View Shopping Cart Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Vallette-Kasic, S. Articles by Drouin, J. Search for Related Content PubMed PubMed Citation Articles by Vallette-Kasic, S. Articles by Drouin, J. Related Collections Adrenal and Hypertension Pediatric Endocrinology