help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ward, B. K.
Right arrow Articles by Ratajczak, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ward, B. K.
Right arrow Articles by Ratajczak, T.
The Journal of Clinical Endocrinology & Metabolism Vol. 89, No. 8 3721-3730
Copyright © 2004 by The Endocrine Society


Clinical Case Seminar

Functional Deletion of the Calcium-Sensing Receptor in a Case of Neonatal Severe Hyperparathyroidism

Bryan K. Ward, Aaron L. Magno, Elizabeth A. Davis, Aylin C. Hanyaloglu, Bronwyn G. A. Stuckey, Mark Burrows, Karin A. Eidne, Adrian K. Charles and Thomas Ratajczak

UWA Centre for Medical Research (B.K.W., A.L.M., A.C.H., K.A.E., T.R.), the University of Western Australia, Nedlands, Western Australia 6009; Department of Endocrinology and Diabetes (B.K.W., A.L.M., B.G.A.S., T.R.), Sir Charles Gairdner Hospital, Nedlands, Western Australia 6009; and Departments of Endocrinology (E.A.D., M.B.) and Pathology (A.K.C.), Princess Margaret Hospital, Subiaco, Western Australia 6008

Address all correspondence and requests for reprints to: Thomas Ratajczak, Department of Endocrinology and Diabetes, Block C, Queen Elizabeth II Medical Centre, Hospital Avenue, Nedlands, Western Australia 6009, Australia. E-mail: tomr{at}cyllene.uwa.edu.au.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Heterozygous inactivating mutations of the calcium-sensing receptor (CaR) cause familial hypocalciuric hypercalcemia, whereas homozygous or compound heterozygous inactivating mutations normally cause neonatal severe hyperparathyroidism. In a case of neonatal severe hyperparathyroidism characterized by moderately severe hypercalcemia and very high PTH levels, coupled with evidence of hyperparathyroidism and effects on brain development not previously demonstrated, we detected point mutations on separate alleles of the CaR, resulting in premature stop codon substitutions at G94 and R648. This led to severely truncated receptors and an effective so-called knockout of functional CaR. FLAG-tagged, truncated receptors were expressed in HEK293 cells for functional analysis. Confocal microscopy demonstrated cytoplasmic localization of the G94stop receptor, whereas the R648stop receptor was present both in the cytoplasm and associated with the cell membrane. Only the R648stop receptor could be detected by Western analysis. Functional assays in which R648stop and wild-type receptor were cotransfected into HEK293 cells demonstrated a reduction in wild-type Ca2+-responsiveness by the R648stop receptor, even at physiological Ca2+ levels, thus simulating familial hypocalciuric hypercalcemia in relatives of the infant who were heterozygous for the R648stop mutation. The R648stop receptor alone was nonresponsive to Ca2+. This case contributes to our understanding of the clinical manifestation of a CaR knockout.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
THE CALCIUM-SENSING RECEPTOR (CaR) is a cell surface-expressed G protein-coupled receptor first cloned from bovine parathyroid tissue (1). The 1078-amino-acid human CaR is highly homologous with the bovine CaR and, characteristic of all G protein-coupled receptors, contains three functionally significant domains—a large (612 amino acid) extracellular ligand binding domain, a seven-transmembrane domain that gives rise to three extracellular and three cytoplasmic loops, and a 216-amino-acid intracellular tail (2, 3). The G proteins (Gq/i) involved in signal transduction are presumed to bind to one or more of the cytoplasmic loops and/or the intracellular tail. In the most extensively documented CaR pathway, agonist stimulation of receptor coupled to Gq activates phosphoinositide-specific phospholipase C (PI-PLC) resulting in the release of Ca2+ from intracellular stores (4). CaR is abundantly expressed in the parathyroid glands and kidney, where it plays a key role in the maintenance of Ca2+ homeostasis through Ca2+-mediated regulation of PTH release and renal tubular Ca2+ reabsorption via the PI-PLC pathway. Cell surface-expressed receptors are linked by disulfide bonds or other intermolecular interactions, to form dimers that enable cooperative interaction in Ca2+-sensing (5, 6, 7). Moreover, mutant receptors can heterodimerize with wild-type receptor and, in some cases, appear to exert a dominant negative effect on wild-type receptor activation (8, 9).

The disorders of calcium homeostasis, familial hypocalciuric hypercalcemia (FHH) and neonatal severe hyperparathyroidism (NSHPT), were first linked to mutations in the CaR a decade ago (10), with FHH found to result from inactivating mutations affecting a single allele, and NSHPT from inactivating mutations affecting both alleles. Due to the comparative rarity of mutations in the CaR, NSHPT most commonly arises as a result of consanguinous unions within FHH families, giving rise to the homozygous form of the disease. However, compound or single heterozygous mutations may occasionally give rise to NSHPT (9, 11, 12). Mutations linked to these disorders of calcium sensing are usually single-point in nature and commonly occur in that part of the CaR gene that encodes the extracellular sensing domain where they most likely disrupt ligand binding or in the transmembrane domain where they are likely to interfere with signal transduction. The heterozygous mutations that are associated with FHH result in an elevated set-point for calcium sensing, giving rise to generally asymptomatic, lifelong, mild to moderate hypercalcemia accompanied by lower-than-expected urinary calcium concentrations and generally normal circulating PTH levels. Patients with FHH are thus relatively insensitive to Ca2+-mediated PTH suppression, maintaining their PTH levels in the normal range despite hypercalcemia. The elevated set-point for calcium sensing also affects the renal tubular handling of calcium with patients unable to increase urinary excretion of Ca2+ ions in response to hypercalcemia (3, 4). On the other hand, parathyroids from NSHPT patients show a markedly higher set-point for calcium responsiveness, and this condition is associated with parathyroid gland hyperplasia, severe hypercalcemia, and elevated circulating PTH levels accompanied by symptoms in the neonate, which include failure to thrive, dehydration, respiratory distress, hypotonia, skeletal undermineralization, and significant mortality. Urgent surgical intervention in the form of parathyroidectomy and appropriate follow-up treatment is normally required to correct the condition (13). We show here a case of NSHPT involving compound heterozygous mutations of the CaR that led to an effective knockout of functional receptor.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Biochemical and histopathological analysis

Family members were studied after an overnight fast allowing water, or in the nonfasting state. Total calcium and albumin were measured in plasma using standard Technicon methods on a SMAC II analyzer (Technicon Corp., Tarrytown, NY) or in a Vitros 250 biochemistry analyzer (Ortho-clinical Diagnostics, Raritan, NJ). Serum-ionized calcium was measured using a Radiometer ICA I ionized calcium analyzer (Radiometer A/S, Copenhagen, Denmark) or in a Bayer blood gas analyzer (Bayer Corp., Leverkusen, Germany). Calcium and creatinine were measured in urine using standard Technicon methods on an RA-1000 analyzer (Technicon) or in a Vitros 250 biochemistry analyzer. Serum PTH was measured using a midmolecule region-specific antibody (Ab) (IRE AS-17; Institut National des Radioelements, Fleuris, Belgium), or by immunochemiluminescence using an Immulite 2000 analyzer (Diagnostic Products Corp., Los Angeles, CA).

Parathyroid tissue pieces from the neonate were embedded in optimal cutting temperature medium, snap-frozen in liquid nitrogen, and sections were prepared according to standard histological practice.

Mutational analysis of the CaR gene

Ethics approval for this study and consent from participants or their guardians were obtained according to local institutional guidelines. DNA was extracted from whole blood from the infant and other family members using the GFX method (Amersham Biosciences, Buckinghamshire, UK) or other standard procedures. In the case of the infant, the entire coding region of the CaR gene was amplified by PCR, as approximately 200- to 600-bp segments, using previously described primers (10, 11). Typically, 50-µl reactions consisted of: 1x Taq DNA polymerase buffer (Promega Corp., Madison, WI) containing 250 ng template DNA, 35 pmol of each primer, 200 µM deoxynucleotide triphosphates, either 2 or 3 mM MgCl2 and 1.5 U Taq DNA polymerase added as a hot start at the end of a preliminary denaturation step (4 min, 30 sec; at 94 C). This was followed by 30–35 cycles of denaturation for 45 sec at 94 C, annealing for 45 sec at 68 C (for all primer sets except 3AF/4CR, which was at 65 C), and extension for 1 min at 72 C. PCR products were purified using the QIAEX II gel extraction kit (QIAGEN, Germantown, MD) and concentrated using 100,000 molecular weight cut-off Centricon centrifugal filters (Millipore Corp., Bellerica, MA). Sequencing of the purified PCR product was performed in both directions, with the initial primers used for PCR product generation, using the Big Dye terminator ready reaction sequencing kit (PerkinElmer Life Sciences, Norwalk, CT). Apparent mutational changes were confirmed by repeat PCR and sequence analysis. Rapid restriction enzyme tests were developed for two mutations detected (a G94stop mutation abolished a single XcmI restriction enzyme recognition site in the 366-bp product in which it was detected, whereas a R648stop mutation introduced a single DdeI restriction enzyme recognition site in the 646-bp product in which it was detected). These tests were used to confirm the presence of the mutations in the infant and to screen for them in the PCR-amplified products from other family members and 50 normocalcemic controls to exclude the possibility of the mutations being common polymorphisms.

Examination of mutational status of alleles from the infant

RNA was extracted using the RNeasy mini RNA extraction kit (QIAGEN) from approximately 20 microtomed sections (20-µm thick) of optimal cutting temperature-enveloped frozen sections of parathyroid tissue collected from the infant at surgery. RT was performed with approximately 40 ng template RNA using the Sensiscript RT kit (QIAGEN) according to the manufacturer’s instructions, except that random hexamer primers, instead of oligo (dT) primers, were used (at a concentration of 12.5 µg/ml) and incubation was increased to 2 h at 37 C. A region of 1897 bp of the CaR sequence, incorporating the sites for both mutations at either end, was amplified by PCR from the generated cDNA using HotStarTaq DNA polymerase (QIAGEN) and the following primers: 5'-CCGGAGTCTGTGGAATGTATCAGG-3' (sense) and 5'-CTGATGCCAAAGGCCGGCTGGCGC-3' (antisense). Each 50-µl reaction contained 1x PCR buffer, 1.5 mM MgCl2, 200 µM deoxynucleotide triphosphates, 40 pmol of each primer, 1.7 U HotStarTaq DNA polymerase, and 3 µl of the cDNA template. After the initial enzyme activation step at 95 C for 15 min, amplification involved 42 cycles of denaturation for 1 min at 94 C, annealing for 1 min at 68 C, and extension for 1 min 50 sec at 72 C, followed by 1 cycle for 10 min at 72 C. The PCR product was gel-purified using the QIAEX II gel extraction kit and cloned into pDrive PCR cloning vector (QIAGEN). DNA extracted from 11 recombinant clones was then subjected to 5' and 3' sequence analysis of the CaR insert using the pUC/M13 forward and reverse primer sites situated on either side of the cloning site in the pDrive cloning vector.

Construction of FLAG-tagged, wild-type, and truncated CaR plasmid constructs

Constructs were generated from the human CaR (2), cloned into the HindIII and XbaI restriction enzyme sites of the pcDNA1/Amp expression vector (pcDNA1/hCaR) obtained from Dr. Ed Nemeth (NPS Pharmaceuticals, Salt Lake City, UT). For the FLAG-tagged G94stop and R648stop truncation mutants, forward primers containing the unique restriction enzyme recognition sites for HindIII and BsrGI, respectively, were designed along with reverse primers containing, in the 5' to 3' direction, the XbaI recognition sequence, the mutant stop codon sequence, the sequence encoding the FLAG peptide (GACTACAAGGACGACGATGACAAG), and hCaR sequence (24 or 25 bases, respectively) adjacent to the mutant stop codon. After PCR amplification using these primers and the wild-type pcDNA1/hCaR recombinant as template, the resultant, appropriately digested PCR products were cassetted back into HindIII/XbaI and BsrGI/XbaI digested pcDNA1/hCaR vector, respectively. Sequence fidelity of the insert was checked by sequence analysis using internal CaR primers. The wild-type FLAG-tagged CaR was constructed in a similar fashion, except that the forward primer contained the unique SmaI recognition site, and the reverse primer contained, in the 5' to 3' direction, the XbaI recognition sequence, the wild-type termination codon sequence, the sequence encoding the FLAG peptide, and hCaR sequence (24 bases) adjacent to the wild-type termination codon. For some experiments, FLAG-tagged CaR constructs were subcloned into the vector pcDNA3.1 (Invitrogen Corp., Carlsbad, CA) for expression.

Cell culture and transfections

HEK293 cells were propagated overnight in 5% CO2 at 37 C in 25-cm2 flasks in DMEM medium containing 10% fetal calf serum (FCS) without antibiotics until about 90% confluent, and were then transfected with DNA for FLAG-tagged wild-type or truncated CaR DNA, using Lipofectamine 2000 (Invitrogen) and Opti-MEM 1 reduced serum medium (Invitrogen) according to the manufacturer’s instructions. Flasks were incubated, for 48 h, for detection of total expressed CaR by Western analysis. For the total inositol phosphate (IP) assay, after incubation overnight, transfected cells were trypsinized and distributed, in DMEM containing 10% FCS without antibiotics, to 24-well poly-L-lysine-coated plates and incubated until cells were adherent. For confocal microscopy, HEK293 cells were propagated as described above in 100-mm Petri dishes, then transfected with 5.0 µg DNA for FLAG-tagged wild-type or truncated CaR using PolyFect transfection reagent (QIAGEN) according to the manufacturer’s instructions. After 24 h, cells were plated onto poly-L-lysine-coated eight-well chamber slides for confocal microscopy (performed next day).

Western analysis

Cell monolayers were washed twice in chilled PBS and whole protein extracted with chilled lysis buffer (150 mM NaCl, 10 mM EDTA, 1 mM EGTA, 1% Triton X-100, 20 mM Tris, pH 6.8) containing protease inhibitors and 100 mM iodoacetamide, the latter included to prevent protein aggregation (14). Cells were sheared through a 25-gauge needle 10 times, then centrifuged at maximum speed in a microfuge for 30 min at 4 C. Extracted protein contained in the supernatant was quantitated using a bicinchoninic acid-based protein assay kit (Pierce, Rockford, IL) and 50 µg separated on 7.5% SDS-PAGE gels under reducing conditions (samples were suspended in a final concentration of approximately 300 mM ß-mercaptoethanol in sample loading buffer and were not heated before loading). Proteins were blotted overnight at 4 C onto a Hybond-C super nitrocellulose membrane (Amersham Biosciences) using a mini Trans-blot electrophoretic transfer cell (Bio-Rad, Hercules, CA). Efficiency of transfer and evenness of loading were checked by staining the membrane in 0.5% Ponceau dye. FLAG-tagged CaR protein was detected by first blocking the membrane with 3% skim milk powder in Tris-buffered saline (TBS) (20 mM Tris, 137 mM NaCl, pH 7.6), then incubating with anti-FLAG M2 Ab (Sigma-Aldrich, St. Louis, MO; 4.9 µg/µl) at a concentration of 1:10,000 in TBS containing 3% skim milk powder for 30 min at room temperature. After rinsing, the membrane was incubated with secondary Ab comprising horseradish peroxidase-conjugated goat antimouse IgG (Sigma-Aldrich) at a concentration of 1:10,000 in TBS containing 3% skim milk powder for 30 min at room temperature. The membrane was then washed eight times in TBS containing 0.1% (vol/vol) Tween 20, and protein bands were developed using Western Lightning chemiluminescence reagent (PerkinElmer Life Sciences) and exposure to Hyperfilm (enhanced chemiluminescence) (Amersham Biosciences).

Confocal microscopy

At 48 h after transfection, HEK293 cells attached to slides were fixed in 4% paraformaldehyde, blocked (1% BSA/10% goat serum in PBS) and permeabilized (1% BSA/10% goat serum/0.2% Nonidet P-40 in PBS). Cells were incubated with 1:250 anti-FLAG M2 Ab in blocking solution overnight at 4 C. After washing in PBS, goat antimouse Alexa Fluor488 Ab (Molecular Probes, Eugene, OR) was added at a dilution of 1:300. The slide was mounted in FluoroGuard (Bio-Rad) and sealed with coverslips. Cells were examined under a 60x NA 1.4 oil immersion lens (Nikon Corp., Tokyo, Japan) using a Bio-Rad MRC-1000/1024 UV confocal laser scanning microscope with a filter selective for fluorescein isothiocyanate. Optical sections (1.0 µm) were taken, and representative sections corresponding to the middle of the cells are presented.

IP assays

As a measure of CaR responsiveness, total IPs were extracted and separated as described previously (15). Briefly, 24 h after transfection, adherent cells in 24-well plates were incubated for 20 h with inositol-free DMEM containing 1% dialyzed FCS and 2 µCi/ml [3H]myoinositol (Amersham Biosciences). The medium was then removed, and cells were washed twice with buffer A (1 mg/ml fatty acid free BSA, 140 mM NaCl, 4 mM KCl, 8 mM D-glucose, 1 mM MgCl2, 0.5 mM CaCl2, 20 mM HEPES, pH 7.2) followed by incubation with buffer A containing 10 mM LiCl with or without addition of CaCl2 at 37 C for 45 min. The assay buffer was removed and cells incubated at 4 C for 30–60 min with 10 mM formic acid. The extracted material was then transferred to tubes containing Dowex (AG 108) anion-exchange resin (Bio-Rad), whereas the cell layer underneath was solubilized in 0.2 M NaOH/1% sodium dodecyl sulfate for 2 h at room temperature. The resin containing total IPs was then successively washed in distilled water, then 60 mM ammonium formate/5 mM sodium tetraborate solution. IPs were eluted from the washed resin with 1 M ammonium formate/0.1 M formic acid. The radioactivity of the eluted IPs and the solubilized cellular material (used to calculate total count) were then counted in a TRI-CARB 2000 liquid scintillation analyzer (United Technologies Packard, Zurich, Switzerland). Treatments were performed in triplicate in three separate experiments.

Calculations and statistical methods

Total IP counts for each treatment were expressed as a ratio of total [3H]myoinositol uptake and the mean values for nontreated subtracted from the mean of treated samples (see Fig. 4AGo). These values were then expressed as the percentage of maximal response, which in all experiments was observed with cells transfected with 5.25 µg wild-type DNA. Histograms represent the mean of the percentage values for three experiments for each treatment; bars represent SEM. Where relevant, statistical significance between the response to wild-type CaR (5.25 µg) and that for other wild-type/R648stop CaR combinations was assessed using a one sample t test, comparing treatment percent response against 100% (SPSS for Windows, version 11.5) (P values < 0.05 were considered to be statistically significant). Then (see Fig. 4BGo), total IP counts for each dose were expressed as a ratio of total [3H]myoinositol uptake and the mean value for each dose expressed as a percentage of the maximal response (seen in all cases with wild-type receptor and 20 mM Ca2+). Points on the curves represent the mean of the percentage values for three experiments for each dose; bars represent SEM.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 4. A, Response to 10 mM Ca2+ as a percentage of maximal response (seen with 5.25 µg wild-type receptor DNA) for various combinations of wild-type and R648stop mutant receptor DNA transfected into HEK293 cells. B, Response curves for wild-type, R648stop and combined wild-type and R648stop receptor constructs expressed in HEK293 cells and dosed with varying concentrations (0, 1, 2, 4, 6, 8, 10, and 20 mM) of Ca2+ ions. For these transfections, 5.25 µg DNA of wild-type and R648stop CaR was used either alone or in combination for the cotransfection. For both experiments, calcium responsiveness was assessed by measuring the accumulation of total IPs as described in Subjects and Methods. To correct for possible inhibitory effects of DNA on transfection, where necessary, treatments were supplemented with an amount of empty vector to bring the final amount of DNA to 10.5 µg.

 

    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Case history of the neonate

A 5-month-old male infant presented at The Princess Margaret Hospital for Children, Perth, Western Australia, with a history of failure to thrive, hypotonia, irritability, and developmental delay. Length was on the tenth centile and weight and head circumference below the third centile. Initial biochemical investigations demonstrated a plasma total calcium level of 4.48 mmol/liter (normal range, 2.15–2.75 mmol/liter), an ionized Ca2+ level of 2.51 mmol/liter (normal range, 1.13–1.32 mmol/liter), hypocalciuria with a urinary calcium to creatinine ratio less than 0.06 mol/mol (normal range, 0.09–2.00 mol/mol), and a PTH level of 48 pmol/liter (normal range, 0.8–8.0 pmol/liter). Skeletal x-rays showed generalized osteopenia best illustrated in the phalanges of the hand (Fig. 1AGo), where there was marked cortical thinning along with intracortical tunneling and subperiosteal resorption. There were no noticeable fractures. The infant was managed with forced saline diuresis, followed 24 h later by iv pamidronate (20 mg/m2 over 4 h). Two days subsequent to treatment, when plasma total calcium levels had returned to almost normal levels, a total parathyroidectomy was performed. Parathyroid gland tissue collectively weighed 27.4 mg (mean total parathyroid gland weight for 3-month-old infant is 5–9 mg). Histologically, the glands were composed predominantly of chief cells as typically occurs in infants. Enlargement of the glands in this case was consistent with parathyroid chief cell hyperplasia. The infant’s postoperative course was uncomplicated, with treatment on calcium and calcitriol maintaining calcium and phosphate levels in the normal range. Postoperatively, his PTH level was undetectable. Immediately postoperatively, he was noted to be more alert and have improved muscle tone, and he became more interactive and less irritable over the following weeks. There has been continued improvement in the development and muscle tone of this infant. Associated with this has been an increase in growth velocity, sustained weight gain, and relative increase in head circumference with the crossing of centiles. Interestingly, a cranial computerized tomography (CT) scan of the infant at 6 months showed a paucity of deep white matter bilaterally compared with a normal infant brain (Fig. 1Go, B and C). This was most prominent in the occipital and parietal regions and is consistent with delayed myelination. During the course of his recovery, it had come to light that the infant was part of a family in which a number of members on the maternal side had biochemical features suggestive of FHH (Table 1Go). Although consanguinity was not suspected, the biochemical, histological, and clinical features were consistent with NSHPT, so a mutational analysis of the CaR gene of the infant was performed.



View larger version (147K):
[in this window]
[in a new window]
 
FIG. 1. Effects on the skeleton and brain observed in an infant with NSHPT. A, X-ray of left hand of the infant at 5 months, demonstrating changes consistent with hyperparathyroidism, including cortical thinning, prominent intracortical tunneling, and subperiosteal resorption involving the phalanges. B, CT scan of the infant at 6 months, demonstrating generalized bilateral paucity of deep white matter; C, matching scan of a normal infant brain.

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Biochemical characteristics of family members affected or unaffected with FHH/NSHPT

 
Mutational analysis of the CaR gene of the neonate

Heterozygous sequence analysis of the entire coding region of the CaR of the infant with NSHPT demonstrated a G to T transversion at nucleotide 280 in exon 2 (2), leading to a premature stop codon substitution at G94 (G94stop) as well as a C to T transition at nucleotide 1942 in exon 7, resulting in a premature stop codon substitution at R648 (R648stop) (Fig. 2AGo). One of the two mutations, the C to T transition at nucleotide 1942, was also found by heterozygous sequence analysis in the CaR coding region of the infant’s great aunt and mother (Fig. 2BGo, family members H and W, respectively) (results not shown). This mutation introduces a DdeI recognition site, allowing the rapid screening of a large number of maternal relatives, with and without biochemically determined FHH, for the presence of the mutation. This test revealed complete cosegregation of the mutant allele with FHH status (Fig. 2BGo). It also confirmed that the infant is not homozygous for the R648stop mutation. The G94stop mutation abolishes an Xcm1 restriction enzyme site. Restriction enzyme digestion confirmed the presence of the mutation in one allele of the infant and also revealed that the mutation was not present in the infant’s mother. In addition, examination of 50 normocalcemic individuals for the presence of both these mutations, using these screening tests, revealed that neither mutation existed as a common polymorphism in the Australian population (results not shown).



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 2. A, Heterozygous sequence analysis of segments of the CaR of the infant with NSHPT, demonstrating two single nucleotide mutations (N): i, a G to T transversion at nucleotide 280 of exon 3, resulting in a premature stop codon substitution at G94; and ii, a C to T transition at nucleotide 1942 of exon 7, resulting in a premature stop codon substitution at R648. Wild-type sequence is shown at left for i and ii. B, Family pedigree and mutational analysis by DdeI restriction enzyme digestion of the exon 7 PCR product from the case of NSHPT (filled symbol, Y) and 13 maternal family members with and without biochemically diagnosed FHH (hatched and gray symbols, respectively), showing complete cosegregation of the mutant allele (C to T alteration at nucleotide 1942) with FHH status. The mutation introduces a DdeI site in the 646-bp PCR product of one allele, resulting in the generation of two extra bands of 391 and 255 bp. Unfilled symbols represent family members not available for biochemical or genetic testing. Family member A was not genetically tested. The identity of V was not disclosed. C, Sequence analysis of clones obtained by RT-PCR of a 1897-bp region (incorporating the sites for both mutations) of CaR mRNA of the infant. Clones, in pDrive cloning vector, were sequenced with either the pUC/M13 forward or reverse primer and fell into two categories: i, those containing the G to T substitution at nucleotide 280 and no change from wild-type at nucleotide 1942; and ii, those containing no change from wild-type at nucleotide 280 and the C to T substitution at nucleotide 1942 (viewed here as G to A by reverse primer sequencing). Corresponding wild-type sequence, sense for the region containing the nucleotide 280 mutation and antisense for that containing the nucleotide 1942 mutation, is shown above the chromatographic sequence. Numbers in brackets indicate the number of each type of clone found of the 11 examined.

 
Because DNA was not available from the father for mutational analysis and because heterozygous sequence analysis cannot distinguish between alleles in regards to the presence of mutations, there remained the possibility that the G94stop and R648stop mutations were present on the one allele and that some other aberration in addition to a single truncated receptor was responsible for the NSHPT. To confirm that the two mutations were present on separate alleles, we performed RT-PCR analysis on RNA extracted from the infant’s parathyroid tissue. PCR products, each representing a single allele and incorporating the sites for the mutations at either end, were cloned into a PCR cloning vector and then sequenced at the 5' and 3' ends to determine which mutations were present. Of the 11 clones examined, four contained the G94stop mutation at one end and wild-type sequence at the other end corresponding to the R648stop site, and seven contained the R648stop mutation at one end and wild-type sequence corresponding to the G94stop mutation site at the other (Fig. 2CGo). None of the clones contained both mutations, and none of the clones were free of mutations. These results demonstrate that the two mutations are located on separate alleles and would therefore give rise to two truncated receptors and no wild-type receptor protein.

Expression and functional analysis of the R648stop and G94stop-truncated receptors in HEK293 cells

To determine the functional consequences of these mutations, the mutants were generated in human CaR (cloned into the expression vectors pcDNA1/Amp or pcDNA3.1), C-terminally FLAG-tagged, transfected into HEK293 cells, and examined for expression by confocal microscopy and Western analysis using anti-FLAG M2 Ab. Calcium responsiveness was assessed by means of an IP assay that measures total IPs. Wild-type, FLAG-tagged CaR was included in all experiments for comparison. In addition, the FLAG epitope in wild-type receptor was found not to affect receptor expression or its ability to activate the PI-PLC pathway (results not shown). Confocal microscopy demonstrated significant cell surface expression of receptor for both wild-type and R648stop mutated CaR as well as a considerable amount of cytoplasmic expression (Fig. 3AGo). On the other hand, the G94stop-mutated CaR appeared, in most cases, to be expressed only within the cytoplasm; there was little evidence of cell surface expression. In addition, compared with wild-type, only about 50–65% of the number of cells were observed to express receptor for R648stop and G94stop-mutated CaR. Western analysis demonstrated both monomeric (mature and immature glycosylated) and dimeric forms of the FLAG-tagged, wild-type receptor; and, whereas the R648stop-truncated receptor showed a strong dimeric form, only a single, relatively weak monomeric band could be distinguished (Fig. 3BGo). The wild-type receptor was significantly better expressed overall than the R648stop-mutated receptor. Approximately 20 times as much DNA was required in transfection reactions for the latter to achieve similar band intensities to the wild-type. We were unable to detect any FLAG-tagged, G94stop-truncated receptor by Western analysis, even when transfecting 10 µg DNA (results not shown).



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 3. A, Confocal microscopic examination of FLAG-tagged wild-type, G94stop, and R648stop-truncated CaR expressed in HEK293 cells and control untransfected HEK293 cells demonstrating relative expression and localization of receptor. At 48 h after transfection (5.0 µg DNA for each treatment), cells plated onto slides were fixed, permeabilized, and incubated overnight with anti-FLAG M2 primary Ab, then with goat antimouse Alexa Fluor488 secondary Ab for examination in a cofocal laser microscope as described in Subjects and Methods. B, Western blot analysis of FLAG-tagged wild-type (lane 1) and R648stop-truncated (lane 2) CaR expressed in HEK293 cells, demonstrating overall expression of dimeric (D) and monomeric (M) receptor forms. Untransfected HEK293 cells are shown in lane 3; molecular mass (expressed as kilodaltons) is indicated. For the transfections, 1 µg wild-type and 10 µg R648stop DNA were transfected into HEK293 cells, incubated for 48 h, and total proteins extracted and FLAG-tagged CaR protein detected using anti-FLAG M2 Ab as described in Subjects and Methods.

 
When calcium responsiveness was determined by the IP assay using a single dose of Ca2+ ions (10 mM), as little as 0.5 µg wild-type DNA transfected into HEK293 cells produced a measurable response, whereas 10 µg of the R648stop-truncated receptor failed to elicit a response (Fig. 4AGo). Nevertheless, this amount of R648stop-truncated receptor (10 µg) was able to reduce wild-type (0.5 µg) responsiveness by 14-fold when the two were cotransfected. The amounts transfected represent the approximate ratio which would yield equivalent expression of wild-type and mutant receptor in HEK293 cells by Western analysis (see Fig. 3BGo). When the amount of R648stop-truncated receptor was reduced from 10 µg to 5.25 µg, the inhibition of wild-type (0.5 µg) responsiveness was reduced to approximately 5-fold. Finally, when equivalent amounts (5.25 µg each) of wild-type and R648stop-mutated receptor were transfected, there was still a significantly reduced response (P = 0.02) compared with wild-type (5.25 µg) alone. Interestingly, when ten times as much wild-type receptor alone was transfected (5.25 compared with 0.5 µg), there was only a slight increase in response (P = 0.042), suggesting a tapering off to a certain threshold above which no additional cell surface expression, and therefore Ca2+ responsiveness, would be seen. To determine whether the diminution of wild-type CaR responsiveness observed in the presence of truncated receptor at 10 mM Ca2+ ions occurred at physiological calcium concentrations, we performed dose response studies, comparing wild-type and R648stop receptor alone with cotransfected wild-type and R648stop receptors (5.25 µg of each receptor transfected) (Fig. 4BGo). The dominant negative effect of the R648stop receptor on wild-type responsiveness was seen across the full range of calcium concentrations, even those at physiological levels (1–2 mM). The maximal response achieved with the cotransfected receptors was less than 50% of that of the wild-type alone. The R648stop receptor remained unresponsive at all calcium concentrations.


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The clinical features, biochemical parameters, and x-rays exhibiting changes of hyperparathyroidism in this case were highly suggestive of NSHPT (13). These findings, together with the fact that the infant’s maternal relatives were already being investigated for presumed FHH, prompted us to perform heterozygous sequence analysis of his CaR DNA. This analysis revealed two single-point mutations, both leading to potential truncations of the receptor. One of the mutations, resulting in a G94stop substitution, occurs early in the extracellular ligand-binding domain, whereas the other, which leads to an R648stop substitution, occurs in the first intracellular loop. The latter mutation was subsequently detected in the infant’s mother and other maternal relatives with biochemically determined FHH. Although the identity of the father of the infant was not disclosed, consanguinity was not suspected, suggesting that NSHPT was unlikely to be caused by homozygous presentation of the family mutation. Both heterozygous sequence analysis and subsequent restriction enzyme analysis confirmed this unequivocally (Fig. 2Go). Although it is probable that the father donated the allele containing the G94stop mutation, it is also possible that the G94stop mutation arose de novo in the infant as has been reported previously (9, 11). RT-PCR of RNA from the infant’s parathyroid tissue was used to show that the two mutations are present on separate alleles, so that irrespective of the source of the G94stop mutation, the infant would produce two truncated forms of the receptor.

The G94stop truncation has not been reported previously. Because it occurs early in the extracellular binding domain, it would be unable to anchor to the membrane and would have no signaling capacity. In support of this, our confocal microscopy results demonstrated that expressed G94stop receptor was not generally associated with the cell membrane when transfected into HEK293 cells (Fig. 3AGo). In addition, the G94stop receptor demonstrated no response in single-dose (10 mM Ca2+) IP assays (results not shown), consistent with a lack of signaling via the PI-PLC pathway. The R648stop receptor has been reported previously (16, 17) and has been shown to be expressed on the cell surface but to exhibit a complete lack of Ca2+ responsiveness in a dose-response IP assay (17). Our confocal and IP assay results confirm these observations, demonstrating expression of mutant R648stop receptor at the cell surface similar to that seen for wild-type receptor (Fig. 3AGo) and a complete lack of Ca2+ response in an IP assay even when transfections were adjusted to produce equivalent overall expression to wild-type, where a response was clearly seen (Fig. 4AGo).

This infant therefore appears to be the first reported case of a complete functional deletion of human CaR. Accordingly, the symptoms mimic, to a large extent, those described in the CaR knockout mouse (18), such as a similar phenotype to wild-type mice at birth, followed soon after by very obvious growth retardation, failure to thrive, inability to feed, and lethargy with a tendency to "floppiness" due to hypotonia. The serum Ca2+ and PTH concentrations were severely elevated, and hypocalciuria was evident. The parathyroid glands were enlarged, with a predominance of chief cells, consistent with parathyroid chief-cell hyperplasia. Skeletal radiographs clearly demonstrated effects of hyperparathyroidism, including undermineralization of bone, particularly at the extremities. Surprisingly, however, there was no evidence of fractures, a common finding in NSHPT (9, 13). In addition, some of the skeletal deformities observed in the knockout mouse and/or NSHPT (9, 18), such as bowing of the long bones and deficiencies in the extension of the digits, were not evident in this case. Interestingly, recent skeletal x-rays (taken approximately 3 yr after treatment) showed normal bone morphology and mineralization, consistent with recent conclusions drawn from studies with double PTH and CaR knockout mice that demineralization and other effects on the skeleton are due to the effects of hyperparathyroidism and not to CaR deficiency per se (19).

The presence of compound heterozygous mutations in a neonate with NSHPT has been reported previously (12). However, most of the documented cases of NSHPT involving defects in the CaR have involved homozygous presentation of single missense or nonsense mutations within consanguinous unions (10, 11, 20, 21). Interestingly, homozygous presentation of CaR missense mutations does not always manifest as NSHPT, some cases surviving to adulthood with FHH-like symptoms (22, 23). By contrast, there have been reports of inactivating mutations, which can give rise to NSHPT even in the heterozygous state (9, 11). The wide spectrum of severity in the biochemical and clinical presentation of NSHPT may depend on the innate inactivating properties of the mutation(s), gene dosage, and the capacity of mutant receptor to exert a dominant negative effect on wild-type receptor in heterozygous cases of NSHPT. The case presented here is characterized by relatively high serum Ca2+ levels, although not as high as some reported for this condition (11, 24); very high PTH levels [six times greater than the upper end of the normal range (13)]; enlarged parathyroid glands; and most of the clinical features normally associated with NSHPT, such as growth retardation and hypotonia, but with skeletal effects not as pronounced as seen in severe cases or in knockout mice (9, 18). The lack of gross skeletal effects could be due to reduced skeletal sensitivity of this neonate to high levels of PTH. It is perhaps surprising that, given the presence of nonfunctional CaR, this neonate presented very late and did not fare any worse clinically than cases of NSHPT caused by less dramatic mutational effects on the CaR.

In maternal relatives of the infant under study, FHH cosegregated with the R648stop mutation. In cotransfection experiments with wild-type and R648stop mutant receptors, we demonstrated dose-dependent inhibition of wild-type response to Ca2+ by the R648stop receptor. Moreover, this dominant negative effect was observed at physiologically relevant Ca2+ levels in dose response studies with cotransfected wild-type and R648stop receptors. Hence, under physiological conditions, simulation of this effect would be expected to lead to the FHH phenotype. Truncated receptors have been shown to heterodimerize with wild-type receptors when cotransfected into HEK293 cells (5). The R648stop mutant may exert its dominant negative effect by heterodimerizing with wild-type receptors and causing conformational changes that reduce signaling through the wild-type signaling domain. On the other hand, reduced cell surface expression of wild-type receptor alone, caused by competing mutant receptors, may be sufficient to reduce Ca2+ responsiveness as seen in mice heterozygous for the CaR gene and in which FHH is mimicked (18). The interplay of these factors is likely to be important in determining the specific nature of the inhibition of Ca2+ responsiveness of wild-type receptor by different mutant receptors. In this respect, we show that the dominant negative effect observed with the R648stop mutation is manifested by reduced Ca2+ responsiveness at all levels of calcium, with no appreciable difference in EC50, compared with wild-type alone (Fig. 4BGo). By contrast, an R185Q mutation, associated with another case of NSHPT, displays its dominant negative effect as a right shift in Ca2+ dose response (37% increase in EC50) with no difference in maximal response, compared with wild-type alone (9).

To our knowledge, cranial CT scans have not been examined in cases of NSHPT. The finding of a significant decrease in white matter in this infant is particularly interesting. The CaR is highly expressed in brain, even within components lying within blood-brain barriers, suggesting functions for the CaR that lie outside the sphere of Ca2+ homeostatic regulation (25, 26). The CaR is expressed both in neurons and oligodendrocytes (4, 25, 27), with substantial increases seen in the hippocampus of the early developing brain (28). This parallels the rapid formation of myelin by the oligodendrocytes. It is possible that a lack of functional receptor in oligodendrocytes could have led to a failure of myelination and the decrease in white matter observed in this case. In support of this, patients with NSHPT who have survived to adulthood without treatment suffer significant neurodevelopmental problems (23, 29); and in one case, these were not reversed by surgery (23). In our case, examination of further CT scans will be of great interest. It is encouraging that there has been some catch-up in head circumference and developmental milestones, and the neurodevelopmental follow-up of this interesting patient will be closely monitored and should contribute to our understanding of the pathophysiology of NSHPT.


    Acknowledgments
 
We thank Ed Nemeth for the pcDNA1/hCaR construct, Ian Dick for help with statistical analysis, and Arthur Conigrave for critical evaluation of the manuscript.


    Footnotes
 
This work was supported by grants from the Sir Charles Gairdner Hospital Research Fund, the Medical Research Fund of Western Australia, and the Raine Foundation for Medical Research.

Abbreviations: Ab, Antibody; CaR, calcium-sensing receptor; CT, computerized tomography; FCS, fetal calf serum; FHH, familial hypocalciuric hypercalcemia; IP, inositol phosphate; NSHPT, neonatal severe hyperparathyroidism; PI-PLC, phosphoinositide-specific phospholipase C; TBS, Tris-buffered saline.

Received September 23, 2003.

Accepted May 10, 2004.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Brown EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, Sun A, Hediger MA, Lytton J, Hebert SC 1993 Cloning and characterization of an extracellular Ca(2+)-sensing receptor from bovine parathyroid. Nature 366:575–580[CrossRef][Medline]
  2. Garrett JE, Capuano IV, Hammerland LG, Hung BC, Brown EM, Hebert SC, Nemeth EF, Fuller F 1995 Molecular cloning and functional expression of human parathyroid calcium receptor cDNAs. J Biol Chem 270:12919–12925[Abstract/Free Full Text]
  3. Pearce SH, Brown EM 1996 Disorders of calcium ion sensing. J Clin Endocrinol Metab 81:2030–2035[CrossRef][Medline]
  4. Brown EM, MacLeod RJ 2001 Extracellular calcium sensing and extracellular calcium signaling. Physiol Rev 81:239–297[Abstract/Free Full Text]
  5. Bai M, Trivedi S, Brown EM 1998 Dimerization of the extracellular calcium-sensing receptor (CaR) on the cell surface of CaR-transfected HEK293 cells. J Biol Chem 273:23605–23610[Abstract/Free Full Text]
  6. Bai M, Trivedi S, Kifor O, Quinn SJ, Brown EM 1999 Intermolecular interactions between dimeric calcium-sensing receptor monomers are important for its normal function. Proc Natl Acad Sci USA 96:2834–2839[Abstract/Free Full Text]
  7. Zhang Z, Sun S, Quinn SJ, Brown EM, Bai M 2001 The extracellular calcium-sensing receptor dimerizes through multiple types of intermolecular interactions. J Biol Chem 276:5316–5322[Abstract/Free Full Text]
  8. Bai M, Quinn S, Trivedi S, Kifor O, Pearce SH, Pollak MR, Krapcho K, Hebert SC, Brown EM 1996 Expression and characterization of inactivating and activating mutations in the human Ca2+o-sensing receptor. J Biol Chem 271:19537–19545[Abstract/Free Full Text]
  9. Bai M, Pearce SH, Kifor O, Trivedi S, Stauffer UG, Thakker RV, Brown EM, Steinmann B 1997 In vivo and in vitro characterization of neonatal hyperparathyroidism resulting from a de novo, heterozygous mutation in the Ca2+-sensing receptor gene: normal maternal calcium homeostasis as a cause of secondary hyperparathyroidism in familial benign hypocalciuric hypercalcemia. J Clin Invest 99:88–96[Medline]
  10. Pollak MR, Brown EM, Chou YH, Hebert SC, Marx SJ, Steinmann B, Levi T, Seidman CE, Seidman JG 1993 Mutations in the human Ca(2+)-sensing receptor gene cause familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Cell 75:1297–1303[CrossRef][Medline]
  11. Pearce SH, Trump D, Wooding C, Besser GM, Chew SL, Grant DB, Heath DA, Hughes IA, Paterson CR, Whyte MP, Thakker RV 1995 Calcium-sensing receptor mutations in familial benign hypercalcemia and neonatal hyperparathyroidism. J Clin Invest 96:2683–2692
  12. Kobayashi M, Tanaka H, Tsuzuki K, Tsuyuki M, Igaki H, Ichinose Y, Aya K, Nishioka N, Seino Y 1997 Two novel missense mutations in calcium-sensing receptor gene associated with neonatal severe hyperparathyroidism. J Clin Endocrinol Metab 82:2716–2719[Abstract/Free Full Text]
  13. Pearce S, Steinmann B 1999 Casting new light on the clinical spectrum of neonatal severe hyperparathyroidism. Clin Endocrinol (Oxf) 50:691–693[CrossRef][Medline]
  14. Hu J, Hauache O, Spiegel AM 2000 Human Ca2+ receptor cysteine-rich domain. Analysis of function of mutant and chimeric receptors. J Biol Chem 275:16382–16389[Abstract/Free Full Text]
  15. Anderson L, Milligan G, Eidne KA 1993 Characterization of the gonadotrophin-releasing hormone receptor in {alpha} T3–1 pituitary gonadotroph cells. J Endocrinol 136:51–58[Abstract]
  16. Jap TS, Wu YC, Jenq SF, Won GS 2001 A novel mutation in the calcium-sensing receptor gene in a Chinese subject with persistent hypercalcemia and hypocalciuria. J Clin Endocrinol Metab 86:13–15[Abstract/Free Full Text]
  17. Yamauchi M, Sugimoto T, Yamaguchi T, Yano S, Wang J, Bai M, Brown E, Chihara K 2002 Familial hypocalciuric hypercalcemia caused by an R648stop mutation in the calcium-sensing receptor gene. J Bone Miner Res 17:2174–2182[CrossRef][Medline]
  18. Ho C, Conner DA, Pollak MR, Ladd DJ, Kifor O, Warren HB, Brown EM, Seidman JG, Seidman CE 1995 A mouse model of human familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Nat Genet 11:389–394[CrossRef][Medline]
  19. Kos CH, Karaplis AC, Peng JB, Hediger MA, Goltzman D, Mohammad KS, Guise TA, Pollak MR 2003 The calcium-sensing receptor is required for normal calcium homeostasis independent of parathyroid hormone. J Clin Invest 111:1021–1028[CrossRef][Medline]
  20. Janicic N, Pausova Z, Cole DE, Hendy GN 1995 Insertion of an Alu sequence in the Ca(2+)-sensing receptor gene in familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Am J Hum Genet 56:880–886[Medline]
  21. D’Souza-Li L, Canaff L, Janicic N, Cole DE, Hendy GN 2001 An acceptor splice site mutation in the calcium-sensing receptor (CASR) gene in familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Hum Mutat 18:411–421[CrossRef][Medline]
  22. Aida K, Koishi S, Inoue M, Nakazato M, Tawata M, Onaya T 1995 Familial hypocalciuric hypercalcemia associated with mutation in the human Ca(2+)-sensing receptor gene. J Clin Endocrinol Metab 80:2594–2598[Abstract]
  23. Chikatsu N, Fukumoto S, Suzawa M, Tanaka Y, Takeuchi Y, Takeda S, Tamura Y, Matsumoto T, Fujita T 1999 An adult patient with severe hypercalcaemia and hypocalciuria due to a novel homozygous inactivating mutation of calcium-sensing receptor. Clin Endocrinol (Oxf) 50:537–543[CrossRef][Medline]
  24. Cooper L, Wertheimer J, Levey R, Brown E, Leboff M, Wilkinson R, Anast CS 1986 Severe primary hyperparathyroidism in a neonate with two hypercalcemic parents: management with parathyroidectomy and heterotopic autotransplantation. Pediatrics 78:263–268[Abstract/Free Full Text]
  25. Ruat M, Molliver ME, Snowman AM, Snyder SH 1995 Calcium sensing receptor: molecular cloning in rat and localization to nerve terminals. Proc Natl Acad Sci USA 92:3161–3165[Abstract/Free Full Text]
  26. Rogers KV, Dunn CK, Hebert SC, Brown EM 1997 Localization of calcium receptor mRNA in the adult rat central nervous system by in situ hybridization. Brain Res 744:47–56[CrossRef][Medline]
  27. Chattopadhyay N, Ye CP, Yamaguchi T, Kifor O, Vassilev PM, Nishimura R, Brown EM 1998 Extracellular calcium-sensing receptor in rat oligodendrocytes: expression and potential role in regulation of cellular proliferation and an outward K+ channel. Glia 24:449–458[CrossRef][Medline]
  28. Chattopadhyay N, Legradi G, Bai M, Kifor O, Ye C, Vassilev PM, Brown EM, Lechan RM 1997 Calcium-sensing receptor in the rat hippocampus: a developmental study. Dev Brain Res 100:13–21[Medline]
  29. Cole D, Forsythe CR, Dooley JM, Grantmyre EB, Salisbury SR 1990 Primary neonatal hyperparathyroidism: a devastating neurodevelopmental disorder if left untreated. J Craniofac Genet Dev Biol 10:205–214[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ward, B. K.
Right arrow Articles by Ratajczak, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ward, B. K.
Right arrow Articles by Ratajczak, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals