| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
St. Vincent’s Institute (G.R.S., B.J.W.v.D., Z.C., S.M., D.J.C., B.E.K.) and Department of Medicine (G.R.S., D.J.C., B.E.K.), University of Melbourne, Fitzroy, Victoria 3065, Australia; Department of Human Biology and Nutritional Sciences (A.C.S., D.J.D.), University of Guelph, Ontario N1G 2W1, Canada; and Department of Medicine (G.J.F.H.), McMaster University, Hamilton, Ontario L8N 3Z5, Canada
Address all correspondence and requests for reprints to: Gregory R. Steinberg, St. Vincent’s Institute, 9 Princes Street, Fitzroy, Victoria, Australia 3065. E-mail: gsteinberg{at}svi.edu.au.
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
1 and -2 activity, AMPK kinase activity, acetyl-coenzyme A carboxylase (ACCß) expression and phosphorylation, and FA metabolism in biopsies of rectus abdominus muscle from lean and obese women. We also examined the effect of 5-aminoimidazole-4-carboxamide riboside (AICAR) on AMPK activity and the effects of AICAR and leptin on FA metabolism. Skeletal muscle of obese subjects had increased total FA uptake and triglyceride esterification, and leptin failed to stimulate FA oxidation. However, AMPK mRNA and protein expression, AMPK1 and -2 activities, AMPK kinase activity, ACCß phosphorylation, and FA oxidation were similar in lean and obese subjects. Moreover, AICAR increased AMPK2 activity, ACCß phosphorylation, and palmitate oxidation to a similar degree in muscle from lean and obese subjects. We conclude that the abnormal lipid metabolism and leptin resistance of skeletal muscle of obese subjects is not due to down-regulation of AMPK. In addition, the similar stimulation by AICAR of AMPK in skeletal muscle of lean and obese subjects suggests that direct pharmacological activation of AMPK may be a therapeutic approach for stimulating FA oxidation in the treatment of human obesity. |
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
AMP-activated protein kinase (AMPK) is an ß
-heterotrimer consisting of a catalytic subunit () and two noncatalytic subunits (ß, ). Whereas AMPK activity is dependent on Thr172 phosphorylation within the catalytic 1- and 2subunits, the noncatalytic ß- (ß1 and ß2) and (1, 2 and 3)-subunits are essential for optimum enzyme activity, regulation, and intracellular targeting (4). AMPK is an important regulator of FA metabolism in rodent skeletal muscle in which activation stimulates FA oxidation through phosphorylation of acetyl-coenzyme A carboxylase (ACCß) on Ser 221, leading to reduced malonyl-coenzyme A and increased FA flux into the mitochondria via carnitine palmitoyl transferase-1. AMPK also suppresses triglyceride (TG) esterification through inhibition of glycerol-3 phosphate acyl transferase (GPAT) (5) and was recently shown to mediate contraction-induced sarcolemmal FA uptake by translocating the FA translocase/CD36 to the plasma membrane (6). In addition, AMPK activation leads to increased uncoupling protein-3 expression (7) and mitochondrial biogenesis (8, 9).
We previously showed that skeletal muscle of obese subjects has increased total palmitate uptake and fails to show increased palmitate oxidation in response to leptin stimulation in vitro (1). In rodents, skeletal muscle AMPK is activated by humoral factors such as leptin (10) and adiponectin (11) and by the pharmacological AMPK activator 5-aminoimidazole-4-carboxamide riboside (AICAR). Leptin resistance in skeletal muscle of obese subjects suggests that skeletal muscle AMPK may be down-regulated in obesity. To address the hypothesis that lipid accumulation and leptin resistance of skeletal muscle of obese subjects may be due to downregulation of AMPK, we measured mRNA and protein levels of the AMPK catalytic (1 and 2) and regulatory (ß1, ß2, 1, 2, 3) subunit isoforms, AMPK1 and -2 activity, AMPK Thr172 phosphorylation, AMPK kinase (AMPKK) activity, ACCß expression and phosphorylation, and palmitate metabolism in biopsies of rectus abdominus muscle from lean and obese women. We also examined the effect of AICAR on AMPK activity and the effects of AICAR and leptin on FA metabolism.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
27.5 kg/m2, mean 24.1 ± 0.8 kg/m2) and nine obese (body mass index 
30.0 kg/m2, mean 33.3 ± 1.1 kg/m2) nondiabetic women. Subjects were admitted to McMaster Health Sciences Center for a variety of abdominal surgical procedures and gave informed written consent before participation. The study was approved by The University of Guelph and McMaster University Ethics Committees. None of the subjects had any diseases or had taken any medications known to alter carbohydrate or lipid metabolism in the previous 6 months, and they maintained a constant body mass during the previous year. Three obese women and two lean women were postmenopausal. Because menopausal status was without effect on muscle lipid metabolism, the data for pre- and postmenopausal subjects in each group were combined. After an overnight fast (12–18 h), general anesthesia was induced with a short-acting barbiturate and maintained by a fentanyl and rocuronium volatile anesthetic mixture. Rectus abdominus muscle biopsies were excised, a small aliquot of muscle (
200 mg) immediately frozen in liquid nitrogen, and muscle strips prepared and incubated for 20 min in a modified Kreb’s Henseleit buffer as previously described (1). Muscle strips were then transferred to vials containing 2 µCi [1-14C] palmitate (Amersham Biosciences, Arlington Heights, IL) for 60 min containing leptin (10 µg/ml), AICAR (2 mM), or saline vehicle. These concentrations were selected because they previously have been shown to elicit maximal stimulation of rodent skeletal muscle FA metabolism (12, 13). Palmitate oxidation and esterification were monitored by the production of 14CO2 and incorporation of [1-14C] palmitate into endogenous lipids, respectively, as described previously (14). Muscle strips were also incubated under the same conditions with or without AICAR to examine its effect on AMPK activity and ACCß phosphorylation, snap frozen, and stored in liquid nitrogen until further analysis as described below. Given the limited size of the muscle biopsies, not all experiments could be performed for each subject. Intramuscular contents of glycogen and metabolites
Skeletal muscle glycogen content was determined on freeze-dried samples, which were dissected free of all visible connective tissue and blood, and assayed using procedures previously described (15). ATP, ADP, AMP, and phosphocreatine were measured on freeze-dried, powdered muscle that was extracted with perchloric acid, neutralized, and analyzed by reverse phase HPLC (16).
AMPK-related measures
Muscle lysate preparation.
Frozen rectus abdominus muscle (100 mg) was homogenized in 700 µl ice-cold lysis buffer as described previously (17). Similarly, muscle strips incubated with or without AICAR were homogenized in 200 µl ice-cold lysis buffer. Homogenates were centrifuged at 14,000 x g for 25 min and an aliquot (100 µl) removed for the measurement of AMPKK activity and AMPK subunit expression after the determination of protein content by the bicinchoninic acid method (Bio-Rad Laboratories, Hercules, CA). Aliquots of the basal rectus abdominus muscle homogenate (500 µl) and homogenates of incubated muscle (150 µl) were removed for measurement of AMPK1 and -2 activities and ACCß expression and phosphorylation as described below.
AMPK subunit mRNA expression.
Total RNA was isolated from frozen rectus abdominus muscle (20 mg) using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. For each sample 3 µg RNA were reverse transcribed using the SuperScript II first-strand synthesis kit (Invitrogen) and oligo dT primers, in a final volume of 20 µl. Samples were diluted 1:100 in water and 1 µl used for quantification. Real-time quantitative RT-PCR was performed on an ABI Prism 5700 sequence detection system (Perkin-Elmer Applied Biosystems, Foster City, CA). Reactions were performed in triplicate in 10 mM Tris-HCl (pH 8.0), 2.5 mM Mg acetate, 50 mM KCl, 200 µM deoxynucleotide triphosphates, 1/40,000 dilution of SYBR Green I (Molecular Probes, Eugene, OR), 1 µg/ml 6-carboxy-X-rhodamine (Molecular Probes), 8% dimethylsulfoxide, 200 nM primers, and 0.625 U AmpliTaq Gold polymerase (Applied Biosystems) per 25-µl reaction. Samples were incubated at 95 C for 10 min followed by 50 cycles of 95 C for 15 sec and 60 C for 1 min. After amplification, the specificity of the PCR was determined by performing melt curve analysis from 60 to 95 C. Results were normalized against the RPL32 housekeeping gene, and relative gene expression was determined using the comparative cycle threshold method. The sequences of the forward (F) and reverse (R) primers are listed from 5' to 3' and are as follows: RPL32 (NM000994), (F) CAGGGTTCGTAGAAGATTCAAGGG, (R) CTTGGAGGAAACATTGTGAGCGATC; AMPK1 (NM006251), (F) CGGCAAAGTGAAGGTTGGCAAAC, (R) GCGGATTTTTCCTACCACATCAAGG; AMPK2 (NM006252), (F) ACGGGTTGAAGAGATGGAAGCCAG, (R) AATGGGAGGGTGCCACAAAGAAG; AMPKß1 (NM006253), (F) ACTCCGAGGAAATCAAGGCA, (R) GAGCACTTTTGGGAATCCAC; AMPKß2 (NM005399), (F) ACTCCGTAAAGCCCACACAG, (R) GAGGTCCAGGATGGCAACAA; AMPK1 (NM002733), (F) ACTACCACCCCCGTCTATGT, (R) GGCTTCTTCTCTCCACCTGT; AMPK2 (AF087875), (F) GCCTTCATACATCCAGACAC, (R) GCACTTCACAACACCTTCAA; and AMPK3 (AJ249977), (F) GGCAGAAGTCGGTGGAGGAA, (R) CAGTCAGAGGGGAGGCAGTC.
AMPK protein expression and activity and ACCß expression and phosphorylation
The expression level of AMPK subunits was determined by Western blot analysis. AMPK Thr172, 1, 2, ß1, ß2, and 1 antibodies were as described previously (18, 19). AMPK2 and -3 antibodies were raised against the peptide (rat 553–566 CLTPAGAKQKETETE) and the peptide (h59–75 RWTRQSVEEGEPPGQG), respectively. Muscle homogenates (200 µg protein) were loaded onto a 12% acrylamide gel. Membranes were blocked for 60 min in 5% skim milk in PBS, probed using 1 and 1 antibodies at a dilution of 1:500 in PBS, exposed to the secondary antibody protein G/horse radish peroxidase (1:1000 in PBS) for 60 min and visualized using enhanced chemiluminescence. Membranes were then stripped for 20 min by incubating with 0.5 N NaOH at room temperature, washed in PBS, blocked for 60 min, and then reprobed for 2- and ß2/ß1-, followed by 2-, 3-, and Thr172. AMPK1 and -2 activities and ACCß expression and phosphorylation were determined using procedures described previously (17).
AMPKK activity
AMPKK was measured using a two-step reaction with a maltose binding protein (MBP)-AMPK (1–312) fusion construct as substrate (20). The construct consists of the AMPK catalytic domain that is activated after phosphorylation of the activation loop Thr-172. For the first AMPKK reaction, 19 µl buffer [20 mM Tris-HCl (pH 7.5), 0.1% Tween 20, 10 mM dithiothreitol, 8 mM MgCl2 with 0.4 mM ATP, 0.12 mM AMP] containing 5 µM MBP-AMPK (1–312) were incubated with 11 µl of muscle homogenate at 30 C for 30 min. In the second reaction, MBP-AMPK (1–312) activity was determined using the SAMS [ACC (73–87)A77] peptide assay; 10 µl of the AMPKK reaction were added to the peptide phosphorylation reaction to give a final volume of 40 µl, comprising 50 mM HEPES (pH 7.5), 12 mM MgCl2, 5% glycerol, and 0.05% Triton X-100 with 1 mM dithiothreitol, 0.25 mM [-32P]ATP (500 cpm/pmol), 100 µM SAMS peptide, and 0.18 mM AMP. After incubation for 10 min at 30 C, 30-µl aliquots were applied to P81 papers as previously described (21), and activities (picomoles of phosphate transferred to the SAMS peptide per minute per milligram protein measured in the original muscle homogenate) were calculated.
Calculations and statistics
The quantity of palmitate esterified and oxidized was calculated from the specific activity of labeled palmitate in the incubation medium. All data are reported as mean ± SE. Results were analyzed using ANOVA procedures, and Tukey’s post hoc test was used to test for significant differences revealed by the ANOVA. Significance was accepted at P 0.05.
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
AMPK subunit mRNA and protein expression
AMPK subunit mRNA expression relative to lean subjects was not significantly altered with obesity (1, 117 ± 21%; 2, 117 ± 28.3%; ß1, 140 ± 17%; ß2, 98 ± 17%; 1, 100 ± 10%; 2, 63 ± 7%; 3, 76 ± 18%). Western blot analysis showed the AMPK subunits migrated to their expected molecular mass (1, 63 kDa; 2, 63 kDa; ß1, 40 kDa; ß2, 34 kDa; 1, 35 kDa; 2, 63 kDa; 3, 55 kDa; Thr172, 63 kDa). AMPK subunit protein expression relative to lean subjects was not significantly altered with obesity (1, 149 ± 13%; 2, 104 ± 20%; ß1, 99 ± 9%; ß2, 155 ± 26%; 1, 110 ± 19%; 2, 108 ± 18%; 3, 128 ± 21%; Thr172, 94 ± 4%).
Basal AMPK and AMPKK activity and ACCß expression and phosphorylation
Basal levels of AMPK activity, measured with and without saturating concentrations of AMP, were similar for skeletal muscle of lean and obese subjects (Fig. 1
). Moreover, obesity was without effect on basal AMPKK activity (lean, 0.24 ± 0.08 pmol/min·mg protein; obese, 0.24 ± 0.7 pmol/min·mg protein). Total ACCß protein (lean, 1.0 ± 0.38 arbitrary units; obese, 1.02 ± 0.16 arbitrary units) and ACCß phosphorylation (lean, 1.0 ± 0.14 arbitrary units; obese, 1.14 ± 0.24 arbitrary units) were similar in skeletal muscle from lean and obese subjects.
|
1 and -2 activity and ACCß phosphorylation
AICAR stimulated skeletal muscle AMPK2, but not AMPK1, activity to a similar degree for lean (+110%, P = 0.03) and obese (+100%, P = 0.03) subjects (Fig. 2). AICAR also produced a similar stimulation of ACCß phosphorylation for lean (+118%, P = 0.037) and obese (+49%, P = 0.007) subjects (Fig. 3).
|
|
Obesity was associated with higher rates of palmitate uptake (+70%, P = 0.03) and TG esterification (+119%, P = 0.04), although basal rates of palmitate oxidation were not different between skeletal muscle of lean and obese subjects (Fig. 4). Leptin stimulated palmitate oxidation in lean but not obese humans (lean, +44%, P = 0.024, obese, –6%) (Fig. 4A). In contrast to the leptin resistance of muscle from obese subjects, AICAR produced similar increases in skeletal muscle palmitate oxidation for lean and obese subjects (lean, +109%, P = 0.02; obese +59%, P = 0.052) (Fig. 4A). Leptin did not alter total palmitate uptake or TG esterification (Fig. 4, B and C, respectively). Whereas there was a trend for AICAR to stimulate total palmitate uptake (lean, +32%, P = 0.075; obese +26%, P = 0.052), AICAR had no effect on TG esterification. As we have previously demonstrated (1), skeletal muscle from obese subjects had elevated esterification/oxidation ratio (+53%, P = 0.045). Leptin treatment reduced this ratio in skeletal muscle from lean (–40%, P = 0.035) but not obese subjects, whereas AICAR reduced the esterification/oxidation ratio in muscle from both lean (–29%, P = 0.05) and obese (–31%, P = 0.033) subjects (Fig. 4D).
|
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
2 activity, ACCß phosphorylation, and FA oxidation in skeletal muscle from lean and leptin-resistant obese humans.
This is the first report of AMPK subunit isoforms mRNA and protein expression and AMPK1 and -2 activities in skeletal muscle of obese human subjects relative to lean controls. Previously, AMPK expression and activity have been demonstrated to be similar in both obese (22) and lean (23) type 2 diabetics when compared with nondiabetic subjects. In this study we demonstrate that AMPK mRNA and protein expression, ACCß expression, and phosphorylation and AMPKK and AMPK1 and -2 activity are preserved in obese human skeletal muscle, suggesting that, similar to observations in type 2 diabetics, alterations in AMPK expression do not contribute to the pathogenesis of lipid accumulation in skeletal muscle of obese humans.
To our knowledge this is the first report of the effects of AICAR on AMPK activity and FA metabolism in skeletal muscle from obese humans. Koistinen et al. (24) recently reported the effects of AICAR on glucose transport and GLUT4 translocation in type 2 diabetics, although isoform-specific AMPK activity was not reported. Our finding that AICAR stimulated AMPK2, but not AMPK 1, activity in human skeletal muscle suggests that activation of the 2-isoform is the preferable target for pharmacological activation of AMPK. This finding is in agreement with previous studies demonstrating that activation of the 2-subunit is critical for mediating the effects of exercise and AICAR on skeletal muscle FA metabolism in rodents (25). Moreover, a recent study demonstrated that skeletal muscle of AMPK2 null mice are insensitive to AICAR-stimulated glucose uptake (26).
Our finding that AICAR did not affect TG esterification in skeletal muscle is in contrast to the findings of Muoio et al. (5) for isolated rodent skeletal muscle, in which AICAR suppressed TG esterification, an effect attributed to reduced GPAT activity. The difference between these findings and our own may reflect a species-dependent difference in the regulation of GPAT in rodent and human skeletal muscle. Leptin similarly failed to influence TG esterification in our study, although we previously demonstrated an effect in rodent skeletal muscle (14). Future studies are required to examine whether AMPK phosphorylates and inhibits GPAT activity in human skeletal muscle.
Several lines of evidence indicate that pharmacological activation of skeletal muscle AMPK may be of therapeutic benefit in obesity because treatment of obese rodents with adiponectin (11) or AICAR (27) activates AMPK and stimulates skeletal muscle FA oxidation. Similarly, we found in obese human skeletal muscle that treatment with AICAR resulted in the stimulation of skeletal muscle AMPK2 activity, ACCß phosphorylation, and FA oxidation and reduction of the esterification/oxidation ratio, highlighting the potential role for chronic AMPK activation to reduce skeletal muscle lipid. Indeed, the stimulation of AMPK activity and reduction of im TG by metformin indicates that this may be an important mechanism by which AMPK activation improves skeletal muscle insulin sensitivity (28). Moreover, chronic leptin infusion in leptin-deficient humans with lipodystrophy reduces im lipid storage (29). Although AMPK activity was not reported for this study, we have demonstrated that chronic leptin infusion in rodents increases skeletal muscle AMPK2 expression, ACCß phosphorylation, and FA oxidation, leading to reduced im TG (30, 31). Despite these pronounced effects of leptin in rodents (30, 31) and leptin-deficient humans with lipodystrophy (29, 32), the effects of recombinant leptin treatment in human obesity appears to be minimal (33), which may be due to skeletal muscle leptin resistance (1, 14). Our demonstration that AICAR increases AMPK2 activity, ACCß phosphorylation, and FA oxidation in leptin-resistant skeletal muscle of obese human subjects emphasizes that the development of specific activators of AMPK may be an appropriate treatment to bypass skeletal muscle leptin resistance, leading to stimulation of skeletal muscle FA oxidation, reduced accumulation of im lipid, and improved skeletal muscle insulin sensitivity.
Our study had a number of limitations. We obtained muscle biopsies from anesthetized subjects, and the effect of anesthesia on skeletal muscle of human subjects is unknown. However, biopsies from lean and obese subjects were obtained under identical conditions. The limited number of subjects meant that we were unable to detect small differences between AMPK in skeletal muscle from lean and obese subjects. However, our study had sufficient statistical power to detect a 14% difference in basal AMPK activity and a 34% difference in AMPK response to AICAR stimulation. The limited size of the skeletal muscle biopsies prevented our examination of more than one stimulus of AMPK. Further studies are required to examine the effects of other stimuli such as leptin and adiponectin on AMPK in skeletal muscle of lean and obese subjects.
In conclusion, our findings indicate that the abnormal lipid metabolism and leptin resistance of skeletal muscle of obese subjects is not due to down-regulation of AMPK. Our demonstration that AICAR produces similar stimulation of AMPK in skeletal muscle of lean and obese subjects suggests that direct activation of AMPK above basal levels may be a valid therapeutic approach for stimulating FA oxidation in the treatment of human obesity.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: ACCß, Acetyl-coenzyme A carboxylase; AICAR, 5-aminoimidazole-4-carboxamide riboside; AMPK, AMP-activated protein kinase; AMPKK, AMPK kinase; F, forward; FA, fatty acid; GPAT, glycerol-3 phosphate acyl transferase; MBP, maltose binding protein; R, reverse; TG, triglyceride.
Received February 18, 2004.
Accepted June 8, 2004.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
2 activity and ACC phosphorylation during exercise. Am J Physiol 282:E688–E694
1 subunit. Biochem Biophys Res Commun 293:892–898[CrossRef][Medline]
-2 but not -1 5'AMP-activated protein kinase isoform abolishes AICAR but not contraction-induced glucose uptake in skeletal muscle. J Biol Chem 279:1070–1079
This article has been cited by other articles:
 |
|
 |
|
  G. R. Steinberg and B. E. Kemp AMPK in Health and Disease Physiol Rev, July 1, 2009; 89(3): 1025 - 1078. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. R. Steinberg, M. J. Watt, M. Ernst, M. J. Birnbaum, B. E. Kemp, and S. B. Jorgensen Ciliary Neurotrophic Factor Stimulates Muscle Glucose Uptake by a PI3-Kinase-Dependent Pathway That Is Impaired With Obesity Diabetes, April 1, 2009; 58(4): 829 - 839. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Kola, M. Christ-Crain, F. Lolli, G. Arnaldi, G. Giacchetti, M. Boscaro, A. B. Grossman, and M. Korbonits Changes in Adenosine 5'-Monophosphate-Activated Protein Kinase as a Mechanism of Visceral Obesity in Cushing's Syndrome J. Clin. Endocrinol. Metab., December 1, 2008; 93(12): 4969 - 4973. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Dzamko, J. D. Schertzer, J. G. Ryall, R. Steel, S. L. Macaulay, S. Wee, Z.-P. Chen, B. J. Michell, J. S. Oakhill, M. J. Watt, et al. AMPK-independent pathways regulate skeletal muscle fatty acid oxidation J. Physiol., December 1, 2008; 586(23): 5819 - 5831. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Pieter de Lange, M. Moreno, E. Silvestri, A. Lombardi, F. Goglia, and A. Lanni Fuel economy in food-deprived skeletal muscle: signaling pathways and regulatory mechanisms FASEB J, November 1, 2007; 21(13): 3431 - 3441. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Cuthbertson, J. A. Babraj, K. J.W. Mustard, M. C. Towler, K. A. Green, H. Wackerhage, G. P. Leese, K. Baar, M. Thomason-Hughes, C. Sutherland, et al. 5-Aminoimidazole-4-Carboxamide 1-{beta}-D-Ribofuranoside Acutely Stimulates Skeletal Muscle 2-Deoxyglucose Uptake in Healthy Men Diabetes, August 1, 2007; 56(8): 2078 - 2084. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. C. Smith, K. L. Mullen, K. A. Junkin, J. Nickerson, A. Chabowski, A. Bonen, and D. J. Dyck Metformin and exercise reduce muscle FAT/CD36 and lipid accumulation and blunt the progression of high-fat diet-induced hyperglycemia Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E172 - E181. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. R. Steinberg, A. J. McAinch, M. B. Chen, P. E. O'Brien, J. B. Dixon, D. Cameron-Smith, and B. E. Kemp The Suppressor of Cytokine Signaling 3 Inhibits Leptin Activation of AMP-Kinase in Cultured Skeletal Muscle of Obese Humans J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3592 - 3597. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. K. Bandyopadhyay, J. G. Yu, J. Ofrecio, and J. M. Olefsky Increased Malonyl-CoA Levels in Muscle From Obese and Type 2 Diabetic Subjects Lead to Decreased Fatty Acid Oxidation and Increased Lipogenesis; Thiazolidinedione Treatment Reverses These Defects. Diabetes, August 1, 2006; 55(8): 2277 - 2285. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. L. Martin, T. Alquier, K. Asakura, N. Furukawa, F. Preitner, and B. B. Kahn Diet-induced Obesity Alters AMP Kinase Activity in Hypothalamus and Skeletal Muscle J. Biol. Chem., July 14, 2006; 281(28): 18933 - 18941. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Reznick and G. I. Shulman The role of AMP-activated protein kinase in mitochondrial biogenesis J. Physiol., July 1, 2006; 574(1): 33 - 39. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Lessard, Z.-P. Chen, M. J. Watt, M. Hashem, J. J. Reid, M. A. Febbraio, B. E. Kemp, and J. A. Hawley Chronic rosiglitazone treatment restores AMPK{alpha}2 activity in insulin-resistant rat skeletal muscle Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E251 - E257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Jamieson, M. M. W. Chong, G. R. Steinberg, V. Jovanovska, B. C. Fam, D. V. R. Bullen, Y. Chen, B. E. Kemp, J. Proietto, T. W. H. Kay, et al. Socs1 Deficiency Enhances Hepatic Insulin Signaling J. Biol. Chem., September 9, 2005; 280(36): 31516 - 31521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Tanaka, S. Hidaka, H. Masuzaki, S. Yasue, Y. Minokoshi, K. Ebihara, H. Chusho, Y. Ogawa, T. Toyoda, K. Sato, et al. Skeletal Muscle AMP-Activated Protein Kinase Phosphorylation Parallels Metabolic Phenotype in Leptin Transgenic Mice Under Dietary Modification Diabetes, August 1, 2005; 54(8): 2365 - 2374. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. B. Chen, A. J. McAinch, S. L. Macaulay, L. A. Castelli, P. E. O'Brien, J. B. Dixon, D. Cameron-Smith, B. E. Kemp, and G. R. Steinberg Impaired Activation of AMP-Kinase and Fatty Acid Oxidation by Globular Adiponectin in Cultured Human Skeletal Muscle of Obese Type 2 Diabetics J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3665 - 3672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. B. Taylor, W. J. Ellingson, J. D. Lamb, D. G. Chesser, and W. W. Winder Long-chain acyl-CoA esters inhibit phosphorylation of AMP-activated protein kinase at threonine-172 by LKB1/STRAD/MO25 Am J Physiol Endocrinol Metab, June 1, 2005; 288(6): E1055 - E1061. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. P Wojtaszewski, J. B Birk, C. Frosig, M. Holten, H. Pilegaard, and F. Dela 5'AMP activated protein kinase expression in human skeletal muscle: effects of strength training and type 2 diabetes J. Physiol., April 15, 2005; 564(2): 563 - 573. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
