help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Steinberg, G. R.
Right arrow Articles by Kemp, B. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steinberg, G. R.
Right arrow Articles by Kemp, B. E.
The Journal of Clinical Endocrinology & Metabolism Vol. 89, No. 9 4575-4580
Copyright © 2004 by The Endocrine Society

AMP-Activated Protein Kinase Is Not Down-Regulated in Human Skeletal Muscle of Obese Females

Gregory R. Steinberg, Angela C. Smith, Bryce J. W. van Denderen, Zhiping Chen, Sid Murthy, Duncan J. Campbell, G. J. F. Heigenhauser, David J. Dyck and Bruce E. Kemp

St. Vincent’s Institute (G.R.S., B.J.W.v.D., Z.C., S.M., D.J.C., B.E.K.) and Department of Medicine (G.R.S., D.J.C., B.E.K.), University of Melbourne, Fitzroy, Victoria 3065, Australia; Department of Human Biology and Nutritional Sciences (A.C.S., D.J.D.), University of Guelph, Ontario N1G 2W1, Canada; and Department of Medicine (G.J.F.H.), McMaster University, Hamilton, Ontario L8N 3Z5, Canada

Address all correspondence and requests for reprints to: Gregory R. Steinberg, St. Vincent’s Institute, 9 Princes Street, Fitzroy, Victoria, Australia 3065. E-mail: gsteinberg{at}svi.edu.au.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Obesity in humans is associated with lipid accumulation in skeletal muscle, insulin and leptin resistance, and type 2 diabetes. AMP-activated protein kinase (AMPK) is an important regulator of fatty acid (FA) metabolism in skeletal muscle. To address the hypothesis that lipid accumulation in skeletal muscle of obese subjects may be due to down-regulation of AMPK, we measured mRNA and protein levels of AMPK isoforms, AMPK{alpha}1 and -{alpha}2 activity, AMPK kinase activity, acetyl-coenzyme A carboxylase (ACCß) expression and phosphorylation, and FA metabolism in biopsies of rectus abdominus muscle from lean and obese women. We also examined the effect of 5-aminoimidazole-4-carboxamide riboside (AICAR) on AMPK activity and the effects of AICAR and leptin on FA metabolism. Skeletal muscle of obese subjects had increased total FA uptake and triglyceride esterification, and leptin failed to stimulate FA oxidation. However, AMPK mRNA and protein expression, AMPK{alpha}1 and -{alpha}2 activities, AMPK kinase activity, ACCß phosphorylation, and FA oxidation were similar in lean and obese subjects. Moreover, AICAR increased AMPK{alpha}2 activity, ACCß phosphorylation, and palmitate oxidation to a similar degree in muscle from lean and obese subjects. We conclude that the abnormal lipid metabolism and leptin resistance of skeletal muscle of obese subjects is not due to down-regulation of AMPK. In addition, the similar stimulation by AICAR of AMPK in skeletal muscle of lean and obese subjects suggests that direct pharmacological activation of AMPK may be a therapeutic approach for stimulating FA oxidation in the treatment of human obesity.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
OBESITY IS A major public health problem in the developed world. Skeletal muscle from obese humans exhibits increased rates of fatty acid (FA) transport (1A ) and esterification despite unaltered (1) or reduced rates of FA oxidation (2), resulting in im lipid accumulation that is strongly associated with insulin and leptin resistance and the development of type 2 diabetes (3).

AMP-activated protein kinase (AMPK) is an {alpha}ß{gamma}-heterotrimer consisting of a catalytic subunit ({alpha}) and two noncatalytic subunits (ß, {gamma}). Whereas AMPK activity is dependent on Thr172 phosphorylation within the catalytic {alpha}1- and {alpha}2subunits, the noncatalytic ß- (ß1 and ß2) and {gamma} ({gamma}1, {gamma}2 and {gamma}3)-subunits are essential for optimum enzyme activity, regulation, and intracellular targeting (4). AMPK is an important regulator of FA metabolism in rodent skeletal muscle in which activation stimulates FA oxidation through phosphorylation of acetyl-coenzyme A carboxylase (ACCß) on Ser 221, leading to reduced malonyl-coenzyme A and increased FA flux into the mitochondria via carnitine palmitoyl transferase-1. AMPK also suppresses triglyceride (TG) esterification through inhibition of glycerol-3 phosphate acyl transferase (GPAT) (5) and was recently shown to mediate contraction-induced sarcolemmal FA uptake by translocating the FA translocase/CD36 to the plasma membrane (6). In addition, AMPK activation leads to increased uncoupling protein-3 expression (7) and mitochondrial biogenesis (8, 9).

We previously showed that skeletal muscle of obese subjects has increased total palmitate uptake and fails to show increased palmitate oxidation in response to leptin stimulation in vitro (1). In rodents, skeletal muscle AMPK is activated by humoral factors such as leptin (10) and adiponectin (11) and by the pharmacological AMPK activator 5-aminoimidazole-4-carboxamide riboside (AICAR). Leptin resistance in skeletal muscle of obese subjects suggests that skeletal muscle AMPK may be down-regulated in obesity. To address the hypothesis that lipid accumulation and leptin resistance of skeletal muscle of obese subjects may be due to downregulation of AMPK, we measured mRNA and protein levels of the AMPK catalytic ({alpha}1 and {alpha}2) and regulatory (ß1, ß2, {gamma}1, {gamma}2, {gamma}3) subunit isoforms, AMPK{alpha}1 and -{alpha}2 activity, AMPK{alpha} Thr172 phosphorylation, AMPK kinase (AMPKK) activity, ACCß expression and phosphorylation, and palmitate metabolism in biopsies of rectus abdominus muscle from lean and obese women. We also examined the effect of AICAR on AMPK activity and the effects of AICAR and leptin on FA metabolism.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The participants were seven lean (body mass index ≤ 27.5 kg/m2, mean 24.1 ± 0.8 kg/m2) and nine obese (body mass index ≥ 30.0 kg/m2, mean 33.3 ± 1.1 kg/m2) nondiabetic women. Subjects were admitted to McMaster Health Sciences Center for a variety of abdominal surgical procedures and gave informed written consent before participation. The study was approved by The University of Guelph and McMaster University Ethics Committees. None of the subjects had any diseases or had taken any medications known to alter carbohydrate or lipid metabolism in the previous 6 months, and they maintained a constant body mass during the previous year. Three obese women and two lean women were postmenopausal. Because menopausal status was without effect on muscle lipid metabolism, the data for pre- and postmenopausal subjects in each group were combined. After an overnight fast (12–18 h), general anesthesia was induced with a short-acting barbiturate and maintained by a fentanyl and rocuronium volatile anesthetic mixture. Rectus abdominus muscle biopsies were excised, a small aliquot of muscle (~200 mg) immediately frozen in liquid nitrogen, and muscle strips prepared and incubated for 20 min in a modified Kreb’s Henseleit buffer as previously described (1). Muscle strips were then transferred to vials containing 2 µCi [1-14C] palmitate (Amersham Biosciences, Arlington Heights, IL) for 60 min containing leptin (10 µg/ml), AICAR (2 mM), or saline vehicle. These concentrations were selected because they previously have been shown to elicit maximal stimulation of rodent skeletal muscle FA metabolism (12, 13). Palmitate oxidation and esterification were monitored by the production of 14CO2 and incorporation of [1-14C] palmitate into endogenous lipids, respectively, as described previously (14). Muscle strips were also incubated under the same conditions with or without AICAR to examine its effect on AMPK activity and ACCß phosphorylation, snap frozen, and stored in liquid nitrogen until further analysis as described below. Given the limited size of the muscle biopsies, not all experiments could be performed for each subject.

Intramuscular contents of glycogen and metabolites

Skeletal muscle glycogen content was determined on freeze-dried samples, which were dissected free of all visible connective tissue and blood, and assayed using procedures previously described (15). ATP, ADP, AMP, and phosphocreatine were measured on freeze-dried, powdered muscle that was extracted with perchloric acid, neutralized, and analyzed by reverse phase HPLC (16).

AMPK-related measures

Muscle lysate preparation. Frozen rectus abdominus muscle (~100 mg) was homogenized in 700 µl ice-cold lysis buffer as described previously (17). Similarly, muscle strips incubated with or without AICAR were homogenized in 200 µl ice-cold lysis buffer. Homogenates were centrifuged at 14,000 x g for 25 min and an aliquot (100 µl) removed for the measurement of AMPKK activity and AMPK subunit expression after the determination of protein content by the bicinchoninic acid method (Bio-Rad Laboratories, Hercules, CA). Aliquots of the basal rectus abdominus muscle homogenate (500 µl) and homogenates of incubated muscle (150 µl) were removed for measurement of AMPK{alpha}1 and -{alpha}2 activities and ACCß expression and phosphorylation as described below.

AMPK subunit mRNA expression. Total RNA was isolated from frozen rectus abdominus muscle (~20 mg) using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. For each sample 3 µg RNA were reverse transcribed using the SuperScript II first-strand synthesis kit (Invitrogen) and oligo dT primers, in a final volume of 20 µl. Samples were diluted 1:100 in water and 1 µl used for quantification. Real-time quantitative RT-PCR was performed on an ABI Prism 5700 sequence detection system (Perkin-Elmer Applied Biosystems, Foster City, CA). Reactions were performed in triplicate in 10 mM Tris-HCl (pH 8.0), 2.5 mM Mg acetate, 50 mM KCl, 200 µM deoxynucleotide triphosphates, 1/40,000 dilution of SYBR Green I (Molecular Probes, Eugene, OR), 1 µg/ml 6-carboxy-X-rhodamine (Molecular Probes), 8% dimethylsulfoxide, 200 nM primers, and 0.625 U AmpliTaq Gold polymerase (Applied Biosystems) per 25-µl reaction. Samples were incubated at 95 C for 10 min followed by 50 cycles of 95 C for 15 sec and 60 C for 1 min. After amplification, the specificity of the PCR was determined by performing melt curve analysis from 60 to 95 C. Results were normalized against the RPL32 housekeeping gene, and relative gene expression was determined using the comparative cycle threshold method. The sequences of the forward (F) and reverse (R) primers are listed from 5' to 3' and are as follows: RPL32 (NM000994), (F) CAGGGTTCGTAGAAGATTCAAGGG, (R) CTTGGAGGAAACATTGTGAGCGATC; AMPK{alpha}1 (NM006251), (F) CGGCAAAGTGAAGGTTGGCAAAC, (R) GCGGATTTTTCCTACCACATCAAGG; AMPK{alpha}2 (NM006252), (F) ACGGGTTGAAGAGATGGAAGCCAG, (R) AATGGGAGGGTGCCACAAAGAAG; AMPKß1 (NM006253), (F) ACTCCGAGGAAATCAAGGCA, (R) GAGCACTTTTGGGAATCCAC; AMPKß2 (NM005399), (F) ACTCCGTAAAGCCCACACAG, (R) GAGGTCCAGGATGGCAACAA; AMPK{gamma}1 (NM002733), (F) ACTACCACCCCCGTCTATGT, (R) GGCTTCTTCTCTCCACCTGT; AMPK{gamma}2 (AF087875), (F) GCCTTCATACATCCAGACAC, (R) GCACTTCACAACACCTTCAA; and AMPK{gamma}3 (AJ249977), (F) GGCAGAAGTCGGTGGAGGAA, (R) CAGTCAGAGGGGAGGCAGTC.

AMPK protein expression and activity and ACCß expression and phosphorylation

The expression level of AMPK subunits was determined by Western blot analysis. AMPK Thr172, {alpha}1, {alpha}2, ß1, ß2, and {gamma}1 antibodies were as described previously (18, 19). AMPK{gamma}2 and -{gamma}3 antibodies were raised against the peptide (rat 553–566 CLTPAGAKQKETETE) and the peptide (h59–75 RWTRQSVEEGEPPGQG), respectively. Muscle homogenates (200 µg protein) were loaded onto a 12% acrylamide gel. Membranes were blocked for 60 min in 5% skim milk in PBS, probed using {alpha}1 and {gamma}1 antibodies at a dilution of 1:500 in PBS, exposed to the secondary antibody protein G/horse radish peroxidase (1:1000 in PBS) for 60 min and visualized using enhanced chemiluminescence. Membranes were then stripped for 20 min by incubating with 0.5 N NaOH at room temperature, washed in PBS, blocked for 60 min, and then reprobed for {alpha}2- and ß2/ß1-, followed by {gamma}2-, {gamma}3-, and {alpha}Thr172. AMPK{alpha}1 and -{alpha}2 activities and ACCß expression and phosphorylation were determined using procedures described previously (17).

AMPKK activity

AMPKK was measured using a two-step reaction with a maltose binding protein (MBP)-AMPK (1–312) fusion construct as substrate (20). The construct consists of the AMPK catalytic domain that is activated after phosphorylation of the activation loop Thr-172. For the first AMPKK reaction, 19 µl buffer [20 mM Tris-HCl (pH 7.5), 0.1% Tween 20, 10 mM dithiothreitol, 8 mM MgCl2 with 0.4 mM ATP, 0.12 mM AMP] containing 5 µM MBP-AMPK (1–312) were incubated with 11 µl of muscle homogenate at 30 C for 30 min. In the second reaction, MBP-AMPK (1–312) activity was determined using the SAMS [ACC{alpha} (73–87)A77] peptide assay; 10 µl of the AMPKK reaction were added to the peptide phosphorylation reaction to give a final volume of 40 µl, comprising 50 mM HEPES (pH 7.5), 12 mM MgCl2, 5% glycerol, and 0.05% Triton X-100 with 1 mM dithiothreitol, 0.25 mM [{gamma}-32P]ATP (500 cpm/pmol), 100 µM SAMS peptide, and 0.18 mM AMP. After incubation for 10 min at 30 C, 30-µl aliquots were applied to P81 papers as previously described (21), and activities (picomoles of phosphate transferred to the SAMS peptide per minute per milligram protein measured in the original muscle homogenate) were calculated.

Calculations and statistics

The quantity of palmitate esterified and oxidized was calculated from the specific activity of labeled palmitate in the incubation medium. All data are reported as mean ± SE. Results were analyzed using ANOVA procedures, and Tukey’s post hoc test was used to test for significant differences revealed by the ANOVA. Significance was accepted at P ≤ 0.05.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Age-matched (lean, 48.9 ± 4.0 yr, obese 41.7 ± 3.6 yr) obese subjects had significantly greater body mass (lean, 67.3 ± 2.7 kg; obese 90.3 ± 3.7 kg, P < 0.001) then lean controls. Caloric intake and macronutrient composition as determined by 24 h dietary recall was not significantly different between the two groups (data not shown). Basal, muscle glycogen (lean, 279.1 ± 34.9 µmol/g dry mass; obese, 315.1 ± 19.5 µmol/g dry mass), ATP (lean, 14.9 ± 0.9 dry mass; obese 13.1 ± 1.0 µmol/g dry mass), ADP (lean, 2.1 ± 0.1 µmol/g dry mass; obese 1.7 ± 0.2 µmol/g dry mass), AMP (lean, 78.1 ± 10.2 pmol/g dry mass; obese, 58.8 ± 4.2 pmol/g dry mass), and phosphocreatine (lean, 68.1 ± 8.4 µmol/g dry mass; obese 59.0 ± 5.0 µmol/g dry mass) were similar between the two groups.

AMPK subunit mRNA and protein expression

AMPK subunit mRNA expression relative to lean subjects was not significantly altered with obesity ({alpha}1, 117 ± 21%; {alpha}2, 117 ± 28.3%; ß1, 140 ± 17%; ß2, 98 ± 17%; {gamma}1, 100 ± 10%; {gamma}2, 63 ± 7%; {gamma}3, 76 ± 18%). Western blot analysis showed the AMPK subunits migrated to their expected molecular mass ({alpha}1, 63 kDa; {alpha}2, 63 kDa; ß1, 40 kDa; ß2, 34 kDa; {gamma}1, 35 kDa; {gamma}2, 63 kDa; {gamma}3, 55 kDa; Thr172, 63 kDa). AMPK subunit protein expression relative to lean subjects was not significantly altered with obesity ({alpha}1, 149 ± 13%; {alpha}2, 104 ± 20%; ß1, 99 ± 9%; ß2, 155 ± 26%; {gamma}1, 110 ± 19%; {gamma}2, 108 ± 18%; {gamma}3, 128 ± 21%; Thr172, 94 ± 4%).

Basal AMPK and AMPKK activity and ACCß expression and phosphorylation

Basal levels of AMPK activity, measured with and without saturating concentrations of AMP, were similar for skeletal muscle of lean and obese subjects (Fig. 1Go). Moreover, obesity was without effect on basal AMPKK activity (lean, 0.24 ± 0.08 pmol/min·mg protein; obese, 0.24 ± 0.7 pmol/min·mg protein). Total ACCß protein (lean, 1.0 ± 0.38 arbitrary units; obese, 1.02 ± 0.16 arbitrary units) and ACCß phosphorylation (lean, 1.0 ± 0.14 arbitrary units; obese, 1.14 ± 0.24 arbitrary units) were similar in skeletal muscle from lean and obese subjects.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1. AMPK activity was measured in immune complexes isolated by immunoprecipitation of total muscle homogenates using AMPK{alpha}1 (A) and -{alpha}2 (B) antibodies with (+) or without (–) 200 µM AMP. Data shown as means ± SEM, n = 7 lean and 9 obese. Significantly different from a (–AMP).

 
Effects of AICAR on AMPK{alpha}1 and -{alpha}2 activity and ACCß phosphorylation

AICAR stimulated skeletal muscle AMPK{alpha}2, but not AMPK{alpha}1, activity to a similar degree for lean (+110%, P = 0.03) and obese (+100%, P = 0.03) subjects (Fig. 2Go). AICAR also produced a similar stimulation of ACCß phosphorylation for lean (+118%, P = 0.037) and obese (+49%, P = 0.007) subjects (Fig. 3Go).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2. Isolated rectus abdominus muscle strips were incubated under basal conditions or with 2 mM AICAR for 60 min. AMPK activity was measured in immune complexes isolated by immunoprecipitation of total muscle homogenates using AMPK{alpha}1 (A) and -{alpha}2 (B) antibodies with 200 µM AMP. Data shown as means ± SEM, n = 5. Significantly different from a (basal).

 


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3. Isolated rectus abdominus muscle strips from lean and obese women were incubated under basal conditions or with 2 mM AICAR for 60 min. Representative Western blot of ACCß phosphorylation and expression (A) and quantification (B) of ACCß phosphorylation relative total ACCß expression (ratio of P-ACCß to total ACCß). Data shown as means ± SEM, n = 5. Significantly different from a (basal).

 
Effects of AICAR and leptin on FA metabolism

Obesity was associated with higher rates of palmitate uptake (+70%, P = 0.03) and TG esterification (+119%, P = 0.04), although basal rates of palmitate oxidation were not different between skeletal muscle of lean and obese subjects (Fig. 4Go). Leptin stimulated palmitate oxidation in lean but not obese humans (lean, +44%, P = 0.024, obese, –6%) (Fig. 4AGo). In contrast to the leptin resistance of muscle from obese subjects, AICAR produced similar increases in skeletal muscle palmitate oxidation for lean and obese subjects (lean, +109%, P = 0.02; obese +59%, P = 0.052) (Fig. 4AGo). Leptin did not alter total palmitate uptake or TG esterification (Fig. 4Go, B and C, respectively). Whereas there was a trend for AICAR to stimulate total palmitate uptake (lean, +32%, P = 0.075; obese +26%, P = 0.052), AICAR had no effect on TG esterification. As we have previously demonstrated (1), skeletal muscle from obese subjects had elevated esterification/oxidation ratio (+53%, P = 0.045). Leptin treatment reduced this ratio in skeletal muscle from lean (–40%, P = 0.035) but not obese subjects, whereas AICAR reduced the esterification/oxidation ratio in muscle from both lean (–29%, P = 0.05) and obese (–31%, P = 0.033) subjects (Fig. 4DGo).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 4. Palmitate metabolism in isolated rectus abdominus muscle strips from lean and obese women incubated under basal conditions, 10 µM leptin, or 2 mM AICAR for 60 min in the presence of 2 µCi [1-14C] palmitate. A, Palmitate oxidation. B, Total palmitate uptake. C, Triacylglycerol esterification. D, Esterification/oxidation ratio (total palmitate esterification into phospholipid + diacylglycerol + TG lipid pools to palmitate oxidation). Data shown as means ± SEM, n = 7 lean and 9 obese. Significantly different from a (basal) and b (lean).

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The main finding of our study is that the abnormal lipid metabolism and leptin resistance of skeletal muscle of obese subjects cannot be accounted for by down-regulation of AMPK. Basal AMPKK activity, AMPK mRNA, protein expression and activity, and ACCß expression and phosphorylation were similar in skeletal muscle of lean and obese subjects. Moreover, AICAR produced a similar stimulation of skeletal muscle AMPK{alpha}2 activity, ACCß phosphorylation, and FA oxidation in skeletal muscle from lean and leptin-resistant obese humans.

This is the first report of AMPK subunit isoforms mRNA and protein expression and AMPK{alpha}1 and -{alpha}2 activities in skeletal muscle of obese human subjects relative to lean controls. Previously, AMPK expression and activity have been demonstrated to be similar in both obese (22) and lean (23) type 2 diabetics when compared with nondiabetic subjects. In this study we demonstrate that AMPK mRNA and protein expression, ACCß expression, and phosphorylation and AMPKK and AMPK{alpha}1 and -{alpha}2 activity are preserved in obese human skeletal muscle, suggesting that, similar to observations in type 2 diabetics, alterations in AMPK expression do not contribute to the pathogenesis of lipid accumulation in skeletal muscle of obese humans.

To our knowledge this is the first report of the effects of AICAR on AMPK activity and FA metabolism in skeletal muscle from obese humans. Koistinen et al. (24) recently reported the effects of AICAR on glucose transport and GLUT4 translocation in type 2 diabetics, although isoform-specific AMPK activity was not reported. Our finding that AICAR stimulated AMPK{alpha}2, but not AMPK {alpha}1, activity in human skeletal muscle suggests that activation of the {alpha}2-isoform is the preferable target for pharmacological activation of AMPK. This finding is in agreement with previous studies demonstrating that activation of the {alpha}2-subunit is critical for mediating the effects of exercise and AICAR on skeletal muscle FA metabolism in rodents (25). Moreover, a recent study demonstrated that skeletal muscle of AMPK{alpha}2 null mice are insensitive to AICAR-stimulated glucose uptake (26).

Our finding that AICAR did not affect TG esterification in skeletal muscle is in contrast to the findings of Muoio et al. (5) for isolated rodent skeletal muscle, in which AICAR suppressed TG esterification, an effect attributed to reduced GPAT activity. The difference between these findings and our own may reflect a species-dependent difference in the regulation of GPAT in rodent and human skeletal muscle. Leptin similarly failed to influence TG esterification in our study, although we previously demonstrated an effect in rodent skeletal muscle (14). Future studies are required to examine whether AMPK phosphorylates and inhibits GPAT activity in human skeletal muscle.

Several lines of evidence indicate that pharmacological activation of skeletal muscle AMPK may be of therapeutic benefit in obesity because treatment of obese rodents with adiponectin (11) or AICAR (27) activates AMPK and stimulates skeletal muscle FA oxidation. Similarly, we found in obese human skeletal muscle that treatment with AICAR resulted in the stimulation of skeletal muscle AMPK{alpha}2 activity, ACCß phosphorylation, and FA oxidation and reduction of the esterification/oxidation ratio, highlighting the potential role for chronic AMPK activation to reduce skeletal muscle lipid. Indeed, the stimulation of AMPK activity and reduction of im TG by metformin indicates that this may be an important mechanism by which AMPK activation improves skeletal muscle insulin sensitivity (28). Moreover, chronic leptin infusion in leptin-deficient humans with lipodystrophy reduces im lipid storage (29). Although AMPK activity was not reported for this study, we have demonstrated that chronic leptin infusion in rodents increases skeletal muscle AMPK{alpha}2 expression, ACCß phosphorylation, and FA oxidation, leading to reduced im TG (30, 31). Despite these pronounced effects of leptin in rodents (30, 31) and leptin-deficient humans with lipodystrophy (29, 32), the effects of recombinant leptin treatment in human obesity appears to be minimal (33), which may be due to skeletal muscle leptin resistance (1, 14). Our demonstration that AICAR increases AMPK{alpha}2 activity, ACCß phosphorylation, and FA oxidation in leptin-resistant skeletal muscle of obese human subjects emphasizes that the development of specific activators of AMPK may be an appropriate treatment to bypass skeletal muscle leptin resistance, leading to stimulation of skeletal muscle FA oxidation, reduced accumulation of im lipid, and improved skeletal muscle insulin sensitivity.

Our study had a number of limitations. We obtained muscle biopsies from anesthetized subjects, and the effect of anesthesia on skeletal muscle of human subjects is unknown. However, biopsies from lean and obese subjects were obtained under identical conditions. The limited number of subjects meant that we were unable to detect small differences between AMPK in skeletal muscle from lean and obese subjects. However, our study had sufficient statistical power to detect a 14% difference in basal AMPK activity and a 34% difference in AMPK response to AICAR stimulation. The limited size of the skeletal muscle biopsies prevented our examination of more than one stimulus of AMPK. Further studies are required to examine the effects of other stimuli such as leptin and adiponectin on AMPK in skeletal muscle of lean and obese subjects.

In conclusion, our findings indicate that the abnormal lipid metabolism and leptin resistance of skeletal muscle of obese subjects is not due to down-regulation of AMPK. Our demonstration that AICAR produces similar stimulation of AMPK in skeletal muscle of lean and obese subjects suggests that direct activation of AMPK above basal levels may be a valid therapeutic approach for stimulating FA oxidation in the treatment of human obesity.


    Acknowledgments
 
We gratefully acknowledge the invaluable contributions of the surgeons, Drs. Sibley, Roth, and Loopstra.


    Footnotes
 
This study was supported by the Natural Sciences and Engineering Research Council of Canada (NSERC) (to D.J.D.), the Canadian Institutes of Health Research (to G.J.F.H.), and the National Health and Medical Research Council and Australian Research Council (ARC) (to B.E.K.). G.R.S. is an NSERC of Canada postdoctoral fellow. A.C.S. is supported by an NSERC postgraduate scholarship. D.J.C. is the recipient of a Career Development Award (Award CR 02M 0829) from the National Heart Foundation of Australia, and B.E.K. is an ARC Federation fellow.

Abbreviations: ACCß, Acetyl-coenzyme A carboxylase; AICAR, 5-aminoimidazole-4-carboxamide riboside; AMPK, AMP-activated protein kinase; AMPKK, AMPK kinase; F, forward; FA, fatty acid; GPAT, glycerol-3 phosphate acyl transferase; MBP, maltose binding protein; R, reverse; TG, triglyceride.

Received February 18, 2004.

Accepted June 8, 2004.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Steinberg GR, Parolin ML, Heigenhauser GJ, Dyck DJ 2002 Leptin increases FA oxidation in lean but not obese human skeletal muscle: evidence of peripheral leptin resistance. Am J Physiol 283:E187–E192
  2. Bonen A, Parolin ML, Steinberg GR, Calles-Escandon J, Tandon NN, Glatz JFC, Luiken JJFP, Heigenhauser GJF, Dyck DJ 2004 Triacylglycerol accumulation in human obesity and type 2 diabetes is associated with increased rates of skeletal muscle fatty acid transport and increased sarcolemmal FAT/CD36. FASEB J 18:1144–1146[Abstract/Free Full Text]
  3. Kelley DE, Goodpaster B, Wing RR, Simoneau J-A 1999 Skeletal muscle fatty acid metabolism in association with insulin resistance, obesity, and weight loss. Am J Physiol 277:E1130–E1141
  4. Hulver MW, Berggren JR, Cortright RN, Dudek RW, Thompson RP, Pories WJ, MacDonald KG, Cline GW, Shulman GI, Dohm GL, Houmard JA 2003 Skeletal muscle lipid metabolism with obesity. Am J Physiol 284:E741–E747
  5. Kemp BE, Stapleton D, Campbell DJ, Chen ZP, Murthy S, Walter M, Gupta A, Adams JJ, Kastsis F, Van Denderen B, Jenning IG, Iseli T, Michell BJ, Witters LA 2003 AMP-activated protein kinase, super metabolic regulator. Biochem Soc Trans 31:162–168[Medline]
  6. Muoio D, Seefeld K, Witters LA, Coleman RA 1999 AMP-activated kinase reciprocally regulates triacylglycerol synthesis and fatty acid oxidation in liver and muscle: evidence that sn-glycerol-3-phosphate acyltransferase is a novel target. Biochem J 338:783–791
  7. Luiken JJ, Coort SLM, Willems J, Coumans WA, Bonen A, van der Vusse GJ, Glatz JFC 2003 Contraction-induced fatty acid translocase/CD36 translocation in rat cardiac myocytes is mediated through AMP activated protein kinase signaling. Diabetes 52:1627–1634[Abstract/Free Full Text]
  8. Zhou M, Lin B-Z, Coughlin S, Vallega G, Pilch PF 2000 UCP-3 expression in skeletal muscle: effects of exercise, hypoxia, and AMP-activated protein kinase. Am J Physiol 279:E622–E629
  9. Winder WW, Holmes BF, Rubink DS, Jensen EB, Chen M, Holloszy JO 2000 Activation of AMP-activated protein kinase increases mitochondrial enzymes in skeletal muscle. J Appl Physiol 88:2219–2226[Abstract/Free Full Text]
  10. Zong H, Ren JM, Young LH, Pypaert M, Mu J, Birnbaum MJ, Shulman GI 2002 AMP kinase is required for mitochondrial biogenesis in skeletal muscle in response to chronic energy deprivation. Proc Natl Acad Sci USA 99:15983–15987[Abstract/Free Full Text]
  11. Minokoshi Y, Kim YB, Peroni OD, Fryer LG, Muller C, Carling D, Kahn BB 2002 Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415:339–343[CrossRef][Medline]
  12. Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P, Carling D, Kimura S, Nagai R, Kahn BB, Kadowaki T 2002 Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat Med 8:1288–1295[CrossRef][Medline]
  13. Muoio DM, Dohm GL, Fiedorek FTJ, Tapscott EB, Coleman RA 1997 Leptin directly alters lipid partitioning in skeletal muscle. Diabetes 46:1360–1363[Abstract]
  14. Merrill GF, Kurth EJ, Hardie DG, Winder WW 1997 AICA riboside increases AMP-activated protein kinase, fatty acid oxidation, and glucose uptake in rat muscle. Am J Physiol 273:E1107–E1112
  15. Steinberg GR, Dyck DJ 2000 Development of leptin resistance in rat soleus muscle in response to high-fat diets. Am J Physiol 279:E1374–E1382
  16. Watt MJ, Holmes AG, Steinberg GR, Mesa JL, Kemp BE, Febbraio MA 2004 Reduced plasma FFA availability increases net triacylglycerol degradation, but not GPAT or HSL activity in human skeletal muscle. Am J Physiol 287:E120–E127
  17. Bernocchi P, Ceconi C, Cargnoni A, Pedersini P, Curello S, Ferrari R 1994 Extraction and assay of creatine phosphate, purine, and pyridine nucleotides in cardiac tissue by reversed-phase high-performance liquid chromatography. Anal Biochem 222:374–379[CrossRef][Medline]
  18. Chen Z-P, McConell GK, Michell BJ, Snow RJ, Canny BJ, Kemp BE 2000 AMPK signaling in contracting human skeletal muscle: acyl-CoA carboxylase and NO synthase phosphorylation. Am J Physiol 279:E1202–E1206
  19. Stephens TJ, Chen Z-P, Canny BJ, Michell BJ, Kemp BE, McConell GK 2002 Progressive increase in human skeletal muscle AMPK{alpha}2 activity and ACC phosphorylation during exercise. Am J Physiol 282:E688–E694
  20. Chen Z, Heierhorst J, Mann RJ, Mitchelhill KI, Michell BJ, Witters LA, Lynch GS, Kemp BE, Stapleton D 1999 Expression of the AMP-activated protein kinase ß1 and ß2 subunits in skeletal muscle. FEBS Lett 460:343–348[CrossRef][Medline]
  21. Hamilton SR, O’Donnell Jr JB, Hammet A, Stapleton D, Habinowski SA, Means AR, Kemp BE, Witters LA 2002 AMP-activated protein kinase kinase: detection with recombinant AMPK {alpha}1 subunit. Biochem Biophys Res Commun 293:892–898[CrossRef][Medline]
  22. Pearson RB, Mitchelhill K, Kemp BE 1993 In: Hardie DG, ed. Protein phosphorylation: a practical approach. Oxford, UK: Oxford University Press; 265–291
  23. Hojlund K, Mustard KJ, Staehr P, Hardie DG, Beck-Nielsen H, Richter EA, Wojtaszewski JFP 2004 AMPK activity and isoform protein expression are similar in muscle of obese subjects with and without type 2 diabetes. Am J Physiol Endocrinol Metab 286:E239–E244
  24. Musi N, Fujii N, Hirshman MF, Ekberg I, Froberg S, Ljungqvist O, Thorell A, Goodyear LJ 2001 AMP-activated protein kinase (AMPK) is activated in muscle of subjects with type 2 diabetes during exercise. Diabetes 50:921–927[Abstract/Free Full Text]
  25. Koistinen HA, Galuska D, Chibalin AV, Yang J, Zierath JR, Holman GD, Wallberg-Henriksson H 2003 5-Amino-imidazole carboxamide riboside increases glucose transport and cell-surface GLUT4 content in skeletal muscle from subjects with type 2 diabetes. Diabetes 52:1066–1072[Abstract/Free Full Text]
  26. Aschenbach WG, Hirshman MF, Fujii N, Sakamoto K, Howlett KF, Goodyear LJ 2002 Effect of AICAR treatment on glycogen metabolism in skeletal muscle. Diabetes 51:567–573[Abstract/Free Full Text]
  27. Jorgensen SB, Viollet B, Andreelli F, Frosig C, Birk JB, Schjerling P, Vaulont S, Richter EA, Wojtaszewski JFP 2003 Knockout of the {alpha}-2 but not {alpha}-1 5'AMP-activated protein kinase isoform abolishes AICAR but not contraction-induced glucose uptake in skeletal muscle. J Biol Chem 279:1070–1079
  28. Buhl ES, Jessen N, Pold R, Ledet T, Flyvbjerg A, Pedersen SB, Pedersen O, Schmitz O, Lund S 2002 Long-term AICAR administration reduces metabolic disturbances and lowers blood pressure in rats displaying features of the insulin resistance syndrome. Diabetes 51:2199–2206[Abstract/Free Full Text]
  29. Musi N, Hirshman MF, Nygren J, Svanfeldt M, Bavenholm P, Rooyackers O, Zhou G, Williamson JM, Ljunqvist O, Efendic S, Moller DE, Thorell A, Goodyear LJ 2002 Metformin increases AMP-activated protein kinase activity in skeletal muscle of subjects with type 2 diabetes. Diabetes 51:2074–2081[Abstract/Free Full Text]
  30. Petersen KF, Oral EA, Dufour S, Befroy D, Ariyan C, Yu C, Cline GW, DePaoli AM, Taylor SI, Gorden P, Shulman GI 2002 Leptin reverses insulin resistance and hepatic steatosis in patients with severe lipodystrophy. J Clin Invest 109:1345–1350[CrossRef][Medline]
  31. Steinberg GR, Rush JWE, Dyck DJ 2003 AMPK expression and phosphorylation are increased in rodent muscle after chronic leptin treatment. Am J Physiol 284:E648–E654
  32. Steinberg GR, Bonen A, Dyck DJ 2002 Fatty acid oxidation and triacylglycerol hydrolysis are enhanced following chronic leptin treatment in rats. Am J Physiol 282:E593–E600
  33. Oral EA, Simha V, Ruiz E, Andewelt A, Premkumar A, Snell P, Wagner AJ, DePaoli AM, Reitman ML, Taylor SI, Gorden P, Garg A 2002 Leptinreplacement therapy for lipodystrophy. N Engl J Med 346:570–578[Abstract/Free Full Text]
  34. Heymsfield SB, Greenberg AS, Fujioka K, Dixon RM, Kuschner R, Hunt T, Lubina JA, Patane J, Self B, Hunt P, McCamish M 1999 Recombinant leptin for weight loss in obese and lean adults: a randomized, controlled, dose-escalation trial. JAMA 282:1568–1575[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
K. Hojlund, J. B. Birk, D. K. Klein, K. Levin, A. J. Rose, B. F. Hansen, J. N. Nielsen, H. Beck-Nielsen, and J. F. P. Wojtaszewski
Dysregulation of Glycogen Synthase COOH- and NH2-Terminal Phosphorylation by Insulin in Obesity and Type 2 Diabetes Mellitus
J. Clin. Endocrinol. Metab., November 1, 2009; 94(11): 4547 - 4556.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. Mortensen, P. Poulsen, L. Wegner, K. L. Stender-Petersen, R. Ribel-Madsen, M. Friedrichsen, J. B. Birk, A. Vaag, and J. F. P. Wojtaszewski
Genetic and metabolic effects on skeletal muscle AMPK in young and older twins
Am J Physiol Endocrinol Metab, October 1, 2009; 297(4): E956 - E964.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. R. Steinberg and B. E. Kemp
AMPK in Health and Disease
Physiol Rev, July 1, 2009; 89(3): 1025 - 1078.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
G. R. Steinberg, M. J. Watt, M. Ernst, M. J. Birnbaum, B. E. Kemp, and S. B. Jorgensen
Ciliary Neurotrophic Factor Stimulates Muscle Glucose Uptake by a PI3-Kinase-Dependent Pathway That Is Impaired With Obesity
Diabetes, April 1, 2009; 58(4): 829 - 839.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Kola, M. Christ-Crain, F. Lolli, G. Arnaldi, G. Giacchetti, M. Boscaro, A. B. Grossman, and M. Korbonits
Changes in Adenosine 5'-Monophosphate-Activated Protein Kinase as a Mechanism of Visceral Obesity in Cushing's Syndrome
J. Clin. Endocrinol. Metab., December 1, 2008; 93(12): 4969 - 4973.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
N. Dzamko, J. D. Schertzer, J. G. Ryall, R. Steel, S. L. Macaulay, S. Wee, Z.-P. Chen, B. J. Michell, J. S. Oakhill, M. J. Watt, et al.
AMPK-independent pathways regulate skeletal muscle fatty acid oxidation
J. Physiol., December 1, 2008; 586(23): 5819 - 5831.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Pieter de Lange, M. Moreno, E. Silvestri, A. Lombardi, F. Goglia, and A. Lanni
Fuel economy in food-deprived skeletal muscle: signaling pathways and regulatory mechanisms
FASEB J, November 1, 2007; 21(13): 3431 - 3441.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. J. Cuthbertson, J. A. Babraj, K. J.W. Mustard, M. C. Towler, K. A. Green, H. Wackerhage, G. P. Leese, K. Baar, M. Thomason-Hughes, C. Sutherland, et al.
5-Aminoimidazole-4-Carboxamide 1-{beta}-D-Ribofuranoside Acutely Stimulates Skeletal Muscle 2-Deoxyglucose Uptake in Healthy Men
Diabetes, August 1, 2007; 56(8): 2078 - 2084.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. C. Smith, K. L. Mullen, K. A. Junkin, J. Nickerson, A. Chabowski, A. Bonen, and D. J. Dyck
Metformin and exercise reduce muscle FAT/CD36 and lipid accumulation and blunt the progression of high-fat diet-induced hyperglycemia
Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E172 - E181.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. R. Steinberg, A. J. McAinch, M. B. Chen, P. E. O'Brien, J. B. Dixon, D. Cameron-Smith, and B. E. Kemp
The Suppressor of Cytokine Signaling 3 Inhibits Leptin Activation of AMP-Kinase in Cultured Skeletal Muscle of Obese Humans
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3592 - 3597.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
G. K. Bandyopadhyay, J. G. Yu, J. Ofrecio, and J. M. Olefsky
Increased Malonyl-CoA Levels in Muscle From Obese and Type 2 Diabetic Subjects Lead to Decreased Fatty Acid Oxidation and Increased Lipogenesis; Thiazolidinedione Treatment Reverses These Defects.
Diabetes, August 1, 2006; 55(8): 2277 - 2285.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. L. Martin, T. Alquier, K. Asakura, N. Furukawa, F. Preitner, and B. B. Kahn
Diet-induced Obesity Alters AMP Kinase Activity in Hypothalamus and Skeletal Muscle
J. Biol. Chem., July 14, 2006; 281(28): 18933 - 18941.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
R. M. Reznick and G. I. Shulman
The role of AMP-activated protein kinase in mitochondrial biogenesis
J. Physiol., July 1, 2006; 574(1): 33 - 39.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. J. Lessard, Z.-P. Chen, M. J. Watt, M. Hashem, J. J. Reid, M. A. Febbraio, B. E. Kemp, and J. A. Hawley
Chronic rosiglitazone treatment restores AMPK{alpha}2 activity in insulin-resistant rat skeletal muscle
Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E251 - E257.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Jamieson, M. M. W. Chong, G. R. Steinberg, V. Jovanovska, B. C. Fam, D. V. R. Bullen, Y. Chen, B. E. Kemp, J. Proietto, T. W. H. Kay, et al.
Socs1 Deficiency Enhances Hepatic Insulin Signaling
J. Biol. Chem., September 9, 2005; 280(36): 31516 - 31521.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. Tanaka, S. Hidaka, H. Masuzaki, S. Yasue, Y. Minokoshi, K. Ebihara, H. Chusho, Y. Ogawa, T. Toyoda, K. Sato, et al.
Skeletal Muscle AMP-Activated Protein Kinase Phosphorylation Parallels Metabolic Phenotype in Leptin Transgenic Mice Under Dietary Modification
Diabetes, August 1, 2005; 54(8): 2365 - 2374.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. B. Chen, A. J. McAinch, S. L. Macaulay, L. A. Castelli, P. E. O'Brien, J. B. Dixon, D. Cameron-Smith, B. E. Kemp, and G. R. Steinberg
Impaired Activation of AMP-Kinase and Fatty Acid Oxidation by Globular Adiponectin in Cultured Human Skeletal Muscle of Obese Type 2 Diabetics
J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3665 - 3672.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. B. Taylor, W. J. Ellingson, J. D. Lamb, D. G. Chesser, and W. W. Winder
Long-chain acyl-CoA esters inhibit phosphorylation of AMP-activated protein kinase at threonine-172 by LKB1/STRAD/MO25
Am J Physiol Endocrinol Metab, June 1, 2005; 288(6): E1055 - E1061.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. F. P Wojtaszewski, J. B Birk, C. Frosig, M. Holten, H. Pilegaard, and F. Dela
5'AMP activated protein kinase expression in human skeletal muscle: effects of strength training and type 2 diabetes
J. Physiol., April 15, 2005; 564(2): 563 - 573.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Steinberg, G. R.
Right arrow Articles by Kemp, B. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steinberg, G. R.
Right arrow Articles by Kemp, B. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals