| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Endocrinology and Metabolism, Department of Medicine (M.X., M.E., P.W.L.), Department of Otolaryngology-Head and Neck Surgery (R.P.T., E.R., P.J.B., D.S.), Department of Surgery (A.P.T.), Johns Hopkins University School of Medicine, Baltimore, Maryland 21287; Division of Endocrinology and Metabolism (S.B.), Johns Hopkins Bayview Medical Center, Baltimore, Maryland 21224; and TrimGen Corporation (J.W.), Sparks, Maryland 21152
Address all correspondence and requests for reprints to: Mingzhao Xing, M.D., Ph.D., Division of Endocrinology and Metabolism, Johns Hopkins University School of Medicine, 1830 East Monument Street, Suite 333, Baltimore, Maryland 21287. E-mail: mxing1{at}jhmi.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
BRAF gene mutations are common in human cancers (10). Several investigators have recently identified the most common BRAF mutation, T1796A transversion mutation, in 2969% (mostly around 4550%) of PTCs (11, 12, 13, 14, 15, 16, 17, 18). Remarkably, this mutation has consistently been reported to be specific for PTC, with no benign thyroid neoplasms having been found to harbor BRAF mutation. Consequently, BRAF mutation has the potential to be a specific molecular marker with relatively good sensitivity for the diagnosis of PTC. Moreover, BRAF mutation has been demonstrated to be a novel prognostic biomarker that predicts poor clinicopathological outcomes, such as increased incidence of extrathyroidal invasion and distant metastasis of the tumor (15, 17).
We hypothesized that detection of BRAF mutation in cytological specimens from thyroid fine needle aspiration would be applicable; it may improve the diagnostic accuracy and identify the BRAF mutation-positive PTC patients who have poor clinicopathological outcomes so that their surgery can be appropriately planned. In this prospective study, we have used direct DNA sequencing technique and a novel colorimetric mutation detection method to test this hypothesis in a series of patients with thyroid nodules for whom thyroid surgery was planned, and we compared the tumors BRAF mutation status detected on preoperative cytological specimens with the final histopathological characterization of the tumor. Our data show that BRAF mutation can be readily and reliably detected on thyroid cytological specimens and has the potential to become a useful adjunct tool to FNAB for optimal diagnostic and prognostic evaluation of thyroid nodules that will guide the subsequent appropriate surgical management and clinical follow-up.
| Materials and Methods |
|---|
|
|
|---|
With approval by the Johns Hopkins School of Medicine Institutional Review Board and patient consent, we recruited 48 study patients from whom we were able to obtain preoperative thyroid FNAB specimens for BRAF mutation analysis. These patients were chosen for this study because their thyroid nodule was easily palpable for fine needle aspiration and they were considered for thyroid surgery. For the research fine needle aspiration procedure, three to four passes with 27- to 22-gauge needles were typically made to harvest cytological material for analysis, from the dominant palpable nodule, either in the outpatient clinic or in the operating room immediately before surgery. Specimens were collected in normal saline in a 50-ml Falcon plastic tube. After centrifugation, the pellet was resuspended and pelleted twice in Cyto-Rich Red solution (ThermoShandon, Pittsburgh, PA) to lyze red blood cells, followed by two washings with normal saline by repeating the pelleting and resuspending procedures using a microcentrifuge.
DNA isolation
Tumor tissue and cell line genomic DNA was isolated using a protocol described previously (19). Briefly, the cells were incubated with 1% sodium dodecyl sulfate and 0.5 mg/ml proteinase K at 48 C for 48 h, with a midinterval addition of concentrated proteinase K to facilitate protein digestion. DNA was subsequently isolated from the digested tissues by standard phenol-chloroform extraction procedure and precipitated with 70% ethanol and resuspended in water before use.
Detection of T1796A transversion BRAF mutation
Because the T1796A transversion mutation in exon 15 of the BRAF gene is the most common mutation of this gene in cancers (10) and is specifically found in PTC (11, 12, 13, 14, 15, 16, 17, 18), we analyzed this mutation on thyroid cytological specimens in the present study. The mutation was sought in all specimens by both direct DNA sequencing and a recently established colorimetric mutation detection method (Mutector, TrimGen, Sparks, MD).
For direct DNA sequencing, exon 15 containing the site in which T1796A mutation occurs was first PCR-amplified using the primers as described previously (10): TCATAATGCTTGCTCTGATAGGA (forward) and GGCCAAAAATTTAATCAGTGGA (reverse). The PCR was run with a step-down protocol: 95 C for 5 min x 1 cycle; 95 C for 1 min, 60 C for 1 min, and 72 C for 1 min, x 2 cycles; 95 C for 1 min, 58 C for 1 min, and 72 C for 1 min x 2 cycles; 95 C for 1 min, 56 C for 1 min, and 72 C for 1 min x 40 cycles. A final extension at 72 C for 5 min was added. The reaction mixture contained, in a final volume of 30 µl, 16.6 mM ammonium sulfate, 67 mM Tris (pH 8.8), 10 mM 2-mercaptoethanol, 1.5 mM each deoxynucleotide triphosphate, 6.7 mM MgCl2, 5% dimethylsulfoxide, 1.67 µM each primers (forward and reverse), 60 ng genomic DNA, and 0.5 U of platinum DNA Taq polymerase (Life Technologies, Rockville, MD). A single major PCR product was confirmed by running the PCR products on a 1.5% agarose gel. The PCR products were subsequently subjected to sequencing reaction using the forward primer described above and Big Dye terminator V 3.0 cycle sequencing reagents (Applied Biosystems, Foster City, CA), with the following PCR cycles: 95 C for 30 sec x 1 cycle; 95 C for 15 sec, 50 C for 15 sec, and 60 C for 4 min x 35 cycles. DNA sequence was then read on an ABI PRISM 3700 DNA Analyzer (Applied Biosystems), and the T1796A mutation was identified.
BRAF mutation analysis with the colorimetric method was performed following the instructions of the manufacturer (TrimGen). This is a novel colorimetric gene mutation detection method based on shifted termination assay, in which a specifically designed detection primer hybridizes to the target sequence of the gene with its 3' terminus ending just before the target base, so that primer extension does not occur unless the target base is changed, i.e. a T1796A transversion mutation in the case of BRAF gene. With the mutated allele, the primer extension continues through the target base until the next termination point, and multiple labeled nucleotides are incorporated through this process, forming the basis for specific colorimetric differentiation of the mutated from the wild-type allele. Specifically for BRAF mutation, the detection process involved an initial PCR amplification of exon 15 of the BRAF gene, as described above, followed by hybridization of the PCR products to the specific detection primer attached to the strips in a 96-well plate and subsequent primer extension on a PCR block with the setting of 95 C for 1 min, 56 C for 1 min, and 72 C for 1 min x 15 cycles. This was followed by the final color development through an enzymatic reaction, and the intensity of the color was quantified by a colorimetry microplate reader at a wavelength of 405 nm.
| Results |
|---|
|
|
|---|
We prospectively studied 48 patients from whom we could obtain preoperative cytological specimens for BRAF mutation analysis. Except for three patients, in all the other 45 patients, the nodule biopsied was confirmed by physical examination, preoperative imaging studies (sonography or computed tomography), or by final surgery to be either the solitary or largest (i.e. dominant) nodule in the gland and readily identifiable for a correlation of the BRAF mutation status with the final histological diagnosis. Thus, a total of 45 patients were included in the final analysis (Table 1
). Among these 45 patients, 40 underwent thyroidectomy for a thyroid nodule based on indeterminate (n = 25) or malignant (n = 10) cytological findings or for large benign goiter (n = 3) or Graves disease (n = 1) or amiodarone-induced thyrotoxicosis (n = 1); one patient with indeterminate cytological findings chose not to pursue surgery, and four were not operated on because the cytological findings were consistent with a diagnosis of benign thyroid adenoma. Patient 9 had two nodules of similar size (2 and 1.7 cm), both of which proved histologically to be PTC. Although we could not be certain which lesion had been aspirated preoperatively, their identical histological diagnoses nonetheless permitted us to conclude that the BRAF mutation in the cytological specimen predicted the diagnosis of PTC. Therefore, this patient was included in our final analysis. In patient 17, the aspirated thyroid nodule for this study was the largest one, which proved to be a 5-cm metastasis from renal cell carcinoma. Although two smaller nodules in this patients gland were histologically identified as PTC, they were not the nodules biopsied for BRAF mutation detection and, therefore, were not included in the final analysis. Patient 24 had Graves disease without a thyroid tumor. Patient 41 had thyroidectomy for intractable amiodarone-induced thyrotoxicosis without tumor. In several patients who were found to have incidental foci of microscopic PTC (15 mm), only the histological findings in the dominant nodule that had been aspirated were considered in the analysis (Table 1
). Altogether, the final histopathological diagnoses of the biopsied thyroid nodules included in this study were PTC (n = 16), follicular thyroid cancer (FTC, n = 5), Hurthle cell carcinoma (n = 1), benign adenoma or hyperplasia (n = 18), metastatic renal cancer (n = 1), Graves disease (n = 1), Hashimotos thyroiditis (n = 1), amiodarone-induced thyroiditis (n = 1), and one nonoperated indeterminate lesion.
|
To define the specificity and sensitivity of the colorimetric mutation detection method for the BRAF T1796A transversion mutation, we compared its results to the "gold standard" of direct DNA sequencing in a large pool of genomic DNA samples isolated from various primary benign and malignant thyroid tumors, as well as several thyroid tumor cell lines. Figure 1A
shows an example of wild allele and an example of mutated allele for BRAF T1796A transversion mutation by direct DNA sequencing. Figure 1B
shows an example of the result on BRAF mutation detection using the colorimetric method, with the mutation-positive samples showing up as blue color and the mutation-negative samples showing no color. Figure 1C
shows the results of quantitative colorimetric measurement of the data in Fig. 1B
, with the mutation-negative and -positive groups clearly separated from each other. Altogether from different experiments, 23 samples found to be BRAF mutation positive by direct DNA sequencing were also detected as positive for mutation in the colorimetric assay, and 68 samples found to be BRAF mutation negative by direct DNA sequencing were also negative in the colorimetric assay.
|
We analyzed preoperative cytological specimens for T1796A transversion BRAF mutation by both DNA sequencing and the colorimetric assay. Results are shown in Table 1
for each individual patient and are summarized in Table 2
for the entire group of 45 patients. The cytological specimens from all the 21 patients with benign lesions (18 benign neoplasms, one case of Graves disease, one case of Hashimotos thyroiditis, and one case of amiodarone-induced thyroiditis), the five patients with a histopathological diagnosis of FTC, and one patient with Hurthle cell carcinoma were all negative for BRAF mutation, as detected by both direct DNA sequencing and colorimetric assay. The cytological specimen from the renal cell carcinoma metastasis was also negative for BRAF mutation by either method. Among cytological specimens from the nodules in 16 patients with histopathological diagnoses of PTC, six were positive for BRAF mutation by direct DNA sequencing. These six BRAF mutation-positive PTC and, additionally, two more PTC, were also positive for BRAF mutation per analysis by the colorimetric assay, yielding a total prevalence of BRAF mutation of 50% in PTC (Table 2
).
|
| Discussion |
|---|
|
|
|---|
Use of molecular markers for diagnostic and prognostic evaluation of thyroid cancer has been explored extensively (23, 24). Although more than 50 molecular markers have been studied, none of them has yet become clinically useful (24). All of the markers studied to date, including thyroid peroxidase, human telomerase reverse transcriptase, and galectin-3, have had significant limitations, such as the lack of specificity, molecular instability, and variable reproducibility. For example, immunohistochemical staining of thyroid peroxidase, a differentiation marker suggestive of a benign neoplasm, often has an inadequate specificity to definitively diagnose thyroid cancer (24). RT-PCR detection of human telomerase reverse transcriptase on FNAB specimens initially showed promising specificity and sensitivity for diagnosing thyroid cancer (25), but more recent studies using quantitative RT-PCR have demonstrated high expression levels of this molecule in FNAB specimens from benign thyroid neoplasms as well (24). Similarly, galectin-3, which may be the most promising diagnostic marker for thyroid cancer (24), is sometimes also seen in benign adenomas (26). Classical genetic alterations in thyroid tumors, such as Ras mutation (27), RET/PTC rearrangements (28), and PAX8/PPAR
rearrangements (29) are now all known also to be found in some benign thyroid neoplasms. In contrast, the BRAF mutation appears promising as a diagnostic marker because it represents a stable molecular marker with 100% specificity and relatively high sensitivity for thyroid cancer (11, 12, 13, 14, 15, 16, 17, 18). Moreover, the T1796A transversion mutation BRAF mutation is a novel genetic marker that predicts a poor prognosis for PTC. Recently, Namba et al. (15) reported a significant association of BRAF mutation with distant metastasis and advanced pathological stages of PTC. Nikiforova et al. (17) reported a significant association of BRAF mutation with extrathyroidal invasion and advanced pathological stages of PTC. We (our unpublished data) have recently conducted a retrospective study on BRAF mutation and clinicopathologic outcomes in a large series of patients with PTC and confirmed the previous findings (15, 17). In addition, we also observed a statistically significant association of BRAF mutation with neck lymph node metastasis and a higher incidence of cancer recurrence over a long period of clinical follow-up. With multivariate analysis, we also found that BRAF mutation is an independent prognostic factor that clearly predicts a poor prognosis for PTC.
In the present study, we have demonstrated that detection of BRAF mutation on FNAB specimens can be easily and reliably performed, and that it correctly identified 50% of PTC. We have also shown the usefulness and reliability of a new colorimetric mutation detection technique in detecting BRAF mutation, demonstrating its 100% specificity and superior sensitivity over conventional DNA sequencing to detect BRAF mutation on FNAB specimens. DNA from FNAB specimens is invariably contaminated with wild allele of the BRAF gene from normal tissues, which often make the somatically mutated alleles indiscernible on direct DNA sequencing analysis. However, the colorimetric assay can detect the mutation even when only 1% of total DNA molecules are mutated alleles (TrimGen). In evaluating the sensitivity and specificity of this colorimetric assay, most of our BRAF mutation-negative samples were benign thyroid neoplasms, which have been consistently shown to lack BRAF mutation in numerous previous studies (11, 12, 13, 14, 15, 16, 17, 18). The cancer samples used, as described previously (19), were microdissected and contained almost exclusively cancer cells. Therefore, the BRAF mutation states determined by the direct sequencing technique on these samples could be reliably used as "gold standard" to assess the colorimetric assay for BRAF mutation detection (Fig. 1
). Consistent with previous findings, BRAF mutation was found only in PTC with a prevalence (50%) comparable to that reported in most of the previous studies (11, 12, 13, 14, 15, 16, 17, 18); this further attests to the reliability of the results obtained with the colorimetric method. In two of our cases (nos. 19 and 36), the diagnostic FNAB cytological findings were indeterminate, whereas the BRAF mutation was identified both by direct DNA sequencing and colorimetric assay on FNAB-derived materials (Table 1
). These two cases illustrate the potential usefulness of BRAF mutation detection on FNAB specimens to confirm the preoperative diagnosis and define optimal surgical management, i.e. total thyroidectomy, for some patients with cytologically indeterminate thyroid nodules.
Because the prevalence of BRAF mutation in the subset of thyroid nodules with indeterminate cytological findings on FNAB is not well defined and the number of the patients in the present study is limited, we are unable to extrapolate the full diagnostic utility of BRAF mutation detection on FNAB for these thyroid nodules. However, one might anticipate that detection of BRAF mutation on FNAB specimens may prove diagnostically helpful in a substantial number of cases because the prevalence of BRAF mutation in PTC is relatively high and PTC account for the vast majority of thyroid cancers. In view of the large and increasing number of newly discovered thyroid nodules (275,000/yr in the United States) in recent years that require evaluation (30), detection of BRAF mutation on FNAB specimens could be a useful diagnostic adjunctive technique in evaluation of thyroid nodules with indeterminate cytological findings, although this requires further definition by a larger study. More importantly, and perhaps most usefully, detection of BRAF mutation in adjunction with routine FNAB will make preoperative risk and prognostic evaluation of PTC more efficient and effective; it will help identify the BRAF mutation-positive PTC patients who are likely to have poor clinicopathological outcomes and therefore can be appropriately planned for optimal surgery (e.g. more extensive neck dissection) and vigilant postoperative clinical monitoring for cancer recurrence. In this sense, it may become an important future practice to examine BRAF mutation on FNAB specimens in every thyroid cancer patient preoperatively, even when the diagnosis of PTC is already clearly defined based on cytology findings.
| Footnotes |
|---|
Abbreviations: FNAB, Fine needle aspiration biopsy; FTC, follicular thyroid cancer; PTC, papillary thyroid cancer.
Received November 26, 2003.
Accepted February 16, 2004.
| References |
|---|
|
|
|---|
fusion oncogene in both follicular thyroid carcinomas and adenomas. J Clin Endocrinol Metab 88:354357This article has been cited by other articles:
![]() |
M. C. Zatelli, G. Trasforini, S. Leoni, G. Frigato, M. Buratto, F. Tagliati, R. Rossi, L. Cavazzini, E. Roti, and E. C degli Uberti BRAF V600E mutation analysis increases diagnostic accuracy for papillary thyroid carcinoma in fine-needle aspiration biopsies Eur. J. Endocrinol., September 1, 2009; 161(3): 467 - 473. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing, D. Clark, H. Guan, M. Ji, A. Dackiw, K. A. Carson, M. Kim, A. Tufaro, P. Ladenson, M. Zeiger, et al. BRAF Mutation Testing of Thyroid Fine-Needle Aspiration Biopsy Specimens for Preoperative Risk Stratification in Papillary Thyroid Cancer J. Clin. Oncol., June 20, 2009; 27(18): 2977 - 2982. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. E. Nikiforov, D. L. Steward, T. M. Robinson-Smith, B. R. Haugen, J. P. Klopper, Z. Zhu, J. A. Fagin, M. Falciglia, K. Weber, and M. N. Nikiforova Molecular Testing for Mutations in Improving the Fine-Needle Aspiration Diagnosis of Thyroid Nodules J. Clin. Endocrinol. Metab., June 1, 2009; 94(6): 2092 - 2098. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Johnson and M. E. Tublin Postoperative Surveillance of Differentiated Thyroid Carcinoma: Rationale, Techniques, and Controversies Radiology, November 1, 2008; 249(2): 429 - 444. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Nikiforova, G. C. Tseng, D. Steward, D. Diorio, and Y. E. Nikiforov MicroRNA Expression Profiling of Thyroid Tumors: Biological Significance and Diagnostic Utility J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1600 - 1608. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Riesco-Eizaguirre and P. Santisteban New insights in thyroid follicular cell biology and its impact in thyroid cancer therapy Endocr. Relat. Cancer, December 1, 2007; 14(4): 957 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Sapio, A. Guerra, D. Posca, P. P. Limone, M. Deandrea, M. Motta, G. Troncone, A. Caleo, P. Vallefuoco, G. Rossi, et al. Combined analysis of galectin-3 and BRAFV600E improves the accuracy of fine-needle aspiration biopsy with cytological findings suspicious for papillary thyroid carcinoma Endocr. Relat. Cancer, December 1, 2007; 14(4): 1089 - 1097. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R Rowe, B. G Bentz, and J. S Bentz Detection of BRAF V600E activating mutation in papillary thyroid carcinoma using PCR with allele-specific fluorescent probe melting curve analysis J. Clin. Pathol., November 1, 2007; 60(11): 1211 - 1215. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Spittle, M. R. Ward, K. L. Nathanson, P. A. Gimotty, E. Rappaport, M. S. Brose, A. Medina, R. Letrero, M. Herlyn, and R. H. Edwards Application of a BRAF Pyrosequencing Assay for Mutation Detection and Copy Number Analysis in Malignant Melanoma J. Mol. Diagn., September 1, 2007; 9(4): 464 - 471. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Mitsiades, J. Negri, C. McMullan, D. W. McMillin, E. Sozopoulos, G. Fanourakis, G. Voutsinas, S. Tseleni-Balafouta, V. Poulaki, D. Batt, et al. Targeting BRAFV600E in thyroid carcinoma: therapeutic implications Mol. Cancer Ther., March 1, 2007; 6(3): 1070 - 1078. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Mittendorf, A. Khiyami, and C. R. McHenry When Fine-Needle Aspiration Biopsy Cannot Exclude Papillary Thyroid Cancer: A Therapeutic Dilemma Arch Surg, October 1, 2006; 141(10): 961 - 966. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Fugazzola, E Puxeddu, N Avenia, C Romei, V Cirello, A Cavaliere, P Faviana, D Mannavola, S Moretti, S Rossi, et al. Correlation between B-RAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: data from a multicentric Italian study and review of the literature. Endocr. Relat. Cancer, June 1, 2006; 13(2): 455 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Sapio, D. Posca, G. Troncone, G. Pettinato, L. Palombini, G. Rossi, G. Fenzi, and M. Vitale Detection of BRAF mutation in thyroid papillary carcinomas by mutant allele-specific PCR amplification (MASA) Eur. J. Endocrinol., February 1, 2006; 154(2): 341 - 348. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing, W. H. Westra, R. P. Tufano, Y. Cohen, E. Rosenbaum, K. J. Rhoden, K. A. Carson, V. Vasko, A. Larin, G. Tallini, et al. BRAF Mutation Predicts a Poorer Clinical Prognosis for Papillary Thyroid Cancer J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6373 - 6379. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Xing BRAF mutation in thyroid cancer Endocr. Relat. Cancer, June 1, 2005; 12(2): 245 - 262. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |