help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2005-0915
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hammer, F.
Right arrow Articles by Arlt, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hammer, F.
Right arrow Articles by Arlt, W.
Related Collections
Right arrow Male Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 11 6283-6289
Copyright © 2005 by The Endocrine Society

Sex Steroid Metabolism in Human Peripheral Blood Mononuclear Cells Changes with Aging

Fabian Hammer1, Daniel G. Drescher1, Susanne B. Schneider, Marcus Quinkler, Paul M. Stewart, Bruno Allolio and Wiebke Arlt

Department of Medicine, Endocrine and Diabetes Unit (F.H., D.G.D., B.A.), University of Würzburg, 97080 Würzburg, Germany; and Division of Medical Sciences (F.H., S.B.S., M.Q., P.M.S., W.A.), Institute of Biomedical Research, University of Birmingham, Edgbaston, Birmingham B15 2TT, United Kingdom

Address all correspondence and requests for reprints to: Dr. Wiebke Arlt, M.D., Division of Medical Sciences, Institute of Biomedical Research, The Medical School, University of Birmingham, Birmingham B15 2TT, United Kingdom. E-mail: w.arlt{at}bham.ac.uk.


   Abstract
Top
 Abstract
Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: Dehydroepiandrosterone (DHEA) mainly exerts indirect action via downstream conversion toward sex steroids within peripheral target cells including immune cells. In vitro DHEA has been shown to enhance IL-2 release from T lymphocytes, whereas it inhibits IL-6 secretion. Conversely, aging is associated with a decline in both DHEA and IL-2, whereas IL-6 increases.

Objective: The objective of the study was to investigate age-related differences in expression and functional activity of steroidogenic enzymes involved in downstream conversion of DHEA in peripheral blood mononuclear cells (PBMCs).

Design: This study was cross-sectional.

Participants/Setting: Healthy young men (n = 8; age range, 23–29 yr) and healthy middle-aged men (n = 8; age range, 52–66 yr) were studied in an academic setting.

Measures: mRNA expression of steroidogenic enzymes in PBMCs was measured by qualitative and quantitative RT-PCR analysis and enzyme activity assays after incubation of PBMCs with radiolabeled DHEA, 4-androstene-3,17-dione (androstenedione), and testosterone.

Results: RT-PCR analysis showed expression of all enzymes required for DHEA conversion toward active androgens and to the immune-stimulatory metabolite androstenediol. Steroid conversion patterns indicated a particularly increased activity of 17ß-hydroxysteroid dehydrogenase type 5 (17ß-HSD5) in the older men, demonstrated by significantly higher conversion rates of DHEA to androstenediol and of androstenedione to testosterone (all P < 0.05). By contrast, conversion of DHEA to androstenedione via 3ß-HSD occurred at a similar rate. Quantitative RT-PCR analysis revealed increased expression of 17ß-HSD 5 mRNA in PBMCs from the older men.

Conclusions: Our results provide evidence for significant changes in sex steroid metabolism by human PBMCs with aging, which may represent an endocrine link to immune senescence.


   Introduction
Top
 Abstract
 Introduction
Subjects and Methods
 Results
 Discussion
 References
 
DEHYDROEPIANDROSTERONE (DHEA) IS synthesized and secreted by the zona reticularis of the human adrenal gland and mainly exerts its action indirectly via downstream conversion toward sex steroids and intermediate steroids within peripheral target cells (1) (Fig. 1Go). DHEA secretion in humans exhibits a continuous decline with age (2, 3) as does the IL-2 response to antigen presentation (4). Conversely, circulating levels of the pro-inflammatory cytokine IL-6 increase with age (5, 6), and it has been suggested that age-associated changes in cytokine secretion pattern may play a role in the pathogenesis of disorders such as rheumatoid arthritis (7, 8), osteoporosis (9), atherosclerosis (10), and Alzheimer’s disease (11).



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 1. Schematic overview of DHEA metabolism to downstream steroids including androgens and androstenediol by steroidogenic enzymes. {Delta}5diol, Androstenediol; {Delta}4dione, androstenedione; DHT, 5{alpha}-dihydrotestosterone; Anedione, 5{alpha}-androstane-3,17-dione; AT, androsterone, 5{alpha}-androstane-3{alpha}-ol,17-one; AD, 5{alpha}-androstane-3{alpha},17ß-diol; ADG, 5{alpha}-androstane-3{alpha},17ß-diol glucuronide; 5{alpha}-Red, 5{alpha}-reductases.

 
Circulating DHEA sulfate (DHEAS) levels have been shown to be negatively correlated with serum IL-6 (12). DHEA administration to rodents increases IL-2 secretion (13) and natural killer (NK) cell cytotoxicity (14, 15, 16) and decreases circulating IL-6 (17). Similarly, in vitro studies employing human immune cells show a DHEA-induced increase in IL-2 secretion (18) and NK cell cytotoxicity (19) and conversely an inhibition of IL-6 release (20). It is unclear to what extent these immune effects are due to direct effects of DHEA or mediated via downstream conversion to other steroids including the DHEA metabolites androstenediol and androstenetriol (Fig. 1Go), which also have been shown to exhibit immune-modulating functions (21, 22, 23).

This suggests that downstream conversion of DHEA within the peripheral immune cell itself may mediate the immune-modulating properties of DHEA. Previous studies have shown that a number of steroidogenic enzymes involved in the downstream conversion of DHEA are expressed and functionally active in human lymphoblastoid cells, lymphocytes, and macrophages (24, 25, 26). Here, we sought to analyze whether expression and functional activity of steroidogenic enzymes involved in downstream conversion of DHEA within human peripheral blood mononuclear cells (PBMCs) differs as a function of age. Therefore we studied human PBMCs isolated from two groups of healthy volunteers, young men (18–30 yr) and older men (50–70 yr).


   Subjects and Methods
Top
 Abstract
 Introduction
 Subjects and Methods
Results
 Discussion
 References
 
Subjects

Sixteen healthy men (age range, 23–29 yr, n = 8; body mass index, 21.6–24.4 kg/m2; and age range, 52–66 yr, n = 8, body mass index, 21.9–27.1 kg/m2) were recruited via local advertising. Circulating levels of DHEAS, 4-androstene-3,17-dione (androstenedione), and testosterone (T) in all subjects were within the age-adjusted normal reference range. Further inclusion criteria for both groups were normal blood cell counts and normal hepatic and renal function parameters. Exclusion criteria were acute infections, chronic inflammatory conditions, current or previous long-term glucocorticoid or sex steroid treatment, thyroid dysfunction, diabetes mellitus, and current intake of drugs known to induce hepatic P450 enzymes. Before the initiation of the study, the protocol had been approved by the Ethics Committee of the University of Würzburg (Würzburg, Germany), and written informed consent was obtained from all study participants before inclusion.

Serum steroid measurements

Serum concentrations of androgen precursors, active androgens, and androgen metabolites were determined by established specific RIAs. The RIAs for DHEA and 5{alpha}-androstane-3{alpha},17ß-diol-17-glucuronide were purchased from Diagnostic Systems Laboratories (Sinsheim, Germany), and the RIAs for DHEAS, androstenedione, and T were purchased from DPC Biermann (Bad Nauheim, Germany). For all assays, the intra- and interassay coefficients of variation were less than 8 and less than 12%, respectively.

Cell isolation and preparation

Venous blood (60 ml) was drawn from healthy volunteers and collected in EDTA tubes between 0900 h and 1100 h. PBMCs were isolated by gradient centrifugation separation (Lymphoprep, Axis-Shield, Oslo, Norway) following the manufacturer’s guidelines. Cells were washed once in PBS and then resuspended in Ham’s F10 medium containing 1 mM glutamine (Sigma, Taufkirchen, Germany). Cell viability was checked by trypan blue staining with cell counting subsequently performed in a Neubauer hematocytometer.

Enzyme assays

For incubation with radiolabeled steroids, 3 x 106 PBMCs were incubated in a final volume of 500 µl Ham’s F10. Each reaction contained 20,000 cpm 4-14C-DHEA (specific activity, 47.8 mCi/mmol), 4-14C-androstenedione (53.6 mCi/mmol), or 4-14C-T (53.6 mCi/mmol) (NEN Life Science Products Life Sciences, Cologne, Germany). Cell-free incubations served as negative controls; all experiments were carried out in triplicate. After incubation for 6 h at 37 C with gentle rocking, steroids were extracted in 3 volumes of ethyl acetate/isooctane (1:1) and concentrated by evaporation under continuous nitrogen flow to prevent oxidation. Substrates and conversion products were separated by thin-layer chromatography (TLC) on silica gel-coated TLC plates (PE SIL G/UV plates, Whatman, Maidstone, UK), using dichloromethane/acetone (92.5:7.5) as the solvent system, and quantified employing phosphor imager analysis (Fuji Film FLA 3000 phosphor imager, Fuji Photo Europe, Düsseldorf, Germany). Conversion products were identified by assessing their comigration with unlabeleled reference steroids. In preceding experiments employing two-dimensional TLC runs [solvent system 1, methylacetate/ethylene dichloride (35:65); solvent system 2, hexanol/hexane (25:75)], it had been verified that none of the products overlapped with each other on the unidimensional TLC run (data not shown). Reference steroids were visualized after exposure of TLC plates to Lieberman-Burchard reagent (ethanol-acetic anhydride-sulfuric acid) and subsequent incubation at 115 C for 15 min (Fig. 2Go) as previously described (27). Enzyme activities were expressed as picomoles of product per 10 million cells per hour.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 2. Separation of nonlabeled DHEA and downstream steroids (10–2 M) by unidimensional TLC using dichloromethane/acetone (92.5:7.5) as the solvent system. Reference steroids were visualized after exposure of TLC plates to Lieberman-Burchard reagent (ethanol-acetic anhydride-sulfuric acid) and subsequent incubation at 115 C for 15 min as previously described (27 ). All substrates are clearly distinguishable from their products (DHEA to {Delta}4dione or {Delta}5diol; {Delta}4dione to T or AD or AT; T to DHT or {Delta}4dione). {Delta}5diol, Androstenediol; {Delta}4dione, androstenedione; DHT, 5{alpha}-dihydrotestosterone; Anedione, 5{alpha}-androstane-3,17-dione; AT, androsterone, 5{alpha}-androstane-3{alpha}-ol,17-one; AD, 5{alpha}-androstane-3{alpha},17ß-diol.

 
RNA extraction

Total RNA was extracted from aliquots of 5 x 106 PBMCs using a single-step extraction method (RNeasy Mini Kit, QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s protocol. RNA integrity was assessed by electrophoresis on 1% agarose gels. RNA concentrations were determined by spectrophotometry at A260, and purity was assessed by measuring the RNA to DNA ratio at A260/280.

Qualitative RT-PCR expression analysis

The oligonucleotide sequences used for amplification of steroidogenic enzymes are given in Table 1Go. Analysis of expression of steroidogenic enzymes was carried out using the OneStep RT-PCR kit (QIAGEN GmbH) according to the manufacturer’s protocol. Briefly, specific PCR(25 µl) contained 1x PCR buffer (QIAGEN GmbH), 200 µM of each dNTP, 0.6 µM of the respective forward and reverse primer, 1 µl enzyme mix [Omniscript/Sensiscript Reverse Transcriptase/HotStart Taq DNA Polymerase (1:1), QIAGEN GmbH], and 200 ng RNA. An initial activation step of the HotStart Taq polymerase for 15 min at 94 C was followed by 34 cycles of denaturation at 94 C for 30 sec, followed by annealing at 60 C for 40 sec, and extension at 72 C for 60 sec.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Primer pairs used for PCR amplification of steroidogenic enzymes

 
Semiquantiative RT-PCR analysis

For semiquantitative analysis, aliquots of 1.5 µg total RNA were reverse transcribed for 1 h at 44 C employing random hexamer primers using the RETROscript kit (Ambion, Austin, TX). The linear range of the amplified PCR product of AKR1C3 on agarose gel was determined by assessment of the intensity of PCR products in relation to the number of PCR cycles. For simultaneous amplification of target genes and 18S, 500 ng cDNA was amplified in a reaction volume of 50 µl containing 1x PCR buffer (QIAGEN GmbH), 200 µM of each dNTP, 0.6 µM forward and reverse primer, 100 nM of QuantumRNA 18S Internal Standards (Ambion) (optimized ratio, 18S primer/competimer = 1:9), and 2 U HotStart Taq polymerase (QIAGEN GmbH). PCRs were subjected to 28 cycles of denaturation at 94 C for 30 sec, annealing at 60 C for 30 sec, and extension at 72 C for 40 sec. PCR products were separated by gel electrophoresis, visualized under UV light (360 nm), and quantified by densitometry using ImageGauge version 3.4 (Fuji Medical Systems, Stamford, CT). Relative expression of AKR1C3 and SRD5A1, respectively, were normalized by referring to the density of the respective 18S band, and results are given as AKR1C3/18S ratios.

Quantitative PCR

AKR1C3 and SRD5A1 mRNA expression levels were analyzed using an ABI Prism 7700 sequence detection system (PerkinElmer Applied Biosystems, Warrington, UK) that employs TaqMan chemistry for highly accurate quantification of mRNA levels as previously described (28). Reactions were performed in 25-µl volumes on 96-well plates in buffer containing TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA) and 25 ng cDNA template. All reactions were multiplexed with the housekeeping gene 18S (PerkinElmer). Reactions were as follows: 50 C for 2 min, 95 C for 10 min, and then 44 cycles of 95 C for 15 sec and 60 C for 1 min. Oligonucleotide primers and a Taqman probe for 17ß-hydroxysteroid dehydrogenase (HSD; AKR1C3) were as follows: forward, GGGATCTCAACGAGACAAACG; reverse, AAAGGACTGGGTCCTCCAAGA; and probe, TGGACCCGAACTCCCCGGTG. Oligonucleotide primers and a Taqman probe for 5{alpha}-reductase 1 (SRD5A1) were as follows: forward, GCGCCCAACTGCATCCT; reverse, TCGCATCAGAAACGGGTAAAT; and probe, CGTCCACTACGGGCATCGGTGCT. Data were expressed as threshold cycle (ct) values according to the manufacturer’s guidelines (the cycle number at which logarithmic PCR plots cross a calculated threshold line) and used to determine {Delta}ct values ({Delta}ct = ct of the target gene – ct of the housekeeping gene; high {Delta}ct values represent low levels of expression). Fold changes were calculated using transformation (fold increase = 2–difference in {Delta}ct).

Statistical analysis

Data are expressed as mean ± SD or SEM, as specified. Statistical analysis on real-time PCR data were performed on mean {Delta}ct values to exclude potential bias owing to averaging data that had been transformed through the equation 2–ct. Comparisons between groups were undertaken using unpaired Student’s t tests where appropriate; otherwise, the Mann-Whitney U test was performed, employing version 12.0 of SPSS statistical software (SPSS, Inc., Chicago, IL). Significance was defined as P < 0.05.


   Results
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
Discussion
 References
 
Serum steroid measurements

Serum steroid hormones are given in Table 2Go. Circulating DHEA and DHEAS concentrations were significantly lower in older men (P < 0.01), whereas serum androstenedione and serum T did not differ significantly between the two age groups. However, the dihydrotestosterone metabolite androstanediol glucuronide, a measure of peripheral androgen synthesis, was significantly decreased in older men (P < 0.01).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Serum steroid concentrations (mean ± SEM) measured between 0900 and 1100 h in the male healthy volunteers according to age group

 
Expression analysis of enzymes involved in downstream conversion of DHEA to sex steroids

DHEA is converted to androstenedione by the two isozymes of 3ß-HSD1 and 2 (Fig. 1Go). Expression analysis of 3ß-HSD revealed that both isoforms are expressed in human PBMCs. All individuals showed expression of 3ß-HSD1 (HSD3B1) (Fig. 3AGo). However, expression of 3ß-HSD type 2 (HSD3B2) was inconsistent and only present in five of 16 individuals, irrespective of age (data not shown).



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 3. RT-PCR analysis of steroidogenic enzyme expression in human PBMCs. A, mRNA Expression of 3ß-HSD types 1 and 2 (HSD3B1/2), 5{alpha}-reductase types 1 and 2 (SRD5A1/2), P450 aromatase (CYP19), and 3{alpha}-HSD types 1–3 (AKR1C1–3). B, mRNA expression of 17ß-HSD types 1–5 (HSD17B1–5). M, 100-bp DNA ladder; Neg, negative control; positive control tissue RNA, Liv, liver; Tes, testis; Adr, adrenal; Br, brain.

 
5{alpha}-Reductase activity catalyzes androgen activation and metabolism (Fig. 1Go). RT-PCR analysis showed expression of 5{alpha}-reductase type 1 (SRD5A1) in human PBMCs and also, albeit weaker, of 5{alpha}-reductase type 2 (SRD5A2) (Fig. 3AGo). By contrast, expression of the isoenzyme 5ß-reductase (AKR1D1) was not detectable in PBMCs (data not shown).

Expression of P450 aromatase (CYP19), the enzyme responsible for conversion of androgens to estrogens, was not detected in PBMCs, even after up to 35 cycles of PCR amplification (Fig. 3AGo).

17ß-HSDs represent the crucial switch system in regulating sex steroid activation and inactivation by their reductive and oxidative activities, respectively (Fig. 1Go). RT-PCR analysis with specific primers for 17ß-HSD isozymes 1–5 revealed predominant expression of 17ß-HSD4 (HSD17B4) and 17ß-HSD5 (HSD17B5 = AKR1C3) in human PBMCs (Fig. 3BGo). 17ß-HSD5 mainly exhibits reductase activity and thereby catalyzes androgen activation, whereas 17ß-HSD4 predominantly mediates the reverse oxidative reaction and hence sex steroid inactivation (28, 29, 30). In some individuals, a weak band for 17ß-HSD3 (HSD17B3) was detectable. However, 17ß-HSD3 expression was negligible when compared with 17ß-HSD4 and 5 expression by semiquantitative RT-PCR (Fig. 3BGo).

Aldo-keto reductases exert 3{alpha}-HSD activity and are involved in further downstream metabolism of active androgens (Fig. 1Go). Some aldo-keto reductase enzymes also exert 20{alpha}-HSD (AKR1C1) or 17ß-HSD activity (AKR1C3). In human PBMCs, we found expression of 20{alpha}(3{alpha})-HSD (AKR1C1) and 3{alpha}-HSD type 2 [AKR1C3; identical with 17ß-HSD5 (HSD17B5)], whereas 3{alpha}-HSD type 3 (AKR1C2) was not detected (Fig. 3AGo).

Enzymatic activity assays in human PBMCs

Incubation of PBMCs with DHEA yielded generation of androstenedione via 3ß-HSD activity and of androstenediol via reductive 17ß-HSD activity. According to our mRNA expression results, the latter reaction is most likely catalyzed by 17ß-HSD type 5. 3ß-HSD activity did not show a significant difference between age groups (Fig. 4AGo). By contrast, conversion of DHEA to androstenediol by 17ß-HSD5 was significantly increased (Fig. 4AGo).



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 4. Conversion (picomoles per hour per 107 cells) of DHEA (A), androstenedione (B), and T (C) in human PBMCs isolated from younger men (ages 18–30 yr; n = 8) and older men (ages 50–70 yr; n = 8). Data are represented as medians and individual data points generated from triplicate measurements. Statistical analysis was performed by Mann-Whitney U test. {Delta}4dione, Androstenedione; {Delta}5diol, androstenediol; DHT, 5{alpha}-dihydrotestosterone; Anedione, 5{alpha}-androstanedione; AT, androsterone; 5{alpha}-Red, 5{alpha}-reductase.

 
17ß-HSD5 activity was also found to be increased in older men when looking at the conversion of androstenedione to T (P < 0.05) (Fig. 4BGo). Concurrently, also an increased conversion of androstenedione in the direction of 5{alpha}-androstanedione was noted, indicating increased 5{alpha}-reductase activity (P < 0.05) (Fig. 4BGo). Increased 5{alpha}-reductase activity was also indicated by a significantly higher activation of T to 5{alpha}-dihydrotestosterone in older men (P < 0.05) (Fig. 4CGo).

Inactivation from T to androstenedione via oxidative 17ß-HSD activity also occurred at a higher rate in older men (P < 0.05) (Fig. 4CGo). According to our mRNA expression data, the enzyme responsible for this conversion in human PBMCs is 17ß-HSD4.

However, it appears that there is an overall predominance of androgen activating (cumulative conversions by 5{alpha}-reductase and reductive 17ß-HSD activities) compared with inactivating, i.e. oxidative 17ß-HSD reactions in human PBMCs from both age groups.

Functional assays did not reveal estrogen generation from androstenedione or T, consistent with the observed lack of P450 aromatase mRNA expression in human PBMCs.

Semiquantitative and quantitative RT-PCR analysis

As shown above, 17ß-HSD 5 (AKR1C3) importantly catalyzes both the conversion of DHEA to the potentially immune-stimulatory androstenediol and the activation of androstenedione to T. As described above, we found a significant age-associated increase in 17ß-HSD5 activity within human PBMCs. To explore whether age-related differences in 17ß-HSD5 expression account for the difference in activity, we analyzed 17ß-HSD5 mRNA levels in human PBMCs. Semiquantitative RT-PCR analysis demonstrated significantly higher expression of 17ß-HSD5 in older men compared with the young men (P < 0.01) (Fig. 5AGo). Additional analysis of 17ß-HSD5 expression by means of quantitative real-time PCR confirmed this age-associated increase in expression levels (1.5-fold higher expression in elderly men), although narrowly missing statistical significance ({Delta}ct young vs. old, 11.6 ± 0.4 vs. 10.8 ± 0.2. P = 0.06). By contrast, 5{alpha}-reductase type 1 mRNA expression did not differ between age groups, neither when assessed by semiquantitative RT-PCR (Fig. 5BGo) nor by real-time PCR ({Delta}ct young vs. old, 20.5 ± 1.1 vs.19.1 ± 1.0, not significant).



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 5. Semiquantitative analysis of 17ß-HSD5 mRNA expression (A) and 5{alpha}-reductase 1 mRNA expression (B) in human PBMCs isolated from healthy young men (ages 18–30 yr; n = 8) and healthy older men (ages 50–70 yr; n = 8). Relative expression levels were normalized to expression of the housekeeping gene 18S. Data are represented as medians and individual data points generated from triplicate measurements. Statistical analysis was performed by Mann-Whitney U test.

 

   Discussion
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
References
 
Here, we have demonstrated mRNA expression and enzymatic activity of all steroidogenic enzymes required for efficient downstream conversion of DHEA toward androstenediol and active androgens within human PBMCs. Importantly, we could show that the steroidogenic capacity of the lymphocyte pool appears to change with aging, specifically leading to an increase in androstenediol and active androgen generation.

A previous study has reported that 16{alpha}-hydroxy-DHEA and to a lesser extent 16{alpha}-hydroxy-T were formed upon incubation of purified mononuclear cells and monocyte-derived macrophages with radiolabeled DHEA (25). By contrast, we did not detect any measurable formation of 16{alpha}-hydroxylated compounds by using freshly prepared and processed PBMCs that mainly consist of peripheral T- and B-lymphocytes (80–90%) but only contain few monocytes or macrophages (5–15%).

Therefore, conversion of DHEA toward androstenediol and toward androgens appear to be the preferred conversions in lymphocytes, whereas monocytes/macrophages may exert a different conversion pattern. This also highlights the potentially important contributions of different subtypes of immune cells. Analysis of steroidogenesis in the PBMC pool as a whole, as employed by us, provides a convenient overall measure. Although differential blood counts did not differ between age groups, it may well be that flow cytometry would have revealed distinct differences. Changes in lymphocyte subsets generally observed with aging include a shift from naive to memory CD45+ T cells, an increase in NK cells, and a shift from naive to activated monocytes (31). Therefore, analysis of steroidogenesis in distinct subtypes of immune cells will be an important issue to be addressed by future studies. Importantly, steroidogenic activities may depend on the activation or differentiation state of a specific immune cell, as recently shown for the up-regulation of 11ß-HSD type 1 upon maturation of monocytes to macrophages (32) and the up-regulation of 1{alpha}-hydroxylase activity upon maturation of monocytes to dendritic cells (33).

Consistent with previous findings (24, 26), we did not find expression of P450 aromatase in human PBMCs. In accordance with this finding, incubation of PBMCs with radiolabeled androstenedione and T did not yield formation of estrone and 17ß-estradiol, respectively. This suggests that DHEA-induced immune-modulatory effects will not be mediated by estrogens but rather by DHEA conversion toward androgens or other steroids of distinct activity, e.g. androstenediol.

We have carried out our study with PBMCs isolated from young and middle-aged men. Exogenous DHEA administration leads to sex-specific differences in downstream conversion as assessed by circulating steroid hormone levels (34, 35). Therefore, it is conceivable that immune cells isolated from female donors may show distinct differences to male donor cells, and future studies may take this into account.

Steroid metabolism and cytokine production are closely intertwined processes (36). In addition to the numerous studies reporting the effects of steroid hormones on the immune system, several studies have described the effect of cytokines on steroidogenic enzymes, both in murine models (37, 38) and in human cells (39, 40). Aging is associated with distinct changes in cytokine production, in particular an increase in IL-6 and a decrease in IL-2, and DHEA has been shown to revert these changes in human immune cells in vitro (18, 20). Therefore, it is well conceivable that changes in cytokine milieu with aging may impact on tissue-specific steroid conversion.

Taken together, our results provide compelling evidence for significant changes in sex steroid metabolism within human PBMCs with aging. We observed particular increases in 17ß-HSD5 activity and expression. This subsequently yielded an increased conversion of DHEA toward the immune modulatory metabolite androstenediol and secondarily also of androstenedione toward T, i.e. increased sex steroid activation. This up-regulation may represent a compensatory mechanism of the peripheral target cell counteracting the decline in circulating DHEA that occurs with aging. Although future studies will have to clarify the exact mechanism of this up-regulation and further explore its clinical significance, our findings are likely to represent an endocrine link to the control of immune senescence.

Importantly, our results illustrate that circulating hormone levels do not necessarily reflect intracellular hormone activity, e.g. enhanced downstream conversion of DHEA within immune cells despite low circulating DHEA levels. This further exemplifies the importance of prereceptor regulation of steroid hormone action.


   Acknowledgments
 
We thank Dr. Synthia H. Mellon, University of California (San Francisco, CA) for initial advice regarding the set-up of the PBMC incubation assay.


   Footnotes
 
W.A. is a Medical Research Council UK Senior Clinical Fellow. M.Q. was supported by a Postdoctoral Research Fellowship from the Deutsche Forschungsgmeinschaft (QU 142/1-1), and S.B.S. was supported by a medical student short-term research fellowship from the German Academic Exchange Service Deutscher Akademischer Austauschdienst.

First Published Online August 9, 2005

1 F.H. and D.G.D. contributed equally to this study. Back

Abbreviations: androstenedione, 4-Androstene-3,17-dione; DHEA, dehydroepiandrosterone; DHEAS, DHEA sulfate; HSD, hydroxysteroid dehydrogenase; NK, natural killer; PBMC, peripheral blood mononuclear cell; T, testosterone; TLC, thin-layer chromatography.

Received April 27, 2005.

Accepted August 3, 2005.


   References
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Allolio B, Arlt W 2002 DHEA treatment: myth or reality? Trends Endocrinol Metab 13:288–294[CrossRef][Medline]
  2. Orentreich N, Brind JL, Vogelman JH, Andres R, Baldwin H 1992 Long-term longitudinal measurements of plasma dehydroepiandrosterone sulfate in normal men. J Clin Endocrinol Metab 75:1002–1004[Abstract]
  3. Sulcova J, Hill M, Hampl R, Starka L 1997 Age and sex related differences in serum levels of unconjugated dehydroepiandrosterone and its sulphate in normal subjects. J Endocrinol 154:57–62[Abstract/Free Full Text]
  4. Gillis S, Kozak R, Durante M, Weksler ME 1981 Immunological studies of aging. Decreased production of and response to T cell growth factor by lymphocytes from aged humans. J Clin Invest 67:937–942
  5. Mysliwska J, Bryl E, Foerster J, Mysliwski A 1998 Increase of interleukin 6 and decrease of interleukin 2 production during the ageing process are influenced by the health status. Mech Ageing Dev 100:313–328[CrossRef][Medline]
  6. Wei S, Blanchard DK, McMillen S, Djeu JY 1992 Lymphokine-activated killer cell regulation of T-cell-mediated immunity to Candida albicans. Infect Immun 60:3586–3595[Abstract/Free Full Text]
  7. Dasgupta B, Corkill M, Kirkham B, Gibson T, Panayi G 1992 Serial estimation of interleukin 6 as a measure of systemic disease in rheumatoid arthritis. J Rheumatol 19:22–25[Medline]
  8. De Benedetti F, Massa M, Pignatti P, Albani S, Novick D, Martini A 1994 Serum soluble interleukin 6 (IL-6) receptor and IL-6/soluble IL-6 receptor complex in systemic juvenile rheumatoid arthritis. J Clin Invest 93:2114–2119
  9. Manolagas SC, Jilka RL 1995 Bone marrow, cytokines, and bone remodeling. Emerging insights into the pathophysiology of osteoporosis. N Engl J Med 332:305–311[Free Full Text]
  10. Ikeda U, Ikeda M, Seino Y, Takahashi M, Kano S, Shimada K 1992 Interleukin 6 gene transcripts are expressed in atherosclerotic lesions of genetically hyperlipidemic rabbits. Atherosclerosis 92:213–218[CrossRef][Medline]
  11. Wood JA, Wood PL, Ryan R, Graff-Radford NR, Pilapil C, Robitaille Y, Quirion R 1993 Cytokine indices in Alzheimer’s temporal cortex: no changes in mature IL-1ß or IL-1RA but increases in the associated acute phase proteins IL-6, {alpha}2-macroglobulin and C-reactive protein. Brain Res 629:245–252[CrossRef][Medline]
  12. Straub RH, Konecna L, Hrach S, Rothe G, Kreutz M, Scholmerich J, Falk W, Lang B 1998 Serum dehydroepiandrosterone (DHEA) and DHEA sulfate are negatively correlated with serum interleukin-6 (IL-6), and DHEA inhibits IL-6 secretion from mononuclear cells in man in vitro: possible link between endocrinosenescence and immunosenescence. J Clin Endocrinol Metab 83:2012–2017[Abstract/Free Full Text]
  13. Daynes RA, Dudley DJ, Araneo BA 1990 Regulation of murine lymphokine production in vivo. II. Dehydroepiandrosterone is a natural enhancer of interleukin 2 synthesis by helper T cells. Eur J Immunol 20:793–802[Medline]
  14. Corsini E, Lucchi L, Meroni M, Racchi M, Solerte B, Fioravanti M, Viviani B, Marinovich M, Govoni S, Galli CL 2002 In vivo dehydroepiandrosterone restores age-associated defects in the protein kinase C signal transduction pathway and related functional responses. J Immunol 168:1753–1758[Abstract/Free Full Text]
  15. McLachlan JA, Serkin CD, Bakouche O 1996 Dehydroepiandrosterone modulation of lipopolysaccharide-stimulated monocyte cytotoxicity. J Immunol 156:328–335[Abstract]
  16. Risdon G, Moore TA, Kumar V, Bennett M 1991 Inhibition of murine natural killer cell differentiation by dehydroepiandrosterone. Blood 78:2387–2391[Abstract/Free Full Text]
  17. Yang BC, Liu CW, Chen YC, Yu CK 1998 Exogenous dehydroepiandrosterone modified the expression of T helper-related cytokines in NZB/NZW F1 mice. Immunol Invest 27:291–302[Medline]
  18. Suzuki T, Suzuki N, Daynes RA, Engleman EG 1991 Dehydroepiandrosterone enhances IL2 production and cytotoxic effector function of human T cells. Clin Immunol Immunopathol 61:202–211[Medline]
  19. Solerte SB, Fioravanti M, Vignati G, Giustina A, Cravello L, Ferrari E 1999 Dehydroepiandrosterone sulfate enhances natural killer cell cytotoxicity in humans via locally generated immunoreactive insulin-like growth factor I. J Clin Endocrinol Metab 84:3260–3267[Abstract/Free Full Text]
  20. Gordon CM, LeBoff MS, Glowacki J 2001 Adrenal and gonadal steroids inhibit IL-6 secretion by human marrow cells. Cytokine 16:178–186[CrossRef][Medline]
  21. Offner H, Zamora A, Drought H, Matejuk A, Auci DL, Morgan EE, Vandenbark AA, Reading CL 2002 A synthetic androstene derivative and a natural androstene metabolite inhibit relapsing-remitting EAE. J Neuroimmunol 130:128–139[CrossRef][Medline]
  22. Padgett DA, Loria RM 1994 In vitro potentiation of lymphocyte activation by dehydroepiandrosterone, androstenediol, and androstenetriol. J Immunol 153:1544–1552[Abstract]
  23. Whitnall MH, Elliott TB, Harding RA, Inal CE, Landauer MR, Wilhelmsen CL, McKinney L, Miner VL, Jackson 3rd WE, Loria RM, Ledney GD, Seed TM 2000 Androstenediol stimulates myelopoiesis and enhances resistance to infection in {gamma}-irradiated mice. Int J Immunopharmacol 22:1–14[CrossRef][Medline]
  24. Milewich L, Whisenant MG, Sawyer MK 1982 Androstenedione metabolism by human lymphocytes. J Steroid Biochem 16:81–85[CrossRef][Medline]
  25. Schmidt M, Kreutz M, Loffler G, Scholmerich J, Straub RH 2000 Conversion of dehydroepiandrosterone to downstream steroid hormones in macrophages. J Endocrinol 164:161–169[Abstract]
  26. Zhou Z, Shackleton CH, Pahwa S, White PC, Speiser PW 1998 Prominent sex steroid metabolism in human lymphocytes. Mol Cell Endocrinol 138:61–69[CrossRef][Medline]
  27. Quinkler M, Johanssen S, Grossmann C, Bahr V, Muller M, Oelkers W, Diederich S 1999 Progesterone metabolism in the human kidney and inhibition of 11ß-hydroxysteroid dehydrogenase type 2 by progesterone and its metabolites. J Clin Endocrinol Metab 84:4165–4171[Abstract/Free Full Text]
  28. Adamski J, Normand T, Leenders F, Monte D, Begue A, Stehelin D, Jungblut PW, de Launoit Y 1995 Molecular cloning of a novel widely expressed human 80 kDa 17ß-hydroxysteroid dehydrogenase IV. Biochem J 311:437–443
  29. Adamski J, Jakob FJ 2001 A guide to 17ß-hydroxysteroid dehydrogenases. Mol Cell Endocrinol 171:1–4[CrossRef][Medline]
  30. Luu-The V 2001 Analysis and characteristics of multiple types of human 17ß-hydroxysteroid dehydrogenase. J Steroid Biochem Mol Biol 76:143–151[CrossRef][Medline]
  31. Globerson A, Effros RB 2000 Ageing of lymphocytes and lymphocytes in the aged. Immunol Today 21:515–521[CrossRef][Medline]
  32. Thieringer R, Le Grand CB, Carbin L, Cai TQ, Wong B, Wright SD, Hermanowski-Vosatka A 2001 11ß-hydroxysteroid dehydrogenase type 1 is induced in human monocytes upon differentiation to macrophages. J Immunol 167:30–35[Abstract/Free Full Text]
  33. Hewison M, Kantorovich V, Liker HR, Van Herle AJ, Cohan P, Zehnder D, Adams JS 2003 Vitamin D-mediated hypercalcemia in lymphoma: evidence for hormone production by tumor-adjacent macrophages. J Bone Miner Res 18:579–582[CrossRef][Medline]
  34. Arlt W, Justl HG, Callies F, Reincke M, Hubler D, Oettel M, Ernst M, Schulte HM, Allolio B 1998 Oral dehydroepiandrosterone for adrenal androgen replacement: pharmacokinetics and peripheral conversion to androgens and estrogens in young healthy females after dexamethasone suppression. J Clin Endocrinol Metab 83:1928–1934[Abstract/Free Full Text]
  35. Arlt W, Justl HG, Callies F, Reincke M, Hubler D, Oettel M, Ernst M, Schulte HM, Allolio B 1999 Biotransformation of oral dehydroepiandrosterone in elderly men: significant increase in circulating estrogens. J Clin Endocrinol Metab 84:2170–2176[Abstract/Free Full Text]
  36. Arlt W, Hewison M 2004 Hormones and immune function: implications of aging. Aging Cell 3:209–216[CrossRef][Medline]
  37. Kim MS, Shigenaga J, Moser A, Grunfeld C, Feingold KR 2004 Suppression of DHEA sulfotransferase (Sult2A1) during the acute-phase response. Am J Physiol Endocrinol Metab 287:731–738
  38. Samy TS, Knoferl MW, Zheng R, Schwacha MG, Bland KI, Chaudry IH 2001 Divergent immune responses in male and female mice after trauma-hemorrhage: dimorphic alterations in T lymphocyte steroidogenic enzyme activities. Endocrinology 142:3519–3529[Abstract/Free Full Text]
  39. Cooper MS, Bujalska I, Rabbitt E, Walker EA, Bland R, Sheppard MC, Hewison M, Stewart PM 2001 Modulation of 11ß-hydroxysteroid dehydrogenase isozymes by proinflammatory cytokines in osteoblasts: an autocrine switch from glucocorticoid inactivation to activation. J Bone Miner Res 16:1037–1044[CrossRef][Medline]
  40. Gingras S, Moriggl R, Groner B, Simard J 1999 Induction of 3ß-hydroxysteroid dehydrogenase/{Delta}5-{Delta}4 isomerase type 1 gene transcription in human breast cancer cell lines and in normal mammary epithelial cells by interleukin-4 and interleukin-13. Mol Endocrinol 13:66–81[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
V. Dhir, H. E. Ivison, N. Krone, C. H. L. Shackleton, A. J. Doherty, P. M. Stewart, and W. Arlt
Differential Inhibition of CYP17A1 and CYP21A2 Activities by the P450 Oxidoreductase Mutant A287P
Mol. Endocrinol., August 1, 2007; 21(8): 1958 - 1968.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
W. Arlt, F. Hammer, P. Sanning, S. K. Butcher, J. M. Lord, B. Allolio, D. Annane, and P. M. Stewart
Dissociation of Serum Dehydroepiandrosterone and Dehydroepiandrosterone Sulfate in Septic Shock
J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2548 - 2554.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hammer, F.
Right arrow Articles by Arlt, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hammer, F.
Right arrow Articles by Arlt, W.
Related Collections
Right arrow Male Endocrinology

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals