| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Imperial College Parturition Research Group (V.T., P.R.B.), Institute of Reproductive and Developmental Biology, Hammersmith Hospital Campus, London W12 0NN, United Kingdom; Department of Obstetrics and Gynaecology (S.R.S., L.U.K., M.R.J.), Imperial College School of Medicine, Chelsea and Westminster Hospital, London SW10 9NH, United Kingdom; and Department of Biological Sciences (S.T.), University of Warwick, Coventry CV4 7AL, United Kingdom
Address all correspondence and requests for reprints to: Dr. Mark R. Johnson, Department of Obstetrics and Gynaecology, Chelsea and Westminster Hospital, 369 Fulham Road, London SW10 9NH, United Kingdom. E-mail: mark.johnson{at}imperial.ac.uk.
 |
Abstract |
|---|
 Top Abstract IntroductionPatients and MethodsResultsDiscussionReferences |
|---|
B transcription factors. OTR expression was least in NL, intermediate in NP, and greatest in L cells. Stretch of NL cells resulted in up-regulation of OTR mRNA expression associated with increased OTR gene promoter activity. Stretch of NP and L cells did not affect OTR mRNA expression. The increased promoter activity was associated with increased DNA binding of C/EBP and AP-1 but not nuclear factor-B transcription factors. Overexpression of C/EBP, but not AP-1, increased OTR promoter activity. We conclude that stretch of NL cells results in increased OTR mRNA expression probably through increased C/EBPß DNA binding. These data suggest that stretch contributes to the massive increase in OTR expression before the onset of human labor. |
Introduction |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
The OTR is a cell surface membrane receptor with seven transmembrane domains that belongs to the class I G protein-coupled receptor family. The OTR gene encodes 389 amino acids and is present as a single copy in the human genome mapped to the gene locus 3p25–3p26.2. The gene spans 17 kb and contains three introns and four exons. Deletion experiments show that approximately 1000 bp upstream of the coding region are needed for expression of the OTR gene (5). It has long been thought that the OTR is up-regulated by estrogen and down-regulated by progesterone. The human OTR promoter does not, however, contain any full consensus progesterone or estrogen response elements (EREs), and there is no evidence of a direct action of either steroid on OTR gene promoter. However, the OTR promoter does contain eleven putative CCAAT/enhancer binding protein (C/EBP), three nuclear factor-B (NF-B), and five activator protein-1 (AP-1) transcription factor binding sites, raising the possibility that these transcription factors may be important in OTR gene expression. More recently two regions, termed US-1 and US-2, have been identified by differential protein-DNA binding analysis, which may be involved in the up-regulation of the OTR gene in human myometrium at term (6).
In animals with a double uterus, it is possible to differentiate the effect of endocrine and mechanical signals on gene expression. Parry et al. (7) originally reported that in the tammar wallaby, the expression of the mesotocin receptor (MTR), the wallaby equivalent of OTR, increased only in the pregnant, but not nonpregnant, uterus at term. These data were supported by the findings in the rat and sheep (8, 9). This suggests that OTR mRNA expression is increased by mechanical stretch and that this may explain the high rate of preterm labor in clinical conditions, such as polyhydramnios, multiple pregnancy, and singleton pregnancies with fetal macrosomia (10, 11, 12). Manabe et al. (13, 14) showed that abortion in the second trimester and labor at term can be induced by mechanical distension of the uterus. Mechanical stretch of rat uterine smooth muscle cells has been associated with increased c-fos expression (15, 16). Stretch of human airway smooth muscle cells increased IL-8 expression in a C/EBP- and AP-1-dependent mechanism (17) and stretch of endothelial cells increases IL-6 in an NF-B-dependent mechanism (18).
Stretch may be constant, as might be expected during pregnancy, or episodic, as at the time of labor. In these studies, we modeled stretch during pregnancy and consequently used constant rather than episodic stretch. We investigated the effect of mechanical stretch on the expression of human OTR in primary human myocytes and OTR promoter activity. We also examined the effect of stretch on DNA binding of the transcription factors C/EBP, NF-B, and AP-1.
|
Patients and Methods |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Approval for the collection of myometrial biopsies was obtained from the regional ethics committee. Fully informed written consent was sought from all patients participating in the study. Tissue was obtained from three groups of women: those undergoing hysterectomy for a benign indication and those undergoing cesarean section both before and after the onset of labor.
Tissue specimens
Biopsies (0.5 x 0.5 cm3) of term human myometrium were collected at the time of cesarean section from women not in labor (NL, n = 6), during active labor (L, n = 6), and from hysterectomy (NP, n = 6) in DMEM medium containing 100 mU/ml penicillin and 100 µg/ml streptomycin. Samples were stored at 4 C for no more than 3 h before cell preparation for culture. Tissue from cesarean section was removed from the upper margin of the incision made in the lower segment of the uterus. Mean maternal age [NL = 31 median (range 26–37); L = 30 (27–40); and NP = 42 (39–47) yr] and gestational age [NL = 39 (38 wk and 3d to 39 wk and 2d) and L = 38 + 5 (37 wk to 40 wk and 4d) wk] did not differ significantly. The indications for lower segment cesarean section in labor group were slow labor, fetal distress, and breech presentation, and in the nonlabor group, previous lower segment cesarean section, breech presentation, and maternal request.
Cell culture
Tissue samples were minced and digested for 45 min in a solution of DMEM (Sigma, Poole, UK) with 1 mg/ml collagenase types IA and XI (Sigma). The resulting suspension was then passed through a cell strainer and individual cells were collected by centrifugation at 400 x g for 10 min. After washing, cells were grown in DMEM with supplementation of 10% fetal calf serum, L-glutamine, and penicillin-streptomycin at 37 C and 5% CO2. Myometrial cells used were between second and fourth passage.
Flexercell tension system
To investigate the effect of mechanical stretch on OTR gene expression and OTR promoter activity, primary human myometrial cells were cultured on 6-well flexible-bottomed plates precoated with collagen I. The Flexercell Tension PlusT, FX-4000T (Flexcell International Corp., McKeesport, PA) is a computer-driven instrument that simulates biological strain conditions using a vacuum to deform cells cultured on a plastic, flexible, collagen type I-bonded growth surface 6-well plastic culture plate. The FX-4000T was developed to provide a mechanical load to cells cultured in vitro, and by applying increasing vacuum strength, it is possible to increase the surface area of attached cells and hence give varying amounts of stretch (percentages of prestretch size). We used a continuous model of stretch as seen in pregnancy in which there is a progressive increase in tension across the uterine wall. This probably builds up more rapidly at the end of pregnancy as the uterus reaches the limit of its ability to stretch and gene transcription is induced once the tension surpasses a threshold.
Before mechanical stretch, cells were serum starved for 16 h. Cells from the NP, NL, and L groups (n = 6 each) were then exposed to 6–16% static stretch for 1 h, and cells from the NL group (n = 6 each) were exposed to 6–16% static stretch for 6 h also. EMSA and transfection studies were performed only at +11 and +16% stretch for 6 h and transfection studies at +16% for 6 h based on our previous results (19). More than 99% of cells remained attached to the 6-well culture plates after stretch protocols, and these cells were frozen in liquid nitrogen for extraction of RNA or precipitated with protein extraction buffer for cytosolic and nuclear extracts.
Quantitative RT-PCR
Total RNA was extracted and purified from myometrial cells using RNeasy minikit (Qiagen Ltd., Crawley, West Sussex, UK). After quantification 1.0 µg was reverse transcribed with oligo dT random primers using Muloney murine leukemia virus reverse transcriptase (Applied Biosystems Ltd., Warrington, Cheshire, UK). Primer sets for OTR and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed and obtained from (Amersham Pharmacia Biotech, Little Chalfont, Bucks, UK).
The OTR sense (5'-GCCTTATCAGCTTCAAGATCTTGG-3') and antisense (5'-CAGGACAAAGGAGGACGAGTTGC-3') and GAPDH sense (5'-TGATGACATCAAGAAGGTGGTGAAG-3') and antisense (5'-TCCTTGGAGGCCATGTGGGCCAT-3') primer sets flanked intron/exon junctions and produced amplicons of the expected size. Assays were validated for all primer sets by confirming that single amplicons of appropriate size and sequence were generated according to predictions. Quantitative PCR was performed in the presence of SYBR Green (Roche Diagnostics Ltd., Lewes, West Sussex, UK), and amplicon yield was monitored during cycling in a LightCycler sequence detector (Roche Diagnostics Ltd.) that continually measures fluorescence caused by the binding of the dye to double-stranded DNA. Pre-PCR cycle was 7 min at 95 C followed by 35 cycles of 95 C for 10 sec, 56–60 C for 10 sec, and 72 C for 10 sec followed by final extension 72 C for 1min. The cycle at which the fluorescence reached a preset threshold (cycle threshold) was used for quantitative analyses. The cycle threshold in each assay was set at a level at which the exponential increase in amplicon abundance was approximately parallel among all samples. All mRNA abundance data were expressed relative to the amount of the constitutively expressed GAPDH. Conventional PCR was also performed using Ampli-Taq Gold DNA polymerase (Applied Biosystems). Pre-PCR cycle was 10 min at 95 C followed by 35 cycles of 95 C for 1 min, 56–60 C for 1 min, and 72 C for 1 min followed by final extension 72 C for 10 min.
Plasmid construction
The OTR-promoter (OTR-PROM) construct was prepared from genomic DNA by PCR using selected sense/antisense primers. The PCR product (1.1 kb) was isolated on an agarose gel (1%), excised, and purified using GFX gel purification columns (Amersham Biosciences, Buckinghamshire, UK). The purified PCR product was then cloned into pGEM-Teasy (Promega, Southampton, UK). The OTR PROM in pGEM-Teasy was used as a template for cloning into the luciferase reporter vector pGL3 (Promega). Restriction enzyme sites for KpnI (at the 5' end) and HindIII (at the 3' end) were introduced by using PCR. The sense primer sequences were GCGCGGTACCAAAGAAGGGGAGGCTTGGT and the antisense GGCCAAGCTTGGTCCCAGAGCCTTAACAAA. The product was then purified and double digested with KpnI/HindIII and inserted into the KpnI/HindIII polylinker restriction site upstream of the luciferase (LUC) reporter gene in the promoterless pGL3-basic vector (Promega). Constructs were confirmed by restriction digests and DNA sequencing.
Expression vectors
Expression vectors for C/EBPß (pSG5 LAP) and AP-1 (pcDNA c-jun and pcDNA c-fos) were kindly provided by Dr. Birgit Gellersen (Institute for Hormone and Fertility Research, University of Hamburg, Hamburg, Germany).
Transient transfections
Myometrial cells were grown in 6-well plates to 80% confluence. Transient transfections were carried out using a liposome-mediated method with Fugene 6 transfection reagent (Roche). The amount of DNA per well and the DNA to Fugene 6 ratios were optimized. Cytomegalovirus (CMV)-Renilla vector was used to control for transfection efficiency. Expression constructs for C/EBPß and AP-1 c-fos and c-jun were all cotransfected at 0.2 µg/well. The empty expression vectors pSG5 and pcDNA were included as filler constructs when required so that the total amount of transfected DNA per well was the same. Cells were cultured for a total of 48 h followed by harvesting and analysis with a dual firefly/Renilla LUC assay [Luclite (Perkin Elmer Life and Analytical Sciences, Inc., Boston, MA) and Coelentrerazin (Merck Biosciences Ltd., Nottingham, UK)]. Transfections were performed in triplicates. Luciferase/Renilla activity was measured 48 h after transfection.
Protein extraction
Monolayer myometrial cells were lysed in buffer containing 10 mM HEPES, 10 mM KCL, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM dithiothreitol (DTT), 1% Nonidet P-40, and Roche complete protease inhibitor tablet (diluted according to manufacturer’s instruction). Cytosolic protein extracts were obtained in the supernatant after centrifugation of the cell lysate for 30 sec at 12,000 x g at 4 C. The pellet was resuspended in buffer containing 10 mM HEPES, 10 mM KCL, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM DTT, 400 mM NaCl, 1% (vol/vol) Nonidet P-40, and a Roche Complete protease inhibitor tablet. Samples were then shaken vigorously for 15 min and submerged in ice bath. Nuclear protein extracts were obtained in the supernatant after centrifugation for 5 min at 12,000 x g at 4 C. Protein concentrations were determined by Bradford assay.
EMSAs
EMSA was carried out by incubating nuclear protein extracts from unstretched and stretched myocytes with a 32P-end-labeled oligonucleotide containing C/EBPß, AP-1, and NF-B consensus sequence. Five-microgram protein extracts were incubated on ice for 1 h with nonradiolabeled (cold) specific competitive and nonspecific competitive (oct-1) oligonucleotide (1.75 pmol) in binding buffer with poly-dI.dC to minimize nonspecific binding (20), 4% glycerol, 1 mM MgCl2, 0.4 mM EDTA, 10 mM Tris-HCl, 50 mM NaCl, and 0.4 mM DTT and then incubated for 45 min on ice with 32P (
ATP)-end-labeled oligonucleotide probe. Nonradiolabeled oligonucleotides were at 200-fold excess to the 32P-labeled probes for specific and nonspecific competition for DNA binding. The consensus C/EBP, AP-1, and NF-B oligonucleotides used in EMSAs were purchased from Thermo Hybaid (Franklin, MA). The concentration of the oligonucleotides used was 1.75 pmol/µl. Supershift analysis was performed by the addition of antisera to C/EBPß, AP-1-c-fos and c-jun, and NF-B p65 and p50 (Santa Cruz Biotechnology, Santa Cruz, CA) on ice 90 min before addition of labeled probe. The resulting protein-DNA complexes were separated in a 4% acrylamide gel run at 250 V for 1 h. The gel was dried under vacuum for 1 h at 80 C and protein-DNA complexes were visualized by autoradiography. The volume of the supershift was quantified using the Typhoon 8600 PhosphoImaging system (Amersham Biosciences, Buckinghamshire, UK) (a charge-coupled device camera-based system that calculates the integrated fluorescent signal from a continuously illuminated sample field).
Statistical analysis
Analysis of the baseline data and stretch data were carried out with a Mann-Whitney U test and between unstretched and stretched cells within each group by Willcoxon signed rank test. Analysis of the promoter studies was with a paired t test. Differences were considered statistically significant at P < 0.05. Data are expressed as means ± SEM.
|
Results |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
OTR mRNA expression was detected from myocytes in each of the patient groups. Expression was lowest in NL myocytes (NL vs. NP, P = 0.016), intermediate in NP myocytes, and greatest in L myocytes (NL vs. L, P = 0.05 and NP vs. L, P = 0.8; Fig. 1
).
|
The effect of mechanical stretch on OTR mRNA expression in human primary myocytes is shown in Figs. 2 and 3. Stretch of NL cells for 1 h at 6 and 11% resulted in a significant increase in OTR expression (P = 0.027 for both; Fig. 2B). Stretch of NL myocytes for 6 h increased OTR mRNA expression, but the increases were not significant (Fig. 3B). Stretch of NP and L cells for 1 h had no significant effect on OTR expression (Fig. 2, A and C).
|
|
To investigate the effect of stretch on the transcriptional regulation of OTR, primary NL myocytes were transiently transfected with a construct of the OTR promoter (1.1 kb from the transcription start site) linked to a LUC reporter gene. CMV-Renilla vector was used to control for transfection efficiency. The myocytes were exposed to 16% stretch for 6 h. We found that mechanical stretch resulted in a significant increase in OTR-PROM activity in transiently transfected human primary myocytes control [100 vs. 134% (4%), n = 6, P = 0.001, paired t test].
Mechanical stretch of human primary myocytes results in increased nuclear protein-DNA binding to consensus C/EBPß and AP-1 DNA sequences
To investigate the effect of stretch on C/EBP, NF-B, and AP-1 transcription factors, primary human myocytes were exposed to 11 or 16% stretch for 1 h, and nuclear protein was extracted from the myocytes as described above. EMSAs were performed to identify the presence of specific DNA binding to consensus oligonucleotide probes for C/EBPß, AP-1, and NF-B and identify any change in DNA binding with stretch. C/EBPß, AP-1, and NF-B were all detected in the nuclear fraction of myometrial cells in the presence and absence of stretch. Specific DNA binding for AP-1 and C/EBPß (supershifted with specific antibodies to C/EBPß and AP-1 c-jun and c-fos) was significantly increased in cells exposed to stretch, whereas NF-B binding was not changed by mechanical stretch. Typhoon phosphor imager showed that the DNA binding and supershift for C/EBPß increases by 35% and for AP-1 by 80% after a 16% stretch for 1 h (n = 3, P < 0.05) (Figs. 4 and 5).
|
|
B-specific oligonucleotides. Antibodies to p65 (RelA) supershifted complex A. Antibody to p50 supershifted both complexes A and B. This suggests that complex A represents a protein-DNA complex containing p65 and p50 heterodimers, whereas complex B contains homodimers of p50. Antibody to p52 did not lead to supershift. In contrast to C/EBPß and AP-1, EMSAs using consensus NF-B with nuclear extract from stretched myocytes did not result in increased specific DNA binding (Fig. 6).
|
The OTR-PROM contains putative C/EBP and AP-1 transcription factor binding sites. To investigate whether the transcription factors C/EBP and AP-1 play a role in the transcriptional regulation of OTR, primary myocytes were transiently transfected with a construct of the OTR-PROM (1.1 kb from the transcription start site) linked to a LUC reporter gene together with expression vectors for C/EBPß or AP-1 (c-jun and c-fos). CMV-Renilla expression was used to control for transfection efficiency, although we did not see any significant differences in transfection efficiency between studies. C/EBPß (pSG5 LAP) resulted in a 4- to 5-fold induction of OTR-PROM-induced LUC activity (n = 6, P < 0.001) (Fig. 7). AP-1 expression vectors did not significantly change basal OTR-PROM activity.
|
|
Discussion |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Early studies of OTR expression in human myometrium were based on receptor studies and found that OTR expression was low in early pregnancy, increased with advancing gestation, and peaked in early labor, only to decline in advanced labor (4). Later studies using Northern analysis to assess mRNA expression found that OTR mRNA levels followed a similar pattern but suggested that OTR mRNA expression was low before 36 wk gestation and increased thereafter but was not significantly different in samples taken before and after the onset of labor (3, 21). These data were supported by Western analysis in one paper (3) and receptor studies in the second (21). Our data, based on a quantitative method of mRNA measurement, show a significant increase in OTR mRNA expression in samples taken before and after the onset of labor at term and as such are similar to the results reported previously in which mRNA expression was also measured with a quantitative method (22). In addition, our study compared NP levels of OTR mRNA expression with those during pregnancy and found that OTR mRNA levels appeared to be suppressed before the onset of labor. This is in contrast to previous work win which OTR mRNA and protein levels were low in NP samples and rose progressively with pregnancy (4, 6, 23). The difference may be due to the relatively smaller sample size of our NP group.
Studies of animals with paired uterine horns have shown that uterine stretch up-regulates OTR expression in the rat and sheep (8, 9) and MTR in the wallaby (7). The role of stretch in OTR/MTR expression has been studied by allowing pregnancy to occur in one horn only in the rat and sheep and taking advantage of the fact that the wallaby conceives in only one horn naturally. Over the last 3 d of wallaby gestation, MTR expression is increased in the gravid horn but reduced in the nongravid horn (7). Removal of the conceptus results in lower MTR expression; however, if uterine distension is artificially maintained, MTR expression is the same as in sham-operated controls (24). In the case of the rat, after progesterone withdrawal, OTR mRNA expression appears to be dependent on stretch because OTR expression is increased only in the gravid horn or an artificially stretched nongravid horn (8). In contrast, in sheep in which parturition has been induced with betamethasone, OTR mRNA expression is increased in both gravid and nongravid horns but is significantly greater in the gravid horn (9). In the rat, tamoxifen treatment delays the increase in OTR expression, and RU486 administration results in increased OTR expression with 6 h (25, 26). These data suggest that stretch is an important stimulus to OTR expression in these animals but that endocrine factors, particularly estrogen and progesterone, may also have a role in OTR expression.
OTR mRNA and protein are expressed in the fetal uterus and are rapidly up-regulated after birth (27). Ovariectomy or treatment with estrogens did not affect the prepubertal OTR mRNA and protein concentrations, but they were suppressed up to 80% by treatment with progesterone. However, the OTR promoter has no full-consensus progesterone response element, and only the rat OTR gene has a functional full ERE [reviewed by Ivell et al. (28)]. In vivo studies in the rat demonstrate that estrogen increases uterine OTR expression (29); however, in vitro, estrogen does not consistently increase OTR expression, and the ERE in the rat OTR-PROM appears not to be functional (30). Thus, it appears that progesterone and estrogen influence OTR expression indirectly, possibly via the stroma as has been suggested previously (31), or it is possible that increasing the estrogen to progesterone ratio subtly alters the balance of relaxation-contraction and increases uterine wall tension leading to increased OTR expression. Indeed, infusion with PTHrP, which is suggested to maintain myometrial quiescence (32), delays the expression of OTR in the rat (33). This suggests that uterine wall tension per se and not the absolute change in estrogen to progesterone ratio may be responsible for the increase in OTR expression. Stretch of cells from nonpregnant and pregnant in labor samples increased OTR expression, but the differences were not significant. This suggests that OTR expression may be inhibited in these situations or, more likely in the case of the labor samples, that it is already close to its maximum.
Stretch of rat uterine myocytes in vivo and in vitro is associated with increase in c-fos expression and activity (15, 34). Further studies in the rat have shown that activation of all three MAPK forms is necessary to achieve optimal stretch-induced c-fos mRNA expression and that in the unilaterally pregnant rat model, MAPK activation and c-fos expression occurs only in the gravid horn (16). In this study, we have shown that stretch is associated with increased DNA binding of C/EBP and AP-1. In contrast to endothelial cells, osteoblast and fibroblast (35, 36, 37) NF-kB is not activated by stretch in myocytes. The OTR-PROM has multiple DNA binding elements for AP-1, AP-2, specificity protein-1, GATA-1, acute-phase response factor (alternatively known as signal transducer and activator of transcription-3), C/EBP (alternatively known as nuclear factor-IL-6), and NF-B (Fig. 5
) (26). Although stretch was associated with both AP-1 and C/EBP activation, we found that overexpression of C/EBP but not AP-1 increased OTR expression. This is consistent with the reports that IL-6 increases myometrial OTR expression (38, 39); however, other studies found either no response to IL-6 (40) or even a reduction in OTR expression (41).
AP-1 is activated by stretch in rat uterine myometrium via increased MAPK activity (16). C/EBP is activated by stretch of human airway smooth muscle cells and is responsible for the increase in IL-8 release in this system (17). In preadipocytes C/EBPß is rapidly and transiently phosphorylated on a conserved MAPK consensus site in response to GH, and this results in nuclear relocalization and increased DNA binding (42). In rat hepatocytes, C/EBPß-dependent gene expression can be mediated by phosphatidylinositol 3-kinase independently of MAPK (43). Therefore, in stretch uterine smooth muscle cells, C/EBP and AP-1 could be activated by either common or discrete mechanisms.
The unilateral animal pregnancy models described above have been used to investigate the myometrial expression of other peptides. These include PTHrP, cyclooxygenase (COX)-2, connexin-26 and -43, heat shock protein-90, estrogen receptor-
, and prostaglandin F2 receptor (9, 44, 45). These studies concluded that stretch determined the expression of COX-2 but not heat shock protein-90 or estrogen receptor- in the sheep (9), PTHrP and connexin-43 but not connexin-26 and prostaglandin F2 receptor in the rat (44, 45, 46). Human studies to date have found that cyclical stretch of human uterine smooth muscle cells increases prostacyclin synthesis (47), and we have shown in these cells that stretch increases COX-2 mRNA expression, peptide synthesis, and enzyme activity and IL-8 mRNA expression and peptide synthesis (19, 48). Our current data add OTR to COX-2 as contraction associated peptide whose expression is induced by stretch of human uterine smooth muscle cells, suggesting that uterine stretch may play a significant role in the up-regulation of caffeic acid phenethyls before the onset of labor in the human.
In conclusion, stretch of pregnant nonlaboring human uterine smooth muscle cells results in increased OTR expression probably through increased C/EBPß DNA binding. These data suggest that stretch contributes to the massive increase in OTR expression at the time of labor in the human.
|
Footnotes |
|---|
First Published Online October 19, 2004
Abbreviations: AP-1, Activator protein-1; C/EBP, CCAAT/enhancer binding protein; CMV, cytomegalovirus; COX, cyclooxygenase; DTT, dithiothreitol; ERE, estrogen response element; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; L, after onset of labor; LUC, luciferase; MTR, mesotocin receptor; NF-B, nuclear factor-B; NL, before onset of labor; NP, nonpregnant; OT, oxytocin; OTR, oxytocin receptor; OTR-PROM, OTR promoter.
Received February 17, 2004.
Accepted October 10, 2004.
|
References |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
and heat shock protein 90 messenger ribonucleic acid in the gravid horn and nongravid horn in sheep during betamethasone-induced labor. Endocrinology 140:5712–5718B activation. Biochem Biophys Res Commun 308:306–312[CrossRef][Medline]
B inductions by changes in mechanical environment in osteoblasts. Biochem Biophys Res Commun 284:622–631[CrossRef][Medline]
B in human fibroblast cells. FASEB J 16:405–407) receptor in the rat myometrium during pregnancy and labor. Am J Obstet Gynecol 182:919–925[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  N. Engineer, S. R. Sooranna, Z. Liang, P. R. Bennett, and M. R. Johnson Influence of Extracellular Matrix on Cytokine Stimulated Pro-labour Gene Expression in Human Uterine Myocytes Reproductive Sciences, November 1, 2008; 15(9): 950 - 960. [Abstract] [PDF]
|
|
|
|
 |
|
 M. Tattersall, N. Engineer, S. Khanjani, S. R Sooranna, V. H Roberts, P. L Grigsby, Z. Liang, L. Myatt, and M. R Johnson Pro-labour myometrial gene expression: are preterm labour and term labour the same? Reproduction, April 1, 2008; 135(4): 569 - 579. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. R. Mohan, S. R. Sooranna, T. M. Lindstrom, M. R. Johnson, and P. R. Bennett The Effect of Mechanical Stretch on Cyclooxygenase Type 2 Expression and Activator Protein-1 and Nuclear Factor-{kappa}B Activity in Human Amnion Cells Endocrinology, April 1, 2007; 148(4): 1850 - 1857. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Dalrymple, K. Mahn, L. Poston, E. Songu-Mize, and R.M. Tribe Mechanical stretch regulates TRPC expression and calcium entry in human myometrial smooth muscle cells Mol. Hum. Reprod., March 1, 2007; 13(3): 171 - 179*. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.R. Sooranna, P. Grigsby, L. Myatt, P.R. Bennett, and M.R. Johnson Prostanoid receptors in human uterine myocytes: the effect of reproductive state and stretch Mol. Hum. Reprod., December 1, 2005; 11(12): 859 - 864. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M Lindstrom and P. R Bennett The role of nuclear factor kappa B in human labour Reproduction, November 1, 2005; 130(5): 569 - 581. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. R. Sooranna, N. Engineer, J. A. Z. Loudon, V. Terzidou, P. R. Bennett, and M. R. Johnson The Mitogen-Activated Protein Kinase Dependent Expression of Prostaglandin H Synthase-2 and Interleukin-8 Messenger Ribonucleic Acid by Myometrial Cells: The Differential Effect of Stretch and Interleukin-1{beta} J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3517 - 3527. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
