Journal of Clinical Endocrinology & Metabolism
, doi:10.1210/jc.2004-1358
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 1 455-462
Copyright © 2005 by The Endocrine Society
PAX8, TITF1, and FOXE1 Gene Expression Patterns during Human Development: New Insights into Human Thyroid Development and Thyroid Dysgenesis-Associated Malformations
Sylvia Sura Trueba,
Joëlle Augé,
Géraldine Mattei,
Heather Etchevers,
Jélééna Martinovic,
Paul Czernichow,
Michel Vekemans,
Michel Polak and
Tania Attié-Bitach
Institut National de la Santé et de la Recherche Médicale, Unité 457 (S.S.T., P.C., M.P.), and Service dEndocrinologie Pédiatrique (P.C.), Hôpital Robert Debré; Institut National de la Santé et de la Recherche Médicale E0363 (S.S.T., M.P.), Faculté de Médecine Necker-Enfants Malades; and Département de Génétique/Institut National de la Santé et de la Recherche Médicale, Unité 393 (J.A., G.M., H.E., J.M., M.V., T.A.-B.), and Service dEndocrinologie Pédiatrique (M.P.), Hôpital Necker-Enfants Malades, Paris, France
Address all correspondence and requests for reprints to: Dr. Michel Polak, Service dEndocrinologie Pédiatrique, Hôpital Necker-Enfants Malades, 149 rue de Sèvres, 75743 Paris Cedex 15, France. E-mail: michel.polak{at}nck.ap-hop-paris.fr.
 |
Abstract
|
|---|
Thyroid dysgenesis (TD) is responsible for most cases of congenital hypothyroidism, a condition that affects about one in 4000 newborns. Mutations in PAX8, TITF1, or FOXE1 may account for congenital hypothyroidism in patients with either isolated TD or TD with associated malformations involving kidney, lung, forebrain, and palate. Pax8, titf1, and foxe1 are expressed in the mouse thyroid bud as soon as it differentiates on the pharyngeal floor. Because the spatio-temporal expression of these genes is unknown in humans, we decided to study them at different stages of human embryonic and fetal development. PAX8 and TITF1 were first expressed in the median thyroid primordium. Interestingly, PAX8 was also expressed in the thyroglossal duct and the ultimobranchial bodies. Human FOXE1 expression was detected later than in the mouse. PAX8 was also expressed in the developing central nervous system and kidney, including the ureteric bud and the main collecting ducts. TITF1 was expressed in the ventral forebrain and lung. FOXE1 expression was detected in the oropharyngeal epithelium and thymus. In conclusion, the expression patterns described here show some differences from those reported in the mouse. They explain the malformations associated with TD in patients carrying PAX8, TITF1, and FOXE1 gene mutations.
 |
Introduction
|
|---|
NORMAL THYROID FUNCTION is essential for development, growth, and metabolic homeostasis. Defects in any step of thyroid development (such as specification, proliferation, migration, growth, organization, differentiation, and survival) may result in a congenital anomaly and/or impaired hormonogenesis, leading to variable degrees of hypothyroidism. Congenital hypothyroidism (CH) affects one in 4000 newborns, and thyroid dysgenesis (TD) accounts for about 85% of the cases; the other 1015% result from functional disorders in hormone synthesis. TD includes absence of thyroid tissue (athyreosis), presence of ectopic tissue, as well as hypoplasia of an orthotopic gland. Ectopic thyroid is by far the most common cause of CH, followed by athyreosis. In contrast, thyroid hypoplasia is very rare (1). TD is usually sporadic, although some cases of familial forms support Mendelian inheritance (2, 3, 4).
In the human embryo, the thyroid gland is the first endocrine gland to develop. In its mature form, it is composed of two different hormone-producing cells, namely, thyroid follicular cells and parafollicular cells, also called C cells. These two cell types have distinct embryonic origins. The former derives from the floor of the foregut (median primordium), whereas the latter arises from cells within the ultimobranchial body (lateral primordia) (5). A morphological and anatomical description of thyroid development is summarized in Table 1
.
A number of thyroid follicular cell-specific transcriptional regulators have been identified in various animal models. Three of these genes, namely, the paired domain factor Pax8, Titf1 (also known as Nkx2a, Ttf-1, or T/ebp), and Foxe1 (also called Titf2 or Ttf-2), are expressed in the thyroid gland during mouse development until adult life (6, 7, 8, 9) and are required for normal thyroid development. Indeed, in all three knockout models, a thyroid primordium forms, but fails to produce a definitive thyroid gland. In the pax8/ knockout mouse, the primary thyroid primordium disappears, leading to a complete absence of follicular cells (10). In the titf1/ knockout mouse, the thyroid primordium is lost by apoptosis, and neither thyroid follicular cells nor C cells can be found (11). Finally, in the titf2/ knockout mouse, the thyroid primordium fails to migrate, and in half of the fetuses on embryonic d 15.5 (E15.5) it is still detectable, but by birth it has completely disappeared (12). In addition, mutations of these genes have been identified in humans providing a molecular basis for some cases of CH, frequently with associated anomalies (13, 14, 15). In the present study we describe the expression patterns of PAX8, TITF1, and FOXE1 genes and thyroglobulin protein during human development. Comparison of these expression patterns with those observed in animal models provides new insights into human thyroid development and delineates a conceptual framework to better assess the phenotypes of patients bearing mutations in these genes.
 |
Materials and Methods
|
|---|
Tissues
Human embryos and fetal tissues were obtained from legally terminated pregnancies in agreement with French legislation, following national ethics committee recommendations, and with approval from the Necker Hospital ethics committee. Embryonic stages were determined according to morphological criteria of the Carnegie staging (CS) classification (16). Five different developmental stages were studied: two embryos at CS14 (d 33), two embryos at CS15 (d 34), two embryos at CS19 (d 4748), and two fetuses of 9 and 11 wk of development, respectively. Tissues were fixed in 4% phosphatase-buffered paraformaldehyde, dehydrated, and embedded in paraffin blocks, and 5-µm-thick serial sections were cut.
Hybridization probes
Coding sequences of PAX8 (a 174-bp fragment in exon 6 corresponding to positions 603776), TITF1 (a 204-bp fragment in exon 2 between positions 159 and 362), and FOXE1 (a 203-bp fragment between positions 583 and 785) were amplified by PCR from human genomic DNA using the following forward and reverse primers: PAX8 forward, 5'-GATCAGGATAGCTGCCGACT-3'; PAX8 reverse, 5'-GTTGTACCTGCTCGCCTTTG-3'; TITF1 forward, 5'-TACAAGAAAGTGGGCATGGA-3'; TITF1 reverse, 5'-CAGGTTGCCGTTGCAGTAG-3'; FOXE1 forward, 5'-CCGTCTATGCAGGCTACGC-3'; and FOXE1 reverse, 5'-CTGGTAGCCGGTGGTGGTAG-3'. The amplified sequences were specific for each gene respectively (not shared by other family members). A T7 (TAATACGACTCACTATAGGGAGA) extension was added to primers in the 5' position to produce experimental (antisense) and control (sense) DNA template to generate probes. The antisense DNA template was generated after amplification using a forward primer and a T7 added reverse primer. The sense DNA template was produced from a fragment amplified with a reverse primer and a T7 added forward primer. Probes were transcribed from the corresponding sense and antisense DNA templates in the presence of [
-35S]UTP (1200 Ci/mmol; NEN Life Science Products, Boston, MA) and were purified on Sephadex G-50 columns.
In situ hybridization
In situ hybridizations were performed as previously described (17, 18) with 15 µl 50% formamide, 300 mM NaCl, 20 mM Tris-HCl (pH 7.4), 5 mM EDTA, 10% dextran sulfate, 1% Denhardts solution, 10 mM NaH2PO4, 0,5 mg/ml yeast total RNA, and the [
-35S]UTP-labeled sense or antisense probes to a final concentration of 5 x 104 cpm/µl. Slides were incubated overnight at 50 C in a humidified chamber. After hybridization, slides were washed, dipped in Kodak NTB2 photographic emulsion (Eastman Kodak, Rochester, NY) for 3 wk at 4 C, developed, fixed, counterstained with toluidine blue, dehydrated, and coverslipped. They were analyzed under dark- and brightfield illumination. Adjacent slides were hematoxylin/eosin-stained for morphological studies.
Immunohistochemistry
Sections were heated in a microwave oven at 750 watts twice for 4 min each time to retrieve the antigen sites. The sections were additionally permeabilized with PBS- 0.1%Triton and incubated for 1 h at room temperature with universal blocking reagent (BioGenex, San Ramon, CA) and then overnight at 4 C with a commercial polyclonal antihuman thyroglobulin antibody (DakoCytomation, Carpinteria, CA) diluted 1:5000. Staining procedures and chromogenic reactions were carried out according to the protocols of the Super Sensitive Concentrated Detection System for alkaline phosphatase labeling (BioGenex) and Fast Red (Sigma Fast, Sigma-Aldrich Corp., St. Louis, MO). Sections were counterstained with hemalum. Control experiments were performed using a commercial mixture of mouse IgG1, IgG2a, IgG2b, IgG3, and IgM (DakoCytomation) instead of the primary antibody.
 |
Results
|
|---|
PAX8
At CS14, the PAX8 gene was strongly expressed in the median thyroid anlage (Fig. 1
, A and B, arrows) and laterally in the ectodermic region of the fourth pharyngeal arch (Fig. 1
, Q and R, arrow). At CS15, PAX8 expression was observed in the median thyroid anlage (Fig. 1
, E and F), the thyroglossal duct cells (Fig. 1F
, arrowhead), and laterally in a deeper cell population that is consistent with the ultimobranchial body (Fig. 1
, S and T, arrow). At CS19, after fusion of median and lateral components, the developing thyroid continued to strongly express PAX8 (Fig. 1
, I and J). This signal persisted in follicular cells at fetal stages (Fig. 1
, M and N).

View larger version (128K):
[in this window]
[in a new window]
|
FIG. 1. Expression of the PAX8, TITF1, and FOXE1 genes during human thyroid gland development. Hematoxylin/eosin-stained sections under brightfield illumination (A, E, I, M, Q, and S) and adjacent hybridized sections under darkfield illumination (BD, FH, JL, NP, R, and T). AD, CS14; sagittal sections through the median thyroid primordium (Th) showing strong PAX8 (arrow, B) and weak TITF1 (arrow, C) expression. FOXE1 expression is not detected. EH, CS15; sagittal sections through median thyroid primordium. PAX8 is strongly expressed in the thyroid primordium (arrow, F) and in the thyroglossal duct cells (arrowhead, F). TITF1 (arrow, G) and FOXE1 (arrow, H) are weakly detected in the thyroid anlage. IL, CS19; sagittal sections through developing thyroid. The three genes are expressed, strongly for PAX8. FOXE1 is also detected in thymus (Thym; L). MP, Eleven weeks of development; transverse sections through fetal thyroid gland showing similar expression levels of the three genes as in thyroid at CS19. Parasagittal sections at CS14 (Q and R) and CS15 (S and T) show PAX8 expression in the fourth pharyngeal arch ectoderm (PA4; arrow, R) and in the ultimobranchial body (arrow, T). Ao, Aorta; H, heart; OV, otic vesicle; Rh, rhombencephalon; To, tongue.
|
|
Outside the thyroid, expression of the PAX8 gene was also observed in the otic vesicle, the central nervous system, and the developing kidney. At CS14, PAX8 transcripts were found in the ventral part of the otic vesicle and in the midbrain-hindbrain boundary (Fig. 2
, A and B, arrowhead and arrow, respectively). At CS15, in addition to the midbrain-hindbrain boundary (Fig. 2
, E and F, arrowhead), PAX8 was expressed in the lateral part of the spinal cord along the rostro-caudal axis (Fig. 2
, E and F, arrow). At CS19, PAX8 expression was observed in the ventral part of the myelencephalon (Fig. 2
, I and J, arrow) and the isthmus, as well as in the dorsal part of the cerebellum anlage (Fig. 2
, IL, * and arrow in L, respectively). In the spinal cord, PAX8 mRNAs were located laterally in the mantle layer of both the alar and the basal plates, next to the neuroepithelial layer (Fig. 2
, M and N, arrows). In the developing kidney, PAX8 transcripts were found in the mesonephros at CS14 (Fig. 2
, C and D), in the metanephric blastema, and weakly in the ureteric bud at CS15 (Fig. 2
, G and H). At CS19, PAX8 was strongly expressed in the condensed mesenchyme (Fig. 2
, O and P, white arrows) and in the ureteric bud giving rise to the collecting duct system (Fig. 2
, O and P, arrowhead), but not at its terminal tips (Fig. 2
, O and P, black arrows). Finally, at 9 wk of development, the highest PAX8 expression was observed in the immature nephrons and in the condensed metanephric blastema, but also in the main collecting ducts (Fig. 2
, Q and R, *). PAX8 transcripts were also observed in the mesonephric ducts and the ureters reaching the bladder (Fig. 2
, S and T).

View larger version (113K):
[in this window]
[in a new window]
|
FIG. 2. PAX8 expression during human development. Hematoxylin/eosin-stained sections under brightfield illumination (A, C, E, G, I, K, M, O, Q, and S) and adjacent hybridized sections under darkfield illumination (B, D, F, H, J, L, N, P, R, and T). At CS14 (AD), PAX8 expression is observed in the otic vesicle (OV; arrowhead, B), the midbrain-hindbrain boundary (arrow, B), and the mesonephros (Msn; C and D). At CS15 (EH), PAX8 expression is observed in midbrain-hindbrain boundary (arrowhead, F) and the spinal cord (Sp; arrows, F and H). In the developing kidney, PAX8 is strongly expressed in the metanephric blastema (Mtn bl; G and H) and is weakly expressed in the ureteric bud (UB; G and H). At CS19 (I and J), PAX8 expression is observed in the myelencephalon (My; arrow, J). K and L, Magnifications of the region boxed in I where PAX8 is detected in the ventral region of the isthmus (Is; *, L) and cerebellum (Cer; arrow, L). It is also expressed in the lateral borders of the neuroepithelial layer of the spinal cord (M; arrows, N). At CS19 (O and P), PAX8 is highly expressed in the condensed mesenchyme of the metanephros (Mtn; white arrows, P). It is weakly expressed in the ureteric bud (arrowheads, P), but is absent at its terminal tips (black arrows, O). PAX8 expression is maintained in the mesonephros. In fetal kidney (K) at 9 wk of development (QT), PAX8 is highly expressed in developing nephrons (mesenchyme undergoing epithelialization), in S-shaped bodies, and also in the collecting system (*, R), but not at the terminal tips. The ureter (U) arriving at the bladder (Bl) expresses PAX8. Ad, Adrenal; G, gonad; H, heart; Li, liver; Mes, mesencephalon; PA, pharyngeal arches; Pro, prosencephalon; Rh, rhombencephalon; To, tongue; V, vertebral column.
|
|
TITF1
At CS14 and CS15, the TITF1 gene was weakly expressed in the median thyroid primordium (Fig. 1
, C and G, arrows). This expression was also observed when the thyroid gland had reached its final position at CS19 (Fig. 1K
) as well as in the fetal gland (Fig. 1O
).
In addition to thyroid expression, TITF1 was detected in the forebrain and the lung. At CS15, TITF1 was strongly expressed in the ventral forebrain, the diencephalon, and the nearby telencephalon (Fig. 3
, A and B, arrows). At CS19, TITF1 expression in the ventral diencephalon was located in the hypothalamic floor and the infundibulum (Fig. 3
, C and D, arrowhead), whereas the expression in the telencephalon corresponded to the developing basal ganglia territory (Fig. 3
, C and D, arrow). During lung development, TITF1 was detected in the lung bud at CS14 (Fig. 3
, E and F, arrowhead). At CS19, when the primary bronchi undergo dichotomous divisions as they grow into the surrounding splanchnic mesenchyme, TITF1 was expressed in the primary bronchi epithelia (Fig. 3
, G and H, arrows), whereas at 9 wk of development only the alveolar primordia epithelium retained TITF1 expression (Fig. 3
, I and J).

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 3. TITF1 and FOXE1 gene expression during human development. A and B, At CS15, in sagittal sections TITF1 transcripts are clearly found in the ventral part of the prosencephalon (Pro). At CS19 (C and D), TITF1 hybridization signal is detected in the ventral diencephalon (Di; arrowhead, D), and in the nearby telencephalon (Tel; arrow, D). EL, TITF1 expression is observed in the lung bud at CS14 (LB; arrowhead, F) and in the lung epithelium at CS19 (arrows, H). At 9 wk of development, sections through the lung show that TITF1 is expressed only in the epithelium of the most recently formed branches. FOXE1 expression is detected in thyroid (Th) and thymus (Thym) at CS19 (K and L). A faint signal is present in the thin layer of the oropharyngeal epithelium (arrows, L). At 11 wk of development (M and N), FOXE1 is detected in the tracheal (Tr; arrowhead, N) and esophageal (E; arrow, N) epithelia. H, Heart; Li, liver; M, mandible; Mes, mesencephalon; Met, metencephalon; My, myelencephalon; Pal, palate; R, Rathkes pouch; Rh, rhomboencephalon; Sp, spinal cord; To, tongue; V, vertebral column.
|
|
FOXE1
Among the three genes studied, FOXE1 showed the weakest hybridization signal. It was first expressed at CS15 in the thyroid primordium (Fig. 1
, D and H, arrow) and then persisted in the thyroid gland throughout development (Fig. 1
, L and P).
Outside the thyroid, FOXE1 signal, at CS19, was detected in the thymus (Fig. 1L
and Fig. 3
, K and L) and weakly in the oropharyngeal epithelium (Fig. 3L
, arrows). At 11 wk of development, a weak FOXE1 signal was observed in the tracheal and esophageal epithelium (Fig. 3
, M and N, arrowhead and arrow, respectively).
For all three genes, comparison of sense (data not shown) and antisense hybridization signals allowed specific signal detection from background.
Thyroglobulin
The thyroglobulin protein was not detected during early thyroid organogenesis and migration at CS15 (Fig. 4
, A and B). It was first detected when the thyroid had reached its final position in front of the trachea at CS19 (Fig. 4
, C and D). Thyroglobulin was still found at 11 wk of development in the thyroid gland (Fig. 4
, E and F).

View larger version (140K):
[in this window]
[in a new window]
|
FIG. 4. Thyroglobulin production during human thyroid gland development. Hemalum-stained sections under brightfield illumination with the control of mouse Igs (A, C, and E) and adjacent sections with polyclonal antihuman thyroglobulin antibody (B, D, and F). A and B, CS15; sagittal sections through the median thyroid primordium (Th) showing no thyroglobulin production. C and D, CS19; sagittal sections through developing thyroid. The thyroglobulin protein is detected in the thyroid gland as well as in the remnant located in the migration track. E and F, Eleven weeks of development; transverse sections through the fetal thyroid gland producing thyroglobulin. H, Heart; Thym, thymus; To, tongue.
|
|
 |
Discussion
|
|---|
Thyroid expression of PAX8, TITF1, and FOXE1 during development supports their direct implication in TD when mutated and accounts for the associated malformations. Comparison of the expression patterns of the three genes during murine and human development highlights some differences that are summarized in Table 2
.
The first difference observed between human and murine thyroid development concerns the time course of FOXE1 gene expression. In mice, titf1 and titf2 are expressed as early as E8.5 in the floor of the foregut before budding of the median thyroid anlage, whereas pax8 is expressed in the area of thyroid evagination on E10.5 (8, 9). At the earliest stages of human development studied (CS14), the median thyroid primordium starts to migrate caudally, analogous to E10.5 in mouse development. Both the PAX8 and TITF1 genes were expressed in the migrating primordium, whereas FOXE1 transcripts were detected only at the CS15 stage and not as early as expected from mouse data. The human thyroglobulin promoter contains three binding sites for TITF1, one for PAX8, and one for FOXE1 (19). Nevertheless, thyroglobulin is produced only once the thyroid gland has reached its final position, as described for the mouse, suggesting that additional mechanisms exist to regulate the expression of thyroid-specific genes. The second difference concerns the expression domains of TITF1 and PAX8. In the mouse, titf1 is expressed in the fourth pharyngeal pouch, giving rise to parafollicular cells. C Cells still express titf1 in the mature thyroid gland (7, 10). In the human, no TITF1 expression, but PAX8 expression, was observed at the surface ectoderm of the fourth pharyngeal pouch, followed shortly thereafter by expression in an inner structure consistent with the ultimobranchial body.
Experimental data in the chick and mouse have demonstrated that neural crest cells colonize the ultimobranchial body during development, giving rise to C cells, and it has been assumed that the same would be true in all mammals (20, 21, 22). Merida-Velasco et al. (23) suggested that in human embryos, the ultimobranchial body is colonized at CS15 by cells of ectodermic origin, arising from the posterior margin of the fourth pharyngeal cleft. Indeed, at CS14 we observed PAX8 expression in the surface ectoderm of the fourth pharyngeal arch and at CS15 in a deeper cell population, corresponding presumably to the ultimobranchial body. These results add additional evidence to the possible contribution of ectodermic cells to the ultimobranchial body.
The PAX8 gene has been implicated in the development and maintenance of the follicular cell phenotype by activating thyroperoxidase, sodium/iodide symporter, and thyroglobulin genes without apparent effect on C cell development (10, 24). Whether follicular cells also originate from the ultimobranchial body is still debated. Thyroglobulin-containing follicles have been identified in the ultimobranchial body-derived structures of the dog (25, 26). In addition, cases of lateral ectopic thyroid or lateral thyroidal cysts with follicles support the premise that some thyroid follicular cells may derive from the ultimobranchial body in humans (27, 28). PAX8 expression in the ultimobranchial body observed in our study adds to the view that the lateral primordia may produce thyroid follicular cells in humans.
During normal development, the thyroglossal duct disappears, but remnants may persist and form cysts anywhere along the course of thyroid migration. Histological studies of these remnants show that follicles and colloid are often present (29, 30, 31). The PAX8 gene expression observed in the thyroglossal duct cells suggests that this structure represents a cellular track left by the migrating thyroid anlage rather than a preestablished pathway for thyroid migration, and its expression may explain the capacity of these cells to differentiate into follicular cells.
The expression pattern of the PAX8 gene in the central nervous system is similar to that observed in the mouse, i.e. restricted to the midbrain-hindbrain boundary, then to the myelencephalon and the spinal cord (8). However, neither homozygous pax8/ mice nor humans with heterozygous PAX8 mutations have been reported to show a central nervous system defect. This could be due to the redundancy of another gene of the same family, PAX2, which is similarly expressed in the central nervous system during both mouse and human development (32, 33, 34, 35). In addition to being expressed in the condensed mesenchyme of the developing kidney, human PAX8 is expressed in the mesonephric duct, the ureteric bud, and the collecting ducts (but not at their tips). This is different from what has been described in the mouse, where pax8 expression has never been observed in the Wolffian duct or in the ureteric bud or its derivatives (8). Kidney malformations are not classically associated with PAX8 mutations. Yet, two TD patients with either unilateral renal agenesis or left-sided uretero-pelvic obstruction, respectively, were found to carry a heterozygous PAX8 mutation (36). It is worth noting that this pattern of malformations is consistent with the human-specific pattern of PAX8 expression in the ureter and pelvis. It is likely, therefore, that renal malformations associated with TD could be underestimated, because no systematic renal studies have been performed in patients with TD. If confirmed, the presence of renal anomalies would be highly suggestive of PAX8 involvement in TD. Finally, no PAX8 homozygous mutations have been reported in humans. Such homozygous mutations could lead to a severe or lethal phenotype (e.g. bilateral renal agenesis), as described for other PAX genes (37, 38) (Ayme, S., and N. Philip, unpublished observations).
In humans and rats, TITF1 transcripts are detected during lung development. TITF1 is first expressed in epithelial cells and becomes progressively restricted to distal branches. No TITF1 expression is detected in main bronchial epithelial cells or in the proximal respiratory compartments of the fetal lung. This expression pattern is consistent with that described during rat development and in human fetal stages (7, 39). The expression of TITF1 in the distal part of the lung is also consistent with its role in surfactant production and regulation and explains the postnatal respiratory distress syndrome in patients bearing a TITF1 mutation (14, 40). TITF1 gene expression is also observed in the ventral part of the forebrain. In the diencephalon, its expression is restricted to the hypothalamic area and then to the infundibulum. In the telencephalic floor, the signal is observed in an area corresponding to the developing striatum and the paleostriatum, as previously described (7, 9, 41). Hypotonia and dyskinesia associated with changes in the basal ganglia and pituitary in patients with TITF1 mutations are consistent with the expression pattern of TITF1 in the central nervous system (14, 39, 42).
During human development, a barely detectable FOXE1 signal was observed in the pharyngeal epithelium and later in the tracheal and esophageal epithelium. In the mouse, titf2 is also weakly expressed in the foregut endoderm and the visceral epithelium of pharyngeal arches (6, 9). However, the FOXE1 expression pattern is consistent with the malformations associated with FOXE1 mutations (6, 12). Indeed, both knockout mice and four reported patients with a FOXE1 mutation displayed TD and cleft palate (13, 43). In addition, FOXE1 mRNAs were detected in the human thymus, as previously described (44), but no abnormal thymus or immunodeficiency has been reported in the rare patients carrying a FOXE1 mutation. An immunological analysis of these patients should allow evaluation of the biological significance of FOXE1 expression in the thymus.
In conclusion, the present study of PAX8, TITF1, and FOXE1 gene expression during human development sheds new light on thyroid development and on the impact of mutations in these genes. This study also highlights the differences in gene expression between species. Indeed, PAX8 is expressed in all territories that may give rise to thyroid follicular cells and in the ultimobranchial bodies, adding support to the contribution of this structure to the follicular cell population. At variance with the mouse gene, PAX8 was expressed in the ureteric bud and some derivatives, suggesting that patients with a PAX8 mutation should be screened for kidney malformations. Also at variance with the mouse gene, TITF1 expression was not detected in the pharyngeal arches, and human FOXE1 expression in the thyroid anlage was observed later than that in the mouse and was present in the thymus. Finally, the expression patterns of the three genes correlate well with the phenotypes observed in patients carrying mutations of the corresponding gene.
 |
Acknowledgments
|
|---|
We thank Marie-Claire Gubler and Féréchté Encha-Razavi for helpful discussions. We are grateful to Guy Van Vliet and Arnold Munnich for comments and suggestions about the manuscript.
 |
Footnotes
|
|---|
This work was supported by Association Française pour le Dépistage et la Prévention des Handicaps de lEnfant, Hoechst-Marion-Roussel, and EURExpress. S.S.T. is supported by a Convention Industrielle de Formation par la Recherche grant in collaboration with HRA Pharma directed by Dr. André Ulmann and the Ministère de lEducation Nationale de la Recherche et de la Technologie.
First Published Online October 19, 2004
Abbreviations: CH, Congenital hypothyroidism; CS, Carnegie staging; E15.5, embryonic d 15.5; TD, thyroid dysgenesis.
Received July 13, 2004.
Accepted October 11, 2004.
 |
References
|
|---|
- Toublanc JE 1992 Comparaison of epidemiological data on congenital hypothyroidism in Europe with those of other parts in the world. Horm Res 38:230235[Medline]
- Castanet M, Lyonnet S, Bonaïti-Pellié C, Polak M, Czernichow P, Léger J 2000 Familial forms of thyroid dysgenesis among infants with congenital hypothyroidism. N Engl J Med 343:441442[Free Full Text]
- Castanet M, Polak M, Bonaïti-Pellié C, Lyonnet S, Czernichow P, Léger J 2001 Nineteen years of national screening for congenital hypothyroidism: familial cases with thyroid dysgenesis suggest the involvement of genetic factors. J Clin Endocrinol Metab 86:20092014[Abstract/Free Full Text]
- Léger J, Marinovic D, Garel C, Bonaïti-Pellié C, Polak M, Czernichow P 2002 Thyroid developmental anomalies in first degree relatives of children with congenital hypothyroidism. J Clin Endocrinol Metab 87:575580[Abstract/Free Full Text]
- Hoyes AD, Kershaw DR 1985 Anatomy and development of the thyroid gland. Ear Nose Throat J 64:318333[Medline]
- Dathan N, Parlato R, Rosica A, De Felice M, Di Lauro R 2002 Distribution of the titf2/foxe1 gene product is consistent with an important role in the development of foregut endoderm, palate, and hair. Dev Dyn 224:450456[CrossRef][Medline]
- Lazzaro D, Price M, De Felice M, Di Lauro R 1991 The transcription factor TTF-1 is expressed at the onset of thyroid and lung morphogenesis and in restricted regions of the foetal brain. Development 113:10931104[Abstract]
- Plachov D, Chowdhury K, Walther C, Simon D, Guenet JL, Gruss P 1990 Pax8, a murine paired box gene expressed in the developing excretory system and thyroid gland. Development 110:643651[Abstract/Free Full Text]
- Zannini M, Avantaggiato V, Biffali E, Arnone MI, Sato K, Pischetola M, Taylor BA, Phillips SJ, Simeone A, Di Lauro R 1997 TTF-2, a new Forkhead protein, shows a temporal expression in the developing thyroid which is consistent with a role in controlling the onset of the differentiation. EMBO J 16:31853197[CrossRef][Medline]
- Mansouri A, Chowdhury K, Gruss P 1998 Follicular cells of the thyroid gland require Pax8 gene function. Nat Genet 19:8790[CrossRef][Medline]
- Kimura S, Hara Y, Pineau T, Fernandez-Salguero P, Fox CH, Ward JM, Gonzalez FJ 1996 The T/ebp null mouse: thyroid-specific enhancer-binding protein is essential for the organogenesis of the thyroid, lung, and ventral forebrain. Genes Dev 10:6069[Abstract/Free Full Text]
- De Felice M, Ovitt C, Biffali E, Rodriguez-Mallon A, Arra C, Anastassiadis K, Macchia PE, Mattei MG, Mariano A, Schöler H, Macchia V, Di Lauro R 1998 A mouse model for hereditary thyroid dysgenesis and cleft palate. Nat Genet 19:395398[CrossRef][Medline]
- Clifton-Bligh R, Wentworth JM, Heinz P, Crisp MS, John R, Lazarus JH, Ludgate M, Chatterjee K 1998 Mutation of the gene encoding human TTF-2 associated with thyroid agenesis, cleft palate and choanal atresia. Nat Genet 19:399401[CrossRef][Medline]
- Krude H, Schuetz B, Biebermann H, von Moers A, Schnabel D, Neitzel H, Tönnies H, Weise D, Lafferty A, Schwarz S, De Felice M, von Deimling A, van Landeghem F, Di Lauro R, Grüters A 2002 Choreoathetosis, Hypothyroidism, and pulmonary alterations due to human NKX2.1 haploinsufficiency. J Clin Invest 109:475480[CrossRef][Medline]
- Macchia PE, Lapi P, Krude H, Pirro MT, Missero C, Chiovato L, Souabni A, Baserga M, Tassi V, Pinchera A, Fenzi G, Grüters A, Busslinger M, Di Lauro R 1998 Pax8 mutations associated with congenital hypothyroidism caused by thyroid dysgenesis. Nat Genet 19:8386[CrossRef][Medline]
- ORahilly R, Müller F 1987 Developmental stages in human embryos. Washington DC: Carnegie Institution of Washington
- Crosnier C, Attie-Bitach T, Encha-Razavi F, Audollent S, Soudy F, Hadchouel M, Meunier-Rotival M, Vekemans M 2000 JAGGED1 gene expression during human embryogenesis elucidates the wide phenotypic spectrum of Alagille syndrome. Hepatology 32:574581[CrossRef][Medline]
- Wilkinson DG 1992 In situ hybridization: a practical approach. Oxford, UK: IRL Press
- Kambe F, Seo H 1997 Thyroid-specific transcription factors. Endocr J 44:775784[Medline]
- Le Douarin N, Le Lievre C 1970 Embryologie experimentale: demonstration de lorigine neurale des cellules a calcitonine du corps ultimobranchial chez lembryon de poulet. C R Hebd Seances Acad Sci D 270:28572860
- Pearse AG, Polak JM 1971 Cytochemical evidence for the neural crest origin of mammalian ultimobranchial C cells. Histochemie 27:96102[CrossRef][Medline]
- Polak JM, Pearse AG, Le Lievre C, Fontaine J, Le Douarin NM 1974 Immunocytochemical confirmation of the neural crest origin of avian calcitonin-producing cells. Histochemistry 40:209214[CrossRef][Medline]
- Merida-Velasco JA, Garcia-Garcia JD, Espin-Ferra J, Linares J 1989 Origin of the ultimobranchial body and its colonizing cells in human embryos. Acta Anat 136:325330[Medline]
- Pasca di Magliano M, Di Lauro R, Zannini M 2000 Pax8 has a key role in thyroid cell differentiation. Proc Natl Acad Sci USA 97:1314413149[Abstract/Free Full Text]
- Kameda Y, Ikeda A 1980 Immunohistochemical study of the C-cell complex of dog thyroid glands with reference to the reactions of calcitonin, C-thyroglobulin and 19S thyroglobulin. Cell Tissue Res 208:405415[Medline]
- Kameda Y, Shigemoto H, Ikeda A 1980 Development and cytodifferentiation of C cell complexes in dog fetal thyroids. An immunohistochemical study using anti-calcitonin, anti-C-thyroglobulin and anti-19S thyroglobulin antisera. Cell Tissue Res 206:403415[Medline]
- Kumar R, Gupta R, Bal CS, Khullar S, Malhotra A 2000 Thyrotoxicosis in a patient with submandibular thyroid. Thyroid 10:363365[Medline]
- Williams ED, Toyn CE, Harach HR 1989 The ultimobranchial gland and congenital thyroid abnormalities in man. J Pathol 159:135141[CrossRef][Medline]
- Chandra RK, Maddalozzo J, Kovarik P 2001 Histological characterization of the thyroglossal tract: implications for surgical management. Laryngoscope 111:10021005[CrossRef][Medline]
- Johnson IJ, Smith I, Akintunde MO, Robson AK, Stafford FW 1996 Assessment of pre-operative investigations of thyroglossal cysts. J R Coll Surg Edinb 41:4849[Medline]
- Sprinzl GM, Koebke J, Wimmers-Klick J, Eckel HE, Thumfart WF 2000 Morphology of the human thyroglossal tract: a histologic and macroscopic study in infants and children. Ann Otol Rhinol Laryngol 109:11351139[Medline]
- Dressler GR, Deutsch U, Chowdhury K, Nornes HO, Gruss P 1990 Pax2, a new murine paired-box-containing gene and its expression in the developing excretory system. Development 109:787795[Abstract/Free Full Text]
- Nornes HO, Dressler GR, Knapik EW, Deutsch U, Gruss P 1990 Spatially and temporally restricted expression of Pax2 during murine neurogenesis. Development 109:797809[Abstract/Free Full Text]
- Tellier AL, Amiel J, Delezoide AL, Audollent S, Auge J, Esnault D, Encha-Razavi F, Munnich A, Lyonnet S, Vekemans M, Attie-Bitach T 2000 Expression of the PAX2 gene in human embryos and exclusion in the CHARGE syndrome. Am J Med Genet 93:8588[CrossRef][Medline]
- Terzic J, Muller C, Gajovic S, Saraga-Babic M 1998 Expression of PAX2 gene during human development. Int J Dev Biol 42:701707[Medline]
- Krude H, Macchia PE, Di Lauro R, Grüters A, Familial hypothyroidism due to thyroid dysgenesis caused by dominant mutations of the PAX8 gene. Proc of the 37th Annual Meeting of the European Society for Paediatric Endocrinology, Florence, Italy, 1998, p 043
- Ayme S, Philip N 1995 Possible homozygous Waardenburg syndrome in a fetus with exencephaly. Am J Med Genet 59:263265[CrossRef][Medline]
- Glaser T, Jepeal L, Edwards JG, Young SR, Favor J, Maas RL 1994 PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat Genet 7:463471[CrossRef][Medline]
- Ikeda K, Clark JC, Shaw-White JR, Stahlman MT, Boutell CJ, Whitsett JA 1995 Gene structure and expression of human thyroid transcription factor-1 in respiratory epithelial cells. J Biol Chem 270:81088114[Abstract/Free Full Text]
- Pohlenz J, Dumitrescu A, Zundel D, Martiné U, Schönberger W, Koo E, Weiss RE, Cohen RN, Kimura S, Refetoff S 2002 Partial deficiency of thyroid transcription factor 1 produces predominantly neurological defects in humans and mice. J Clin Invest 109:469473[CrossRef][Medline]
- Sussel L, Marin O, Kimura S, Rubenstein JL 1999 Loss of Nkx2.1 homeobox gene function results in a ventral to dorsal molecular respecification within the basal telencephalon: evidence for a transformation of the pallidum into the striatum. Development 126:33593370[Abstract]
- Breedveld GJ, van Dongen JW, Danesino C, Guala A, Percy AK, Dure LS, Harper P, Lazarou LP, van der Linde H, Joosse M, Gruters A, MacDonald ME, de Vries BB, Arts WF, Oostra BA, Krude H, Heutink P 2002 Mutations in TITF-1 are associated with benign hereditary chorea. Hum Mol Genet 11:971979[Abstract/Free Full Text]
- Castanet M, Park SM, Smith A, Bost M, Léger J, Lyonnet S, Pelet A, Czernichow P, Chatterjee K, Polak M 2002 A novel loss-of-function mutation in TTF-2 is associated with congenital hypothyroidism, thyroid agenesis, and cleft palate. Hum Mol Genet 11:20512059[Abstract/Free Full Text]
- Chadwick BP, Obermayr F, Frischauf AM 1997 FKHL15: a new human member of the forkhead gene family located on chromosome 9q22. Genomics 41:390396[CrossRef][Medline]
- Larsen WJ 1997 Human embryology: development of the head, the neck, and the eyes and ears, 2nd Ed. New York: Churchill Livingston; 335339
- ORahilly R 1983 The timing and sequence of events in the development of the human endocrine system during the embryonic period proper. Anat Embryol 166:439451[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
L. M. Moreno, M. A. Mansilla, S. A. Bullard, M. E. Cooper, T. D. Busch, J. Machida, M. K. Johnson, D. Brauer, K. Krahn, S. Daack-Hirsch, et al.
FOXE1 association with both isolated cleft lip with or without cleft palate, and isolated cleft palate
Hum. Mol. Genet.,
December 15, 2009;
18(24):
4879 - 4896.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Carre, G. Szinnai, M. Castanet, S. Sura-Trueba, E. Tron, I. Broutin-L'Hermite, P. Barat, C. Goizet, D. Lacombe, M.-L. Moutard, et al.
Five new TTF1/NKX2.1 mutations in brain-lung-thyroid syndrome: rescue by PAX8 synergism in one case
Hum. Mol. Genet.,
June 15, 2009;
18(12):
2266 - 2276.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Zighelboim, P. J. Goodfellow, A. P. Schmidt, K. C. Walls, M. A. Mallon, D. G. Mutch, P. S. Yan, T. H.-M. Huang, and M. A. Powell
Differential Methylation Hybridization Array of Endometrial Cancers Reveals Two Novel Cancer-Specific Methylation Markers
Clin. Cancer Res.,
May 15, 2007;
13(10):
2882 - 2889.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Denham, B. J. Conley, F. Olsson, L. Gulluyan, T. J. Cole, and R. Mollard
A murine respiratory-inducing niche displays variable efficiency across human and mouse embryonic stem cell species
Am J Physiol Lung Cell Mol Physiol,
May 1, 2007;
292(5):
L1241 - L1247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Mittag, E. Winterhager, K. Bauer, and R. Grummer
Congenital Hypothyroid Female Pax8-Deficient Mice Are Infertile Despite Thyroid Hormone Replacement Therapy
Endocrinology,
February 1, 2007;
148(2):
719 - 725.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Szinnai, L. Lacroix, A. Carre, F. Guimiot, M. Talbot, J. Martinovic, A.-L. Delezoide, M. Vekemans, S. Michiels, B. Caillou, et al.
Sodium/Iodide Symporter (NIS) Gene Expression Is the Limiting Step for the Onset of Thyroid Function in the Human Fetus
J. Clin. Endocrinol. Metab.,
January 1, 2007;
92(1):
70 - 76.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Moya, G. Perez de Nanclares, L. Castano, N. Potau, J. R. Bilbao, A. Carrascosa, M. Bargada, R. Coya, P. Martul, E. Vicens-Calvet, et al.
Functional Study of a Novel Single Deletion in the TITF1/NKX2.1 Homeobox Gene That Produces Congenital Hypothyroidism and Benign Chorea But Not Pulmonary Distress
J. Clin. Endocrinol. Metab.,
May 1, 2006;
91(5):
1832 - 1841.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. Watkins, S. E. Harris, M. J. Craven, A. L. Vincent, I. M. Winship, K. Gersak, and A. N. Shelling
An investigation into FOXE1 polyalanine tract length in premature ovarian failure
Mol. Hum. Reprod.,
March 1, 2006;
12(3):
145 - 149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D Sanlaville, H C Etchevers, M Gonzales, J Martinovic, M Clement-Ziza, A-L Delezoide, M-C Aubry, A Pelet, S Chemouny, C Cruaud, et al.
Phenotypic spectrum of CHARGE syndrome in fetuses with CHD7 truncating mutations correlates with expression during human development
J. Med. Genet.,
March 1, 2006;
43(3):
211 - 317.
[Abstract]
[Full Text]
[PDF]
|
 |
|