help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2004-0277
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Terzidou, V.
Right arrow Articles by Johnson, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Terzidou, V.
Right arrow Articles by Johnson, M. R.
Related Collections
Right arrow Female Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 1 237-246
Copyright © 2005 by The Endocrine Society

Mechanical Stretch Up-Regulates the Human Oxytocin Receptor in Primary Human Uterine Myocytes

Vasso Terzidou, Suren R. Sooranna, Louise U. Kim, Steve Thornton, Phillip R. Bennett and Mark R. Johnson

Imperial College Parturition Research Group (V.T., P.R.B.), Institute of Reproductive and Developmental Biology, Hammersmith Hospital Campus, London W12 0NN, United Kingdom; Department of Obstetrics and Gynaecology (S.R.S., L.U.K., M.R.J.), Imperial College School of Medicine, Chelsea and Westminster Hospital, London SW10 9NH, United Kingdom; and Department of Biological Sciences (S.T.), University of Warwick, Coventry CV4 7AL, United Kingdom

Address all correspondence and requests for reprints to: Dr. Mark R. Johnson, Department of Obstetrics and Gynaecology, Chelsea and Westminster Hospital, 369 Fulham Road, London SW10 9NH, United Kingdom. E-mail: mark.johnson{at}imperial.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Oxytocin receptor (OTR) expression is increased before the onset of labor in all models of parturition. However, the mechanisms responsible for the increase in OTR expression are uncertain. Animal data suggest that uterine stretch increases OTR mRNA expression. In primary cultures of human uterine smooth muscle cells obtained from nonpregnant (NP) women and pregnant women before (NL) and after (L) the onset of labor, we investigated the effect of stretch on the expression of OTR mRNA and DNA binding of activator protein-1 (AP-1), CCAAT/enhancer binding protein (C/EBP)ß, and nuclear factor-{kappa}B transcription factors. OTR expression was least in NL, intermediate in NP, and greatest in L cells. Stretch of NL cells resulted in up-regulation of OTR mRNA expression associated with increased OTR gene promoter activity. Stretch of NP and L cells did not affect OTR mRNA expression. The increased promoter activity was associated with increased DNA binding of C/EBP and AP-1 but not nuclear factor-{kappa}B transcription factors. Overexpression of C/EBP, but not AP-1, increased OTR promoter activity. We conclude that stretch of NL cells results in increased OTR mRNA expression probably through increased C/EBPß DNA binding. These data suggest that stretch contributes to the massive increase in OTR expression before the onset of human labor.


    Introduction
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
DURING PREGNANCY THE uterus increases in size by hyperplasia and hypertrophy to accommodate the growing fetus, placenta, and amniotic fluid. Before the onset of labor, the myometrium remains quiescent and the cervix rigid and closed. At the end of pregnancy, the myometrium begins to contract and there is remodeling of the cervix. The contractions are initially irregular and weak, but with the onset of labor, they become coordinated and stronger. Three lines of evidence suggest a role for the oxytocin/oxytocin receptor (OT/OTR) system in the regulation of myometrial contractility: 1) concentrations of OTR increase before the onset of labor, 2) infusions of OT stimulate myometrial contractions such that they are indistinguishable from those of normal labor, and 3) OTR antagonists disrupt the normal pattern of labor (1, 2). A marked increase in OTR mRNA and protein is one of the most consistent findings in all models of parturition. In the human, there is a greater than 300-fold increase in myometrial OTR mRNA expression, compared with the nonpregnant uterus (3, 4). However, the mechanisms regulating myometrial OTR expression in the human remain largely undefined.

The OTR is a cell surface membrane receptor with seven transmembrane domains that belongs to the class I G protein-coupled receptor family. The OTR gene encodes 389 amino acids and is present as a single copy in the human genome mapped to the gene locus 3p25–3p26.2. The gene spans 17 kb and contains three introns and four exons. Deletion experiments show that approximately 1000 bp upstream of the coding region are needed for expression of the OTR gene (5). It has long been thought that the OTR is up-regulated by estrogen and down-regulated by progesterone. The human OTR promoter does not, however, contain any full consensus progesterone or estrogen response elements (EREs), and there is no evidence of a direct action of either steroid on OTR gene promoter. However, the OTR promoter does contain eleven putative CCAAT/enhancer binding protein (C/EBP), three nuclear factor-{kappa}B (NF-{kappa}B), and five activator protein-1 (AP-1) transcription factor binding sites, raising the possibility that these transcription factors may be important in OTR gene expression. More recently two regions, termed US-1 and US-2, have been identified by differential protein-DNA binding analysis, which may be involved in the up-regulation of the OTR gene in human myometrium at term (6).

In animals with a double uterus, it is possible to differentiate the effect of endocrine and mechanical signals on gene expression. Parry et al. (7) originally reported that in the tammar wallaby, the expression of the mesotocin receptor (MTR), the wallaby equivalent of OTR, increased only in the pregnant, but not nonpregnant, uterus at term. These data were supported by the findings in the rat and sheep (8, 9). This suggests that OTR mRNA expression is increased by mechanical stretch and that this may explain the high rate of preterm labor in clinical conditions, such as polyhydramnios, multiple pregnancy, and singleton pregnancies with fetal macrosomia (10, 11, 12). Manabe et al. (13, 14) showed that abortion in the second trimester and labor at term can be induced by mechanical distension of the uterus. Mechanical stretch of rat uterine smooth muscle cells has been associated with increased c-fos expression (15, 16). Stretch of human airway smooth muscle cells increased IL-8 expression in a C/EBP- and AP-1-dependent mechanism (17) and stretch of endothelial cells increases IL-6 in an NF-{kappa}B-dependent mechanism (18).

Stretch may be constant, as might be expected during pregnancy, or episodic, as at the time of labor. In these studies, we modeled stretch during pregnancy and consequently used constant rather than episodic stretch. We investigated the effect of mechanical stretch on the expression of human OTR in primary human myocytes and OTR promoter activity. We also examined the effect of stretch on DNA binding of the transcription factors C/EBP, NF-{kappa}B, and AP-1.


    Patients and Methods
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Patient selection

Approval for the collection of myometrial biopsies was obtained from the regional ethics committee. Fully informed written consent was sought from all patients participating in the study. Tissue was obtained from three groups of women: those undergoing hysterectomy for a benign indication and those undergoing cesarean section both before and after the onset of labor.

Tissue specimens

Biopsies (0.5 x 0.5 cm3) of term human myometrium were collected at the time of cesarean section from women not in labor (NL, n = 6), during active labor (L, n = 6), and from hysterectomy (NP, n = 6) in DMEM medium containing 100 mU/ml penicillin and 100 µg/ml streptomycin. Samples were stored at 4 C for no more than 3 h before cell preparation for culture. Tissue from cesarean section was removed from the upper margin of the incision made in the lower segment of the uterus. Mean maternal age [NL = 31 median (range 26–37); L = 30 (27–40); and NP = 42 (39–47) yr] and gestational age [NL = 39 (38 wk and 3d to 39 wk and 2d) and L = 38 + 5 (37 wk to 40 wk and 4d) wk] did not differ significantly. The indications for lower segment cesarean section in labor group were slow labor, fetal distress, and breech presentation, and in the nonlabor group, previous lower segment cesarean section, breech presentation, and maternal request.

Cell culture

Tissue samples were minced and digested for 45 min in a solution of DMEM (Sigma, Poole, UK) with 1 mg/ml collagenase types IA and XI (Sigma). The resulting suspension was then passed through a cell strainer and individual cells were collected by centrifugation at 400 x g for 10 min. After washing, cells were grown in DMEM with supplementation of 10% fetal calf serum, L-glutamine, and penicillin-streptomycin at 37 C and 5% CO2. Myometrial cells used were between second and fourth passage.

Flexercell tension system

To investigate the effect of mechanical stretch on OTR gene expression and OTR promoter activity, primary human myometrial cells were cultured on 6-well flexible-bottomed plates precoated with collagen I. The Flexercell Tension PlusT, FX-4000T (Flexcell International Corp., McKeesport, PA) is a computer-driven instrument that simulates biological strain conditions using a vacuum to deform cells cultured on a plastic, flexible, collagen type I-bonded growth surface 6-well plastic culture plate. The FX-4000T was developed to provide a mechanical load to cells cultured in vitro, and by applying increasing vacuum strength, it is possible to increase the surface area of attached cells and hence give varying amounts of stretch (percentages of prestretch size). We used a continuous model of stretch as seen in pregnancy in which there is a progressive increase in tension across the uterine wall. This probably builds up more rapidly at the end of pregnancy as the uterus reaches the limit of its ability to stretch and gene transcription is induced once the tension surpasses a threshold.

Before mechanical stretch, cells were serum starved for 16 h. Cells from the NP, NL, and L groups (n = 6 each) were then exposed to 6–16% static stretch for 1 h, and cells from the NL group (n = 6 each) were exposed to 6–16% static stretch for 6 h also. EMSA and transfection studies were performed only at +11 and +16% stretch for 6 h and transfection studies at +16% for 6 h based on our previous results (19). More than 99% of cells remained attached to the 6-well culture plates after stretch protocols, and these cells were frozen in liquid nitrogen for extraction of RNA or precipitated with protein extraction buffer for cytosolic and nuclear extracts.

Quantitative RT-PCR

Total RNA was extracted and purified from myometrial cells using RNeasy minikit (Qiagen Ltd., Crawley, West Sussex, UK). After quantification 1.0 µg was reverse transcribed with oligo dT random primers using Muloney murine leukemia virus reverse transcriptase (Applied Biosystems Ltd., Warrington, Cheshire, UK). Primer sets for OTR and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed and obtained from (Amersham Pharmacia Biotech, Little Chalfont, Bucks, UK).

The OTR sense (5'-GCCTTATCAGCTTCAAGATCTTGG-3') and antisense (5'-CAGGACAAAGGAGGACGAGTTGC-3') and GAPDH sense (5'-TGATGACATCAAGAAGGTGGTGAAG-3') and antisense (5'-TCCTTGGAGGCCATGTGGGCCAT-3') primer sets flanked intron/exon junctions and produced amplicons of the expected size. Assays were validated for all primer sets by confirming that single amplicons of appropriate size and sequence were generated according to predictions. Quantitative PCR was performed in the presence of SYBR Green (Roche Diagnostics Ltd., Lewes, West Sussex, UK), and amplicon yield was monitored during cycling in a LightCycler sequence detector (Roche Diagnostics Ltd.) that continually measures fluorescence caused by the binding of the dye to double-stranded DNA. Pre-PCR cycle was 7 min at 95 C followed by 35 cycles of 95 C for 10 sec, 56–60 C for 10 sec, and 72 C for 10 sec followed by final extension 72 C for 1min. The cycle at which the fluorescence reached a preset threshold (cycle threshold) was used for quantitative analyses. The cycle threshold in each assay was set at a level at which the exponential increase in amplicon abundance was approximately parallel among all samples. All mRNA abundance data were expressed relative to the amount of the constitutively expressed GAPDH. Conventional PCR was also performed using Ampli-Taq Gold DNA polymerase (Applied Biosystems). Pre-PCR cycle was 10 min at 95 C followed by 35 cycles of 95 C for 1 min, 56–60 C for 1 min, and 72 C for 1 min followed by final extension 72 C for 10 min.

Plasmid construction

The OTR-promoter (OTR-PROM) construct was prepared from genomic DNA by PCR using selected sense/antisense primers. The PCR product (1.1 kb) was isolated on an agarose gel (1%), excised, and purified using GFX gel purification columns (Amersham Biosciences, Buckinghamshire, UK). The purified PCR product was then cloned into pGEM-Teasy (Promega, Southampton, UK). The OTR PROM in pGEM-Teasy was used as a template for cloning into the luciferase reporter vector pGL3 (Promega). Restriction enzyme sites for KpnI (at the 5' end) and HindIII (at the 3' end) were introduced by using PCR. The sense primer sequences were GCGCGGTACCAAAGAAGGGGAGGCTTGGT and the antisense GGCCAAGCTTGGTCCCAGAGCCTTAACAAA. The product was then purified and double digested with KpnI/HindIII and inserted into the KpnI/HindIII polylinker restriction site upstream of the luciferase (LUC) reporter gene in the promoterless pGL3-basic vector (Promega). Constructs were confirmed by restriction digests and DNA sequencing.

Expression vectors

Expression vectors for C/EBPß (pSG5 LAP) and AP-1 (pcDNA c-jun and pcDNA c-fos) were kindly provided by Dr. Birgit Gellersen (Institute for Hormone and Fertility Research, University of Hamburg, Hamburg, Germany).

Transient transfections

Myometrial cells were grown in 6-well plates to 80% confluence. Transient transfections were carried out using a liposome-mediated method with Fugene 6 transfection reagent (Roche). The amount of DNA per well and the DNA to Fugene 6 ratios were optimized. Cytomegalovirus (CMV)-Renilla vector was used to control for transfection efficiency. Expression constructs for C/EBPß and AP-1 c-fos and c-jun were all cotransfected at 0.2 µg/well. The empty expression vectors pSG5 and pcDNA were included as filler constructs when required so that the total amount of transfected DNA per well was the same. Cells were cultured for a total of 48 h followed by harvesting and analysis with a dual firefly/Renilla LUC assay [Luclite (Perkin Elmer Life and Analytical Sciences, Inc., Boston, MA) and Coelentrerazin (Merck Biosciences Ltd., Nottingham, UK)]. Transfections were performed in triplicates. Luciferase/Renilla activity was measured 48 h after transfection.

Protein extraction

Monolayer myometrial cells were lysed in buffer containing 10 mM HEPES, 10 mM KCL, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM dithiothreitol (DTT), 1% Nonidet P-40, and Roche complete protease inhibitor tablet (diluted according to manufacturer’s instruction). Cytosolic protein extracts were obtained in the supernatant after centrifugation of the cell lysate for 30 sec at 12,000 x g at 4 C. The pellet was resuspended in buffer containing 10 mM HEPES, 10 mM KCL, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM DTT, 400 mM NaCl, 1% (vol/vol) Nonidet P-40, and a Roche Complete protease inhibitor tablet. Samples were then shaken vigorously for 15 min and submerged in ice bath. Nuclear protein extracts were obtained in the supernatant after centrifugation for 5 min at 12,000 x g at 4 C. Protein concentrations were determined by Bradford assay.

EMSAs

EMSA was carried out by incubating nuclear protein extracts from unstretched and stretched myocytes with a 32P-end-labeled oligonucleotide containing C/EBPß, AP-1, and NF-{kappa}B consensus sequence. Five-microgram protein extracts were incubated on ice for 1 h with nonradiolabeled (cold) specific competitive and nonspecific competitive (oct-1) oligonucleotide (1.75 pmol) in binding buffer with poly-dI.dC to minimize nonspecific binding (20), 4% glycerol, 1 mM MgCl2, 0.4 mM EDTA, 10 mM Tris-HCl, 50 mM NaCl, and 0.4 mM DTT and then incubated for 45 min on ice with 32P ({gamma}ATP)-end-labeled oligonucleotide probe. Nonradiolabeled oligonucleotides were at 200-fold excess to the 32P-labeled probes for specific and nonspecific competition for DNA binding. The consensus C/EBP, AP-1, and NF-{kappa}B oligonucleotides used in EMSAs were purchased from Thermo Hybaid (Franklin, MA). The concentration of the oligonucleotides used was 1.75 pmol/µl. Supershift analysis was performed by the addition of antisera to C/EBPß, AP-1-c-fos and c-jun, and NF-{kappa}B p65 and p50 (Santa Cruz Biotechnology, Santa Cruz, CA) on ice 90 min before addition of labeled probe. The resulting protein-DNA complexes were separated in a 4% acrylamide gel run at 250 V for 1 h. The gel was dried under vacuum for 1 h at 80 C and protein-DNA complexes were visualized by autoradiography. The volume of the supershift was quantified using the Typhoon 8600 PhosphoImaging system (Amersham Biosciences, Buckinghamshire, UK) (a charge-coupled device camera-based system that calculates the integrated fluorescent signal from a continuously illuminated sample field).

Statistical analysis

Analysis of the baseline data and stretch data were carried out with a Mann-Whitney U test and between unstretched and stretched cells within each group by Willcoxon signed rank test. Analysis of the promoter studies was with a paired t test. Differences were considered statistically significant at P < 0.05. Data are expressed as means ± SEM.


    Results
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Reproductive state and OTR mRNA expression

OTR mRNA expression was detected from myocytes in each of the patient groups. Expression was lowest in NL myocytes (NL vs. NP, P = 0.016), intermediate in NP myocytes, and greatest in L myocytes (NL vs. L, P = 0.05 and NP vs. L, P = 0.8; Fig. 1Go).



View larger version (7K):
[in this window]
[in a new window]
 
FIG. 1. The effect of reproductive state on OTR mRNA expression. Myocytes from NL samples differed significantly from L and also NP myometrium (*, P < 0.05). The error bars represent SEM, and n = 6 for each group.

 
Mechanical stretch up-regulates OTR mRNA expression in primary human myocytes

The effect of mechanical stretch on OTR mRNA expression in human primary myocytes is shown in Figs. 2Go and 3Go. Stretch of NL cells for 1 h at 6 and 11% resulted in a significant increase in OTR expression (P = 0.027 for both; Fig. 2BGo). Stretch of NL myocytes for 6 h increased OTR mRNA expression, but the increases were not significant (Fig. 3BGo). Stretch of NP and L cells for 1 h had no significant effect on OTR expression (Fig. 2Go, A and C).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 2. The expression of OTR in human uterine smooth muscle cells grown from myometrial biopsies obtained from NP (A), NL (B), or L (C) women after mechanical stretch at 6, 11, and 16% for 1 h (*, P < 0.05 vs. baseline). The error bars represent SEM, and n = 6 for each group.

 


View larger version (13K):
[in this window]
[in a new window]
 
FIG. 3. The expression of OTR in human uterine smooth muscle cells grown from myometrial biopsies obtained from NL after mechanical stretch at 6, 11, and 16% for 1 (A) and 6 h (B) (*, P < 0.05 vs. baseline). The error bars represent SEM, and n = 6 for each group.

 
Mechanical stretch increases OTR-PROM activity in primary human myocytes

To investigate the effect of stretch on the transcriptional regulation of OTR, primary NL myocytes were transiently transfected with a construct of the OTR promoter (1.1 kb from the transcription start site) linked to a LUC reporter gene. CMV-Renilla vector was used to control for transfection efficiency. The myocytes were exposed to 16% stretch for 6 h. We found that mechanical stretch resulted in a significant increase in OTR-PROM activity in transiently transfected human primary myocytes control [100 vs. 134% (4%), n = 6, P = 0.001, paired t test].

Mechanical stretch of human primary myocytes results in increased nuclear protein-DNA binding to consensus C/EBPß and AP-1 DNA sequences

To investigate the effect of stretch on C/EBP, NF-{kappa}B, and AP-1 transcription factors, primary human myocytes were exposed to 11 or 16% stretch for 1 h, and nuclear protein was extracted from the myocytes as described above. EMSAs were performed to identify the presence of specific DNA binding to consensus oligonucleotide probes for C/EBPß, AP-1, and NF-{kappa}B and identify any change in DNA binding with stretch. C/EBPß, AP-1, and NF-{kappa}B were all detected in the nuclear fraction of myometrial cells in the presence and absence of stretch. Specific DNA binding for AP-1 and C/EBPß (supershifted with specific antibodies to C/EBPß and AP-1 c-jun and c-fos) was significantly increased in cells exposed to stretch, whereas NF-{kappa}B binding was not changed by mechanical stretch. Typhoon phosphor imager showed that the DNA binding and supershift for C/EBPß increases by 35% and for AP-1 by 80% after a 16% stretch for 1 h (n = 3, P < 0.05) (Figs. 4Go and 5Go).



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 4. A, EMSAs were performed with labeled consensus C/EBPß, establishing the presence of C/EBPß in primary myocyte nuclear extracts. Nuclear proteins were extracted from stretched (16% stretch for 1 h) or nonstretched human primary myocytes. The specific complex that can be competed by 200-fold molar excess of unlabeled probe (compet. cold oligo) and supershifted with specific antibody against C/EBPß is indicated by a bracket. The addition of antibody against C/EBPß (anti-C/EBPß) resulted in a supershifted band (arrow) that is of greater intensity after stretch. B, The volume of supershift was measured with Typoon 8600 PhosphoImaging system and was found significantly increased in cells exposed to stretch. We found that the DNA binding and supershift for C/EBPß increases around 35% after stretch for 1 h (*, P < 0.05). The error bars represent SEM, and n = 3 for each group.

 


View larger version (30K):
[in this window]
[in a new window]
 
FIG. 5. A, EMSAs were performed with labeled consensus AP-1, establishing the presence of AP-1 in primary human myocyte nuclear extracts. Nuclear proteins were extracted from stretched (16% stretch for 1 h) or nonstretched human primary myocytes. The specific complex is indicated by a bracket. The addition of antibody against c-fos or c-jun resulted in a supershifted band (arrow) that is of greater intensity after stretch. B, The volume of protein-DNA complex was measured with Typhoon 8600 PhosphoImaging system and was found significantly increased in cells exposed to stretch. We found that the specific DNA binding for AP-1 increases around 80% after 16% stretch for 1 h (*, P < 0.05). The error bars represent SEM, and n = 3 for each group.

 
Two specific protein-DNA complexes (designated A and B) were identified on EMSA using NF-{kappa}B-specific oligonucleotides. Antibodies to p65 (RelA) supershifted complex A. Antibody to p50 supershifted both complexes A and B. This suggests that complex A represents a protein-DNA complex containing p65 and p50 heterodimers, whereas complex B contains homodimers of p50. Antibody to p52 did not lead to supershift. In contrast to C/EBPß and AP-1, EMSAs using consensus NF-{kappa}B with nuclear extract from stretched myocytes did not result in increased specific DNA binding (Fig. 6Go).



View larger version (52K):
[in this window]
[in a new window]
 
FIG. 6. A, EMSAs were performed with labeled consensus NF-{kappa}B, establishing the presence of NF-{kappa}B in the above nuclear extracts. Nuclear proteins were extracted from stretched (16% stretch for 1 h) or nonstretched human primary myocytes. The specific complex that can be competed by 200-fold molar excess of unlabeled probe (compet. cold oligo) and supershifted with specific antibody against NF-{kappa}B p50 and p65 is indicated by a bracket. The protein-DNA binding did not increase after stretch. B, Typical EMSA with labeled consensus NF-{kappa}B in nuclear extracts of myocytes treated with IL-1ß. The specific complexes that can be competed by 200-fold molar excess of unlabeled probe (compet. cold oligo) are indicated by a bracket. They are comprised of two bands, A and B, as shown on the EMSA. The addition of antibody against NF-{kappa}B p50 and p65 resulted in supershifted bands (arrow). Antibodies to p65 supershifted complex A. Antibody to p50 supershifted both complexes A and B (n = 3).

 
Overexpression of C/EBPß but not AP-1 increases OTR-PROM activity

The OTR-PROM contains putative C/EBP and AP-1 transcription factor binding sites. To investigate whether the transcription factors C/EBP and AP-1 play a role in the transcriptional regulation of OTR, primary myocytes were transiently transfected with a construct of the OTR-PROM (1.1 kb from the transcription start site) linked to a LUC reporter gene together with expression vectors for C/EBPß or AP-1 (c-jun and c-fos). CMV-Renilla expression was used to control for transfection efficiency, although we did not see any significant differences in transfection efficiency between studies. C/EBPß (pSG5 LAP) resulted in a 4- to 5-fold induction of OTR-PROM-induced LUC activity (n = 6, P < 0.001) (Fig. 7Go). AP-1 expression vectors did not significantly change basal OTR-PROM activity.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 7. Transfections of primary human myocytes with OTR-PROM reporter vector. Cotransfection with expression vectors for C/EBPß resulted in a significant (n = 6; P < 0.01) 4- to 5-fold increase in OTR-PROM activity. The transfections were performed in triplicate samples and repeated in cells derived from six NL myometrial biopsies at term. The results are expressed as fold induction of LUC to Renilla ratio to the OTR-PROM reporter vector. LUC-Renilla activity was measured 48 h after transfection (*, P < 0.05). The error bars represent SEM, and n = 6 for each group.

 

    Discussion
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
These data show that stretch of pregnant uterine myocytes, collected before labor, results in up-regulation of OTR mRNA expression associated with increased OTR gene promoter activity. The increased promoter activity is associated with increased DNA binding of C/EBP and AP-1 but only overexpression of C/EBP and not AP-1 increased OTR-PROM activity. Our results show that myometrial OTR expression in the human is up-regulated by stretch possibly via increased C/EBP DNA binding. Furthermore, they suggest that in the human, as in several animal models of pregnancy and labor, increased uterine wall tension contributes to the increase in OTR mRNA expression with the onset of labor.

Early studies of OTR expression in human myometrium were based on receptor studies and found that OTR expression was low in early pregnancy, increased with advancing gestation, and peaked in early labor, only to decline in advanced labor (4). Later studies using Northern analysis to assess mRNA expression found that OTR mRNA levels followed a similar pattern but suggested that OTR mRNA expression was low before 36 wk gestation and increased thereafter but was not significantly different in samples taken before and after the onset of labor (3, 21). These data were supported by Western analysis in one paper (3) and receptor studies in the second (21). Our data, based on a quantitative method of mRNA measurement, show a significant increase in OTR mRNA expression in samples taken before and after the onset of labor at term and as such are similar to the results reported previously in which mRNA expression was also measured with a quantitative method (22). In addition, our study compared NP levels of OTR mRNA expression with those during pregnancy and found that OTR mRNA levels appeared to be suppressed before the onset of labor. This is in contrast to previous work win which OTR mRNA and protein levels were low in NP samples and rose progressively with pregnancy (4, 6, 23). The difference may be due to the relatively smaller sample size of our NP group.

Studies of animals with paired uterine horns have shown that uterine stretch up-regulates OTR expression in the rat and sheep (8, 9) and MTR in the wallaby (7). The role of stretch in OTR/MTR expression has been studied by allowing pregnancy to occur in one horn only in the rat and sheep and taking advantage of the fact that the wallaby conceives in only one horn naturally. Over the last 3 d of wallaby gestation, MTR expression is increased in the gravid horn but reduced in the nongravid horn (7). Removal of the conceptus results in lower MTR expression; however, if uterine distension is artificially maintained, MTR expression is the same as in sham-operated controls (24). In the case of the rat, after progesterone withdrawal, OTR mRNA expression appears to be dependent on stretch because OTR expression is increased only in the gravid horn or an artificially stretched nongravid horn (8). In contrast, in sheep in which parturition has been induced with betamethasone, OTR mRNA expression is increased in both gravid and nongravid horns but is significantly greater in the gravid horn (9). In the rat, tamoxifen treatment delays the increase in OTR expression, and RU486 administration results in increased OTR expression with 6 h (25, 26). These data suggest that stretch is an important stimulus to OTR expression in these animals but that endocrine factors, particularly estrogen and progesterone, may also have a role in OTR expression.

OTR mRNA and protein are expressed in the fetal uterus and are rapidly up-regulated after birth (27). Ovariectomy or treatment with estrogens did not affect the prepubertal OTR mRNA and protein concentrations, but they were suppressed up to 80% by treatment with progesterone. However, the OTR promoter has no full-consensus progesterone response element, and only the rat OTR gene has a functional full ERE [reviewed by Ivell et al. (28)]. In vivo studies in the rat demonstrate that estrogen increases uterine OTR expression (29); however, in vitro, estrogen does not consistently increase OTR expression, and the ERE in the rat OTR-PROM appears not to be functional (30). Thus, it appears that progesterone and estrogen influence OTR expression indirectly, possibly via the stroma as has been suggested previously (31), or it is possible that increasing the estrogen to progesterone ratio subtly alters the balance of relaxation-contraction and increases uterine wall tension leading to increased OTR expression. Indeed, infusion with PTHrP, which is suggested to maintain myometrial quiescence (32), delays the expression of OTR in the rat (33). This suggests that uterine wall tension per se and not the absolute change in estrogen to progesterone ratio may be responsible for the increase in OTR expression. Stretch of cells from nonpregnant and pregnant in labor samples increased OTR expression, but the differences were not significant. This suggests that OTR expression may be inhibited in these situations or, more likely in the case of the labor samples, that it is already close to its maximum.

Stretch of rat uterine myocytes in vivo and in vitro is associated with increase in c-fos expression and activity (15, 34). Further studies in the rat have shown that activation of all three MAPK forms is necessary to achieve optimal stretch-induced c-fos mRNA expression and that in the unilaterally pregnant rat model, MAPK activation and c-fos expression occurs only in the gravid horn (16). In this study, we have shown that stretch is associated with increased DNA binding of C/EBP and AP-1. In contrast to endothelial cells, osteoblast and fibroblast (35, 36, 37) NF-kB is not activated by stretch in myocytes. The OTR-PROM has multiple DNA binding elements for AP-1, AP-2, specificity protein-1, GATA-1, acute-phase response factor (alternatively known as signal transducer and activator of transcription-3), C/EBP (alternatively known as nuclear factor-IL-6), and NF-{kappa}B (Fig. 5Go) (26). Although stretch was associated with both AP-1 and C/EBP activation, we found that overexpression of C/EBP but not AP-1 increased OTR expression. This is consistent with the reports that IL-6 increases myometrial OTR expression (38, 39); however, other studies found either no response to IL-6 (40) or even a reduction in OTR expression (41).

AP-1 is activated by stretch in rat uterine myometrium via increased MAPK activity (16). C/EBP is activated by stretch of human airway smooth muscle cells and is responsible for the increase in IL-8 release in this system (17). In preadipocytes C/EBPß is rapidly and transiently phosphorylated on a conserved MAPK consensus site in response to GH, and this results in nuclear relocalization and increased DNA binding (42). In rat hepatocytes, C/EBPß-dependent gene expression can be mediated by phosphatidylinositol 3-kinase independently of MAPK (43). Therefore, in stretch uterine smooth muscle cells, C/EBP and AP-1 could be activated by either common or discrete mechanisms.

The unilateral animal pregnancy models described above have been used to investigate the myometrial expression of other peptides. These include PTHrP, cyclooxygenase (COX)-2, connexin-26 and -43, heat shock protein-90, estrogen receptor-{alpha}, and prostaglandin F2{alpha} receptor (9, 44, 45). These studies concluded that stretch determined the expression of COX-2 but not heat shock protein-90 or estrogen receptor-{alpha} in the sheep (9), PTHrP and connexin-43 but not connexin-26 and prostaglandin F2{alpha} receptor in the rat (44, 45, 46). Human studies to date have found that cyclical stretch of human uterine smooth muscle cells increases prostacyclin synthesis (47), and we have shown in these cells that stretch increases COX-2 mRNA expression, peptide synthesis, and enzyme activity and IL-8 mRNA expression and peptide synthesis (19, 48). Our current data add OTR to COX-2 as contraction associated peptide whose expression is induced by stretch of human uterine smooth muscle cells, suggesting that uterine stretch may play a significant role in the up-regulation of caffeic acid phenethyls before the onset of labor in the human.

In conclusion, stretch of pregnant nonlaboring human uterine smooth muscle cells results in increased OTR expression probably through increased C/EBPß DNA binding. These data suggest that stretch contributes to the massive increase in OTR expression at the time of labor in the human.


    Footnotes
 
This work was supported by a Wellbeing Training Fellowship (2000–2003) United Kingdom and a Wellbeing grant (2001–2003).

First Published Online October 19, 2004

Abbreviations: AP-1, Activator protein-1; C/EBP, CCAAT/enhancer binding protein; CMV, cytomegalovirus; COX, cyclooxygenase; DTT, dithiothreitol; ERE, estrogen response element; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; L, after onset of labor; LUC, luciferase; MTR, mesotocin receptor; NF-{kappa}B, nuclear factor-{kappa}B; NL, before onset of labor; NP, nonpregnant; OT, oxytocin; OTR, oxytocin receptor; OTR-PROM, OTR promoter.

Received February 17, 2004.

Accepted October 10, 2004.


    References
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 

  1. Valenzuela GJ, Sanchez-Ramos L, Romero R, Silver HM, Koltun WD, Millar L, Hobbins J, Rayburn W, Shangold G, Wang J, Smith J, Creasy GW 2000 Maintenance treatment of preterm labor with the oxytocin antagonist atosiban. The Atosiban PTL-098 Study Group. Am J Obstet Gynecol 182:1184–1190[CrossRef][Medline]
  2. Romero R, Sibai BM, Sanchez-Ramos L, Valenzuela GJ, Veille JC, Tabor B, Perry KG, Varner M, Goodwin TM, Lane R, Smith J, Shangold G, Creasy GW 2000 An oxytocin receptor antagonist (atosiban) in the treatment of preterm labor: a randomized, double-blind, placebo-controlled trial with tocolytic rescue. Am J Obstet Gynecol 182:1173–1183[CrossRef][Medline]
  3. Kimura T, Takemura M, Nomura S, Nobunaga T, Kubota Y, Inoue T, Hashimoto K, Kumazawa I, Ito Y, Ohashi K, Koyama M, Azuma C, Kitamura Y, Saji F 1996 Expression of oxytocin receptor in human pregnant myometrium. Endocrinology 137:780–785[Abstract]
  4. Fuchs AR, Fuchs F, Husslein P, Soloff MS 1984 Oxytocin receptors in the human uterus during pregnancy and parturition. Am J Obstet Gynecol 150:734–741[Medline]
  5. Inoue T, Kimura T, Azuma C, Inazawa J, Takemura M, Kikuchi T, Kubota Y, Ogita K, Saji F 1994 Structural organization of the human oxytocin receptor gene. J Biol Chem 269:32451–32456[Abstract/Free Full Text]
  6. Kimura T, Mizumoto Y, Ivell R 1999 Differential protein-DNA binding analysis identifies a novel enhancer element, US-1, involved in the up-regulation of the oxytocin receptor gene in human myometrium at term. Mol Cell Endocrinol 148:137–149[CrossRef][Medline]
  7. Parry LJ, Bathgate RA, Shaw G, Renfree MB, Ivell R 1997 Evidence for a local fetal influence on myometrial oxytocin receptors during pregnancy in the tammar wallaby (Macropus eugenii). Biol Reprod 56:200–207[Abstract]
  8. Ou CW, Chen ZQ, Qi S, Lye SJ 1998 Increased expression of the rat myometrial oxytocin receptor messenger ribonucleic acid during labor requires both mechanical and hormonal signals. Biol Reprod 59:1055–1061[Abstract/Free Full Text]
  9. Wu WX, Ma XH, Yoshizato T, Shinozuka N, Nathanielsz PW 1999 Differential expression of myometrial oxytocin receptor and prostaglandin H synthase 2, but not estrogen receptor {alpha} and heat shock protein 90 messenger ribonucleic acid in the gravid horn and nongravid horn in sheep during betamethasone-induced labor. Endocrinology 140:5712–5718[Abstract/Free Full Text]
  10. Gardner MO, Goldenberg RL, Cliver SP, Boots LR, Hoffman HJ 1997 Maternal serum concentrations of human placental lactogen, estradiol and pregnancy specific ß1-glycoprotein and fetal growth retardation. Acta Obstet Gynecol Scand Suppl 165:56–58[Medline]
  11. Kirkinen P, Jouppila P 1978 Polyhydramnion. A clinical study. Ann Chir Gynaecol 67:117–122[Medline]
  12. Lackman F, Capewell V, Richardson B, daSilva O, Gagnon R 2001 The risks of spontaneous preterm delivery and perinatal mortality in relation to size at birth according to fetal versus neonatal growth standards. Am J Obstet Gynecol 184:946–953[CrossRef][Medline]
  13. Manabe Y, Sakaguchi M, Nakajima A 1981 Initiation of uterine contractions by purely mechanical stretching of the uterus at midpregnancy. Int J Biol Res Pregnancy 2:63–69[Medline]
  14. Manabe Y, Manabe A, Sagawa N 1982 Stretch-induced cervical softening and initiation of labor at term. A possible correlation with prostaglandins. Acta Obstet Gynecol Scand 61:279–280[Medline]
  15. Shynlova OP, Oldenhof AD, Liu M, Langille L, Lye SJ 2002 Regulation of c-fos expression by static stretch in rat myometrial smooth muscle cells. Am J Obstet Gynecol 186:1358–1365[CrossRef][Medline]
  16. Oldenhof AD, Shynlova OP, Liu M, Langille BL, Lye SJ 2002 Mitogen-activated protein kinases mediate stretch-induced c-fos mRNA expression in myometrial smooth muscle cells. Am J Physiol Cell Physiol 283:C1530–C1539
  17. Kumar A, Knox AJ, Boriek AM 2003 CCAAT/enhancer-binding protein and activator protein-1 transcription factors regulate the expression of interleukin-8 through the mitogen-activated protein kinase pathways in response to mechanical stretch of human airway smooth muscle cells. J Biol Chem 278:18868–18876[Abstract/Free Full Text]
  18. Kobayashi S, Nagino M, Komatsu S, Naruse K, Nimura Y, Nakanishi M, Sokabe M 2003 Stretch-induced IL-6 secretion from endothelial cells requires NF-{kappa}B activation. Biochem Biophys Res Commun 308:306–312[CrossRef][Medline]
  19. Sooranna SR, Lee Y, Kim LU, Mohan AR, Bennett PR, Johnson MR 2004 Mechanical stretch activates type 2 cyclooxygenase via activator protein-1 transcription factor in human myometrial cells. Mol Hum Reprod 10:109–113[Abstract/Free Full Text]
  20. Binghui L 1992 Gel shift analysis with human recombinant AP1(c-jun): the effect of poly d(I-C) on specific complex formation. Promega Notes 14
  21. Wathes DC, Borwick SC, Timmons PM, Leung ST, Thornton S 1999 Oxytocin receptor expression in human term and preterm gestational tissues prior to and following the onset of labour. J Endocrinol 161:143–151[Abstract]
  22. Mesiano S, Chan EC, Fitter JT, Kwek K, Yeo G, Smith R 2002 Progesterone withdrawal and estrogen activation in human parturition are coordinated by progesterone receptor A expression in the myometrium. J Clin Endocrinol Metab 87:2924–2930[Abstract/Free Full Text]
  23. Helmer H, Hackl T, Schneeberger C, Knofler M, Behrens O, Kaider A, Husslein P 1998 Oxytocin and vasopressin 1a receptor gene expression in the cycling or pregnant human uterus. Am J Obstet Gynecol 179:1572–1578[CrossRef][Medline]
  24. Siebel AL, Gehring HM, Nave CD, Bathgate RA, Borchers CE, Parry LJ 2002 Up-regulation of mesotocin receptors in the tammar wallaby myometrium is pregnancy-specific and independent of estrogen. Biol Reprod 66:1237–1243[Abstract/Free Full Text]
  25. Fang X, Wong S, Mitchell BF 1996 Relationships among sex steroids, oxytocin, and their receptors in the rat uterus during late gestation and at parturition. Endocrinology 137:3213–3219[Abstract]
  26. Fang X, Wong S, Mitchell BF 1997 Effects of RU486 on estrogen, progesterone, oxytocin, and their receptors in the rat uterus during late gestation. Endocrinology 138:2763–2768[Abstract/Free Full Text]
  27. Fuchs AR, Drolet P, Fortier MA, Balvers M, Fields MJ 1998 Ontogeny of oxytocin receptors and oxytocin-induced stimulation of prostaglandin synthesis in prepubertal heifers. Endocrinology 139:2755–2764[Abstract/Free Full Text]
  28. Ivell R, Kimura T, Muller D, Augustin K, Abend N, Bathgate R, Telgmann R, Balvers M, Tillmann G, Fuchs AR 2001 The structure and regulation of the oxytocin receptor. Exp Physiol 86:289–296[Abstract]
  29. Soloff MS, Fernstrom MA, Periyasamy S, Soloff S, Baldwin S, Wieder M 1983 Regulation of oxytocin receptor concentration in rat uterine explants by estrogen and progesterone. Can J Biochem Cell Biol 61:625–630[Medline]
  30. Bale TL, Dorsa DM 1997 Cloning, novel promoter sequence, and estrogen regulation of a rat oxytocin receptor gene. Endocrinology 138:1151–1158[Abstract/Free Full Text]
  31. Ivell R, Fuchs AR, Bathgate R, Tillmann G, Kimura, T 2000 Regulation of the oxytocin receptor in bovine reproductive tissues and the role of steroids. Reprod Domest Anim 35:134–141[CrossRef]
  32. Wu WX, Bruns ME, Bruns D, Seaner R, Nathanielsz PW, Ferguson 2nd JE 1998 Parathyroid hormone-related protein mRNA in sheep endometrium and myometrium during late gestation and labor. J Soc Gynecol Investig 5:127–131[Medline]
  33. Mitchell JA, Ting TC, Wong S, Mitchell BF, Lye SJ 2003 Parathyroid hormone-related protein treatment of pregnant rats delays the increase in connexin 43 and oxytocin receptor expression in the myometrium. Biol Reprod 69:556–562[Abstract/Free Full Text]
  34. Mitchell JA, Lye SJ 2002 Differential expression of activator protein-1 transcription factors in pregnant rat myometrium. Biol Reprod 67:240–246[Abstract/Free Full Text]
  35. Du W, Mills I, Sumpio BE 1995 Cyclic strain causes heterogeneous induction of transcription factors, AP-1, CRE binding protein and NF-kB, in endothelial cells: species and vascular bed diversity. J Biomech 28:1485–1491[CrossRef][Medline]
  36. Granet C, Boutahar N, Vico L, Alexandre C, Lafage-Proust MH 2001 MAPK and SRC-kinases control EGR-1 and NF-{kappa}B inductions by changes in mechanical environment in osteoblasts. Biochem Biophys Res Commun 284:622–631[CrossRef][Medline]
  37. Inoh H, Ishiguro N, Sawazaki S, Amma H, Miyazu M, Iwata H, Sokabe M, Naruse K 2002 Uni-axial cyclic stretch induces the activation of transcription factor nuclear factor {kappa}B in human fibroblast cells. FASEB J 16:405–407[Free Full Text]
  38. Rauk PN, Friebe-Hoffmann U, Winebrenner LD, Chiao JP 2001 Interleukin-6 up-regulates the oxytocin receptor in cultured uterine smooth muscle cells. Am J Reprod Immunol 45:148–153
  39. Fang X, Wong S, Mitchell BF 2000 Effects of LPS and IL-6 on oxytocin receptor in nonpregnant and pregnant rat uterus. Am J Reprod Immunol 44:65–72
  40. Helmer H, Tretzmuller U, Brunbauer M, Kaider A, Husslein P, Knofler M 2002 Production of oxytocin receptor and cytokines in primary uterine smooth muscle cells cultivated under inflammatory conditions. J Soc Gynecol Investig 9:15–21[CrossRef][Medline]
  41. Schmid B, Wong S, Mitchell BF 2001 Transcriptional regulation of oxytocin receptor by interleukin-1ß and interleukin-6. Endocrinology 142:1380–1385[Abstract/Free Full Text]
  42. Piwien Pilipuk G, Galigniana MD, Schwartz J 2003 Subnuclear localization of C/EBPß is regulated by growth hormone and dependent on MAPK. J Biol Chem 278:35668–35677[Abstract/Free Full Text]
  43. Kang KW, Cho IJ, Lee CH, Kim SG 2003 Essential role of phosphatidylinositol 3-kinase-dependent CCAAT/enhancer binding protein ß activation in the induction of glutathione S-transferase by oltipraz. J Natl Cancer Inst 95:53–66[Abstract/Free Full Text]
  44. Daifotis AG, Weir EC, Dreyer BE, Broadus AE 1992 Stretch-induced parathyroid hormone-related peptide gene expression in the rat uterus. J Biol Chem 267:23455–23458[Abstract/Free Full Text]
  45. Ou CW, Orsino A, Lye SJ 1997 Expression of connexin-43 and connexin-26 in the rat myometrium during pregnancy and labor is differentially regulated by mechanical and hormonal signals. Endocrinology 138:5398–5407[Abstract/Free Full Text]
  46. Ou CW, Chen ZQ, Qi S, Lye SJ 2000 Expression and regulation of the messenger ribonucleic acid encoding the prostaglandin F(2{alpha}) receptor in the rat myometrium during pregnancy and labor. Am J Obstet Gynecol 182:919–925[CrossRef][Medline]
  47. Korita D, Sagawa N, Itoh H, Yura S, Yoshida M, Kakui K, Takemura M, Yokoyama C, Tanabe T, Fujii S 2002 Cyclic mechanical stretch augments prostacyclin production in cultured human uterine myometrial cells from pregnant women: possible involvement of up-regulation of prostacyclin synthase expression. J Clin Endocrinol Metab 87:5209–5219[Abstract/Free Full Text]
  48. Loudon JA, Sooranna SR, Bennett PR, Johnson MR2004 Mechanical stretch of human uterine smooth muscle cells increases IL-8 mRNA expression and peptide synthesis. Mol Hum Reprod 10:895–899



This article has been cited by other articles:


Home page
Reproductive SciencesHome page
N. Engineer, S. R. Sooranna, Z. Liang, P. R. Bennett, and M. R. Johnson
Influence of Extracellular Matrix on Cytokine Stimulated Pro-labour Gene Expression in Human Uterine Myocytes
Reproductive Sciences, November 1, 2008; 15(9): 950 - 960.
[Abstract] [PDF]


Home page
ReproductionHome page
M. Tattersall, N. Engineer, S. Khanjani, S. R Sooranna, V. H Roberts, P. L Grigsby, Z. Liang, L. Myatt, and M. R Johnson
Pro-labour myometrial gene expression: are preterm labour and term labour the same?
Reproduction, April 1, 2008; 135(4): 569 - 579.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. R. Mohan, S. R. Sooranna, T. M. Lindstrom, M. R. Johnson, and P. R. Bennett
The Effect of Mechanical Stretch on Cyclooxygenase Type 2 Expression and Activator Protein-1 and Nuclear Factor-{kappa}B Activity in Human Amnion Cells
Endocrinology, April 1, 2007; 148(4): 1850 - 1857.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
A. Dalrymple, K. Mahn, L. Poston, E. Songu-Mize, and R.M. Tribe
Mechanical stretch regulates TRPC expression and calcium entry in human myometrial smooth muscle cells
Mol. Hum. Reprod., March 1, 2007; 13(3): 171 - 179*.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S.R. Sooranna, P. Grigsby, L. Myatt, P.R. Bennett, and M.R. Johnson
Prostanoid receptors in human uterine myocytes: the effect of reproductive state and stretch
Mol. Hum. Reprod., December 1, 2005; 11(12): 859 - 864.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
T. M Lindstrom and P. R Bennett
The role of nuclear factor kappa B in human labour
Reproduction, November 1, 2005; 130(5): 569 - 581.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. R. Sooranna, N. Engineer, J. A. Z. Loudon, V. Terzidou, P. R. Bennett, and M. R. Johnson
The Mitogen-Activated Protein Kinase Dependent Expression of Prostaglandin H Synthase-2 and Interleukin-8 Messenger Ribonucleic Acid by Myometrial Cells: The Differential Effect of Stretch and Interleukin-1{beta}
J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3517 - 3527.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Terzidou, V.
Right arrow Articles by Johnson, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Terzidou, V.
Right arrow Articles by Johnson, M. R.
Related Collections
Right arrow Female Endocrinology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals