| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
BRIEF REPORT |
Department of Pediatrics, University of Texas Southwestern Medical Center, Dallas, Texas 75390-9063
Address all correspondence and requests for reprints to: Dr. Perrin C. White, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75390-9063. E-mail: perrin.white{at}utsouthwestern.edu.
| Abstract |
|---|
|
|
|---|
Objective: The objective of this study was to confirm the postulated digenic inheritance mechanism for ACRD.
Design: This was a population-based association study (Dallas Heart Study). Subjects were genotyped for the 1971T>G polymorphism in intron 3 of HSD11B1 and the R453Q polymorphism in H6PD.
Subjects: The study comprised 3551 individuals in a population-based sample (50% black, 35% white, and 15% Hispanic).
Main Outcome Measure: The main outcome measure was association between genotypes and risk for polycystic ovarian syndrome.
Results: Both polymorphisms occurred more frequently than previously reported. Thus, ACRD genotypes (at least three of four minor alleles) occurred in 7.0% of subjects. There were no associations between genotype and body mass index; waist/hip ratio; visceral adiposity; measures of insulin sensitivity; levels of testosterone, FSH, or LH (in females); or risk of polycystic ovarian syndrome. There was no genotype effect on urinary free cortisol/cortisone or corticosteroid metabolite ratios, which were measured in 10 subjects, each carrying zero, three, or four minor alleles.
Conclusions: Previously reported associations of ACRD with HSD11B1 and H6PD alleles represent ascertainment bias. However, rare severe mutations in these genes cannot be ruled out.
| Introduction |
|---|
|
|
|---|
It was originally assumed that ACRD was caused by mutations in HSD11B1. The lack of 11-oxoreductase activity would lead to decreased cortisol half-life due to the unopposed action of 11-HSD2. In turn, the adrenal cortex would secrete more cortisol to compensate for the decreased half-life, leading to increased secretion of adrenal androgens as well. In affected women, this would cause signs of androgen excess similar to polycystic ovarian syndrome (PCOS), but without the obesity or signs of insulin resistance that usually accompany PCOS.
However, no mutations in coding sequences or intron-exon junctions of HSD11B1 have been detected in any ACRD patient (1, 5). Instead, two polymorphisms in intron 3 of HSD11B1 were found in complete linkage disequilibrium: 83,557insA (actually 1931 bp downstream of the initial A in the coding sequence) and 83,597T>G (1971 bp from the initial A; this polymorphism is hereafter referred to intron 3 G). They were associated with decreased HSD11B1 expression in vivo and after transfection of minigene constructs in cultured cells. However, the polymorphic haplotype had an allele frequency of 0.14 in normal individuals (thus being homozygous in 2% of the population), whereas ACRD is ascertained very rarely. Moreover, there was no association of homozygosity for these polymorphisms with ACRD (6).
The active site of 11-HSD1 is located within the lumen of the endoplasmic reticulum (7). Because the reductase activity of 11-HSD1 was known to depend on provision of reduced nicotinamide adenine dinucleotide phosphate (NADPH) and removal of NADP+ (8), mutations were sought in hexose-6-phosphate dehydrogenase (H6PD), an enzyme that catalyzes the initial step of the pentose phosphate pathway within the lumen of the endoplasmic reticulum. In fact, two patients with ACRD were homozygous for a missense mutation in H6PD, R453Q, whereas one patient was heterozygous for a 29-bp insertion/frameshift mutation. When mutant enzymes were expressed in cultured cells, the R453Q mutation decreased enzymatic activity to less than 50% of normal, whereas the 29-bp insertion abolished it. The allele frequency of R453Q was 0.20, suggesting that approximately 4% of the population was homozygous. Thus, this polymorphism could not by itself explain ACRD either. However, the patients who were homozygous for R453Q in H6PD were also heterozygous for the intron 3 polymorphisms in HSD11B1, and the patient carrying the 29-bp insertion in H6PD was homozygous for the HSD11B1 intron 3 polymorphism. It was therefore concluded that ACRD resulted from simultaneous allelic variation in the HSD11B1 and H6PD loci, requiring at least three of a possible four affected alleles (also referred to as minor alleles) at the two loci. The combined genotype of H6PD R453Q homozygosity and HSD11B1 intron 3 G heterozygosity was predicted to occur in approximately 0.8% of the population, which did not seem inconsistent with the apparent rarity of ACRD if the disease was poorly ascertained (6).
Because of the post hoc nature of the results and the small number of ascertained ACRD patients, we attempted to confirm these results by detecting additional ACRD cases through genetic screening of a large population-based sample.
| Subjects and Methods |
|---|
|
|
|---|
The Dallas Heart Study has been described previously in detail (9); it was approved by the institutional review board of University of Texas Southwestern Medical Center. It is a probability-based sample of Dallas County residents, aged 1865 yr, who was surveyed with an extensive household health interview. Participants, 3065 yr of age, provided in-home fasting blood and urine samples and visited a research clinic, where they underwent multiple imaging studies. Diastolic and systolic blood pressures were measured on three separate occasions. Completed interviews were obtained for 6101 subjects (54% black), phlebotomy visits for 3551 (52% black), and clinic visits for 2971 (50% black). Subcutaneous and visceral adipose tissue masses were assessed in some subjects by abdominal magnetic resonance imaging (MRI) (10).
Women who were aged 3549 yr at the time of the initial interview qualified for the Reynolds Womens Study. All such women who underwent phlebotomy had FSH, LH, testosterone, and SHBG measured. They were also asked to participate in an extra survey regarding clinical symptoms of PCOS as well as have a pelvic MRI to examine features of their ovaries. Exclusion criteria were pregnancy, nursing, not wanting to participate, or contraindications to MRI, including claustrophobia. For the present study, PCOS was defined as the presence of more than 10 cysts detected by MRI in one or both ovaries.
Genotyping
Single nucleotide polymorphisms in the H6PD and HSD11B1 genes were genotyped by the Reynolds Center at University of Texas Southwestern Medical Center using 5'-endonucleotidase assays based on the TaqMan system (Applied Biosystems, Inc., Foster City, CA) (11). Primers for H6PD were: forward, TCTGTCCGATTACTACGCCTACAG; and reverse, AAATTCTTCCGGCCATGGA. Probes for H6PD were 6-carboxy fluorescein-TCCCGCTCCcGCA and VIC-TCCCGCTCCtGCA. Primers for HSD11B1 were: forward, TGGGAGGAGAATGGGAAAGG; and reverse, CCTCCTGCAAGAGATGGCTATATT. Probes for HSD11B1 were 6-carboxy fluorescein-AACCCCAGAgGATT and VIC-AACCCCAGAtGATT.
Urinary steroid assays
Urinary free cortisol and free cortisone levels were measured at Nichols Institute Diagnostics (San Juan Capistrano, CA) by tandem mass spectrometry essentially as previously described (12). Corticosteroid metabolite ratios were measured by Dr. Cedric Shackleton (Oakland Childrens Hospital, Oakland, CA) by gas chromatography/mass spectrometry (13).
Tests of statistical significance
Ethnic differences in allele frequencies were analyzed by
2, as were differences in risk of PCOS between genotype groups. Differences in other variables between genotype groups were assessed by ANOVA, using ethnicity as a covariate. Associations with blood pressure were assessed by repeated measures ANOVA.
| Results |
|---|
|
|
|---|
We genotyped 3551 individuals from the Dallas Heart Study (15% Hispanic, 35% white, and 50% black) for biallelic polymorphisms in the HSD11B1 and H6PD genes (Table 1
). The minor allele at each locus (HSD11B1 intron 3 G and H6PD R453Q) occurred more frequently than had been previously reported in an analysis of 100 normal whites and 49 Indo-Asians (Table 1
) (6). In particular, blacks had a much higher frequency of H6PD R453Q (P < 0.0001) compared with other ethnic groups.
|
Allelism at H6PD and HSD11B1 loci has no effect on urinary corticosteroid excretion
Patients with ACRD have markedly reduced urinary excretion of cortisol metabolites compared with cortisone metabolites. We used two independent assays to ensure that the association of this finding with H6PD and HSD11B1 alleles did not represent an ascertainment bias. First, we determined urinary free cortisol and free cortisone excretion by tandem mass spectrometry in 30 subjects, 10 each with zero, three, or four minor alleles. All subjects had normal cortisol and cortisone excretion relative to creatinine excretion, and all had ratios of urinary free cortisol to cortisone well within the normal range for this particular assay (0.060.37). There were no differences in the cortisol/cortisone ratio among the genotype groups (zero minor alleles, 0.26 ± 0.15; three minor alleles, 0.28 ± 0.13; four minor alleles, 0.29 ± 0.14; Table 2
).
|
Allelism at H6PD and HSD11B1 loci has no effect on other clinical findings associated with PCOS
There was no increased risk of PCOS (diagnosed on a population basis by MRI) with the ACRD genotypes or with either of the loci alone (Table 2
).
There was no genotype effect on waist/hip ratio, BMI, blood pressure, visceral adiposity, glucose, or insulin after ethnicity was taken into account. There were also no genotype effects on any relevant biochemical parameter in females, such as testosterone, FSH, LH, or SHBG.
| Discussion |
|---|
|
|
|---|
Nevertheless, there is compelling biochemical evidence of cooperativity between H6PD and 11-HSD1 within the lumen of the endoplasmic reticulum (15), and increasing or decreasing H6PD levels in cultured cells have corresponding effects on 11-HSD1 activity (16). Furthermore, mutating H6PD in mice abolishes 11-oxoreductase activity (Lavery, G. G., G. A. Walker, N. Draper, P. Jeyasurin, J. Shelton, C. H. L. Shackleton, J. Marcus, J. A. Richardson, K. L. Parker, P. C. White, and P. M. Stewart, unpublished observations). Hence, it remains likely that H6PD and/or HSD11B1 play roles in the pathogenesis of ACRD.
There are two ways in which all these facts might be reconciled. First, polymorphisms in H6PD and HSD11B1 might cause ACRD only in the presence of polymorphisms in a third locus, yet to be identified. This is a post hoc hypothesis for which there is no direct evidence. Second, there might be additional mutations in H6PD or HSD11B1 that were not identified in previous studies, but that have major effects on expression or activity. The fact that one patient was heterozygous for a 29-bp mutation in H6PD that abolished enzymatic activity is evidence that such mutations exist. These might be ascertained by more extensive sequence analysis. Indirect evidence might be obtained by demonstrating that levels of H6PD activity in ACRD patients are much lower than the approximately 50% of normal predicted for individuals who are homozygous for the R453Q polymorphism.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online August 9, 2005
Abbreviations: ACRD, Apparent cortisone reductase deficiency; H6PD, hexose-6-phosphate dehydrogenase; 11-HSD1, 11ß-hydroxysteroid dehydrogenase type 1; MRI, magnetic resonance imaging; PCOS, polycystic ovarian syndrome.
Received April 29, 2005.
Accepted July 29, 2005.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. G. Lavery, E. A. Walker, A. Tiganescu, J. P. Ride, C. H. L. Shackleton, J. W. Tomlinson, J. M. C. Connell, D. W. Ray, A. Biason-Lauber, E. M. Malunowicz, et al. Steroid Biomarkers and Genetic Studies Reveal Inactivating Mutations in Hexose-6-Phosphate Dehydrogenase in Patients with Cortisone Reductase Deficiency J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 3827 - 3832. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yazawa, M. Uesaka, Y. Inaoka, T. Mizutani, T. Sekiguchi, T. Kajitani, T. Kitano, A. Umezawa, and K. Miyamoto Cyp11b1 Is Induced in the Murine Gonad by Luteinizing Hormone/Human Chorionic Gonadotropin and Involved in the Production of 11-Ketotestosterone, a Major Fish Androgen: Conservation and Evolution of the Androgen Metabolic Pathway Endocrinology, April 1, 2008; 149(4): 1786 - 1792. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Smit, M. J. H. J. Dekker, F. J. de Jong, A. W. van den Beld, J. W. Koper, H. A. P. Pols, A. O. Brinkmann, F. H. de Jong, M. M. B. Breteler, and S. W. J. Lamberts Lack of Association of the 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Gene 83,557insA and Hexose-6-Phosphate Dehydrogenase Gene R453Q Polymorphisms with Body Composition, Adrenal Androgen Production, Blood Pressure, Glucose Metabolism, and Dementia J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 359 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gambineri, V. Vicennati, S. Genghini, F. Tomassoni, U. Pagotto, R. Pasquali, and B. R. Walker Genetic Variation in 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Predicts Adrenal Hyperandrogenism among Lean Women with Polycystic Ovary Syndrome J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2295 - 2302. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. G. Lavery, E. A. Walker, N. Draper, P. Jeyasuria, J. Marcos, C. H. L. Shackleton, K. L. Parker, P. C. White, and P. M. Stewart Hexose-6-phosphate Dehydrogenase Knock-out Mice Lack 11beta-Hydroxysteroid Dehydrogenase Type 1-mediated Glucocorticoid Generation J. Biol. Chem., March 10, 2006; 281(10): 6546 - 6551. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |