help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xing, M.
Right arrow Articles by Ladenson, P. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xing, M.
Right arrow Articles by Ladenson, P. W.
The Journal of Clinical Endocrinology & Metabolism Vol. 89, No. 6 2867-2872
Copyright © 2004 by The Endocrine Society

Detection of BRAF Mutation on Fine Needle Aspiration Biopsy Specimens: A New Diagnostic Tool for Papillary Thyroid Cancer

Mingzhao Xing, Ralph P. Tufano, Anthony P. Tufaro, Shehzad Basaria, Marge Ewertz, Eli Rosenbaum, Patrick J. Byrne, James Wang, David Sidransky and Paul W. Ladenson

Division of Endocrinology and Metabolism, Department of Medicine (M.X., M.E., P.W.L.), Department of Otolaryngology-Head and Neck Surgery (R.P.T., E.R., P.J.B., D.S.), Department of Surgery (A.P.T.), Johns Hopkins University School of Medicine, Baltimore, Maryland 21287; Division of Endocrinology and Metabolism (S.B.), Johns Hopkins Bayview Medical Center, Baltimore, Maryland 21224; and TrimGen Corporation (J.W.), Sparks, Maryland 21152

Address all correspondence and requests for reprints to: Mingzhao Xing, M.D., Ph.D., Division of Endocrinology and Metabolism, Johns Hopkins University School of Medicine, 1830 East Monument Street, Suite 333, Baltimore, Maryland 21287. E-mail: mxing1{at}jhmi.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Numerous biomolecular markers have been studied to improve the accuracy of fine needle aspiration biopsy (FNAB) in the diagnostic and prognostic evaluation of thyroid tumors, but none of them has yet become clinically useful. The recently discovered BRAF mutation, which occurs specifically in papillary thyroid cancers (PTC) with a high prevalence and is associated with poor clinicopathological outcomes, has the potential to be a useful diagnostic and prognostic marker for PTC. In the present study, we investigated whether detection of BRAF mutation on FNAB specimens was technically possible and could be used as an adjunct diagnostic tool with routine FNAB. Evaluation of a new colorimetric mutation detection method demonstrated 100% sensitivity and 100% specificity in comparison with conventional DNA sequencing as the "gold standard" in a large pool of DNA samples from various primary thyroid tumor specimens and cell lines. We found this novel technique even more sensitive in detecting BRAF mutation on FNAB specimens than conventional sequencing. In a series of 48 patients undergoing thyroidectomy, mostly for thyroid cancer or for suspicion of cancer, we performed preoperative FNAB and, using the colorimetric mutation detection method, identified BRAF mutation on the cytological specimens. Prospective analysis showed that 50% of the nodules that proved to be PTC on surgical histopathology were correctly diagnosed by BRAF mutation analysis on FNAB specimens; there were no false positive findings. Thus, we have demonstrated the usefulness of BRAF mutation detection on FNAB specimens that can help diagnose and identify those PTC patients who may need more aggressive surgical treatment and vigilant clinical monitoring.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
FOLLICULAR EPITHELIAL cell-derived thyroid cancers are the most common endocrine malignancies, among which papillary thyroid cancer (PTC) is the most common type, accounting for approximately 80% of thyroid cancers (1, 2). The initial presentation of thyroid cancer is usually a thyroid nodule, which is palpable in approximately 5% of normal adults (3) and visualized by sonography in one third or more of normal adults (4, 5). Because the prevalence of malignancy in solitary thyroid nodules is only approximately 5% in adults (6, 7), the primary clinical challenge is to identify the minority of nodules that are malignant. Fine needle aspiration biopsy (FNAB) with cytological analysis is widely used and has become the mainstay of thyroid nodule evaluation (8). A major problem related to this technique, however, is that approximately 20% of the biopsies yield indeterminate cytological findings that cannot distinguish cancerous from benign neoplasms (9). Consequently, surgery is generally required in these patients, even though only 20% of them prove to harbor cancer based on surgical pathology (9). It is difficult to define the optimal type and extent of surgery for such patients without a certain preoperative diagnosis. Moreover, the lack of preoperative knowledge on the clinicopathological characteristics and the prognosis of the cancer in general often creates an obstacle for optimal surgical planning and postoperative clinical follow-up.

BRAF gene mutations are common in human cancers (10). Several investigators have recently identified the most common BRAF mutation, T1796A transversion mutation, in 29–69% (mostly around 45–50%) of PTCs (11, 12, 13, 14, 15, 16, 17, 18). Remarkably, this mutation has consistently been reported to be specific for PTC, with no benign thyroid neoplasms having been found to harbor BRAF mutation. Consequently, BRAF mutation has the potential to be a specific molecular marker with relatively good sensitivity for the diagnosis of PTC. Moreover, BRAF mutation has been demonstrated to be a novel prognostic biomarker that predicts poor clinicopathological outcomes, such as increased incidence of extrathyroidal invasion and distant metastasis of the tumor (15, 17).

We hypothesized that detection of BRAF mutation in cytological specimens from thyroid fine needle aspiration would be applicable; it may improve the diagnostic accuracy and identify the BRAF mutation-positive PTC patients who have poor clinicopathological outcomes so that their surgery can be appropriately planned. In this prospective study, we have used direct DNA sequencing technique and a novel colorimetric mutation detection method to test this hypothesis in a series of patients with thyroid nodules for whom thyroid surgery was planned, and we compared the tumors’ BRAF mutation status detected on preoperative cytological specimens with the final histopathological characterization of the tumor. Our data show that BRAF mutation can be readily and reliably detected on thyroid cytological specimens and has the potential to become a useful adjunct tool to FNAB for optimal diagnostic and prognostic evaluation of thyroid nodules that will guide the subsequent appropriate surgical management and clinical follow-up.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients, FNAB procedures, tumor tissues, and thyroid cell lines

With approval by the Johns Hopkins School of Medicine Institutional Review Board and patient consent, we recruited 48 study patients from whom we were able to obtain preoperative thyroid FNAB specimens for BRAF mutation analysis. These patients were chosen for this study because their thyroid nodule was easily palpable for fine needle aspiration and they were considered for thyroid surgery. For the research fine needle aspiration procedure, three to four passes with 27- to 22-gauge needles were typically made to harvest cytological material for analysis, from the dominant palpable nodule, either in the outpatient clinic or in the operating room immediately before surgery. Specimens were collected in normal saline in a 50-ml Falcon plastic tube. After centrifugation, the pellet was resuspended and pelleted twice in Cyto-Rich Red solution (ThermoShandon, Pittsburgh, PA) to lyze red blood cells, followed by two washings with normal saline by repeating the pelleting and resuspending procedures using a microcentrifuge.

DNA isolation

Tumor tissue and cell line genomic DNA was isolated using a protocol described previously (19). Briefly, the cells were incubated with 1% sodium dodecyl sulfate and 0.5 mg/ml proteinase K at 48 C for 48 h, with a midinterval addition of concentrated proteinase K to facilitate protein digestion. DNA was subsequently isolated from the digested tissues by standard phenol-chloroform extraction procedure and precipitated with 70% ethanol and resuspended in water before use.

Detection of T1796A transversion BRAF mutation

Because the T1796A transversion mutation in exon 15 of the BRAF gene is the most common mutation of this gene in cancers (10) and is specifically found in PTC (11, 12, 13, 14, 15, 16, 17, 18), we analyzed this mutation on thyroid cytological specimens in the present study. The mutation was sought in all specimens by both direct DNA sequencing and a recently established colorimetric mutation detection method (Mutector, TrimGen, Sparks, MD).

For direct DNA sequencing, exon 15 containing the site in which T1796A mutation occurs was first PCR-amplified using the primers as described previously (10): TCATAATGCTTGCTCTGATAGGA (forward) and GGCCAAAAATTTAATCAGTGGA (reverse). The PCR was run with a step-down protocol: 95 C for 5 min x 1 cycle; 95 C for 1 min, 60 C for 1 min, and 72 C for 1 min, x 2 cycles; 95 C for 1 min, 58 C for 1 min, and 72 C for 1 min x 2 cycles; 95 C for 1 min, 56 C for 1 min, and 72 C for 1 min x 40 cycles. A final extension at 72 C for 5 min was added. The reaction mixture contained, in a final volume of 30 µl, 16.6 mM ammonium sulfate, 67 mM Tris (pH 8.8), 10 mM 2-mercaptoethanol, 1.5 mM each deoxynucleotide triphosphate, 6.7 mM MgCl2, 5% dimethylsulfoxide, 1.67 µM each primers (forward and reverse), 60 ng genomic DNA, and 0.5 U of platinum DNA Taq polymerase (Life Technologies, Rockville, MD). A single major PCR product was confirmed by running the PCR products on a 1.5% agarose gel. The PCR products were subsequently subjected to sequencing reaction using the forward primer described above and Big Dye terminator V 3.0 cycle sequencing reagents (Applied Biosystems, Foster City, CA), with the following PCR cycles: 95 C for 30 sec x 1 cycle; 95 C for 15 sec, 50 C for 15 sec, and 60 C for 4 min x 35 cycles. DNA sequence was then read on an ABI PRISM 3700 DNA Analyzer (Applied Biosystems), and the T1796A mutation was identified.

BRAF mutation analysis with the colorimetric method was performed following the instructions of the manufacturer (TrimGen). This is a novel colorimetric gene mutation detection method based on shifted termination assay, in which a specifically designed detection primer hybridizes to the target sequence of the gene with its 3' terminus ending just before the target base, so that primer extension does not occur unless the target base is changed, i.e. a T1796A transversion mutation in the case of BRAF gene. With the mutated allele, the primer extension continues through the target base until the next termination point, and multiple labeled nucleotides are incorporated through this process, forming the basis for specific colorimetric differentiation of the mutated from the wild-type allele. Specifically for BRAF mutation, the detection process involved an initial PCR amplification of exon 15 of the BRAF gene, as described above, followed by hybridization of the PCR products to the specific detection primer attached to the strips in a 96-well plate and subsequent primer extension on a PCR block with the setting of 95 C for 1 min, 56 C for 1 min, and 72 C for 1 min x 15 cycles. This was followed by the final color development through an enzymatic reaction, and the intensity of the color was quantified by a colorimetry microplate reader at a wavelength of 405 nm.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Characteristics and pathological diagnosis of the thyroid nodules studied

We prospectively studied 48 patients from whom we could obtain preoperative cytological specimens for BRAF mutation analysis. Except for three patients, in all the other 45 patients, the nodule biopsied was confirmed by physical examination, preoperative imaging studies (sonography or computed tomography), or by final surgery to be either the solitary or largest (i.e. dominant) nodule in the gland and readily identifiable for a correlation of the BRAF mutation status with the final histological diagnosis. Thus, a total of 45 patients were included in the final analysis (Table 1Go). Among these 45 patients, 40 underwent thyroidectomy for a thyroid nodule based on indeterminate (n = 25) or malignant (n = 10) cytological findings or for large benign goiter (n = 3) or Graves’ disease (n = 1) or amiodarone-induced thyrotoxicosis (n = 1); one patient with indeterminate cytological findings chose not to pursue surgery, and four were not operated on because the cytological findings were consistent with a diagnosis of benign thyroid adenoma. Patient 9 had two nodules of similar size (2 and 1.7 cm), both of which proved histologically to be PTC. Although we could not be certain which lesion had been aspirated preoperatively, their identical histological diagnoses nonetheless permitted us to conclude that the BRAF mutation in the cytological specimen predicted the diagnosis of PTC. Therefore, this patient was included in our final analysis. In patient 17, the aspirated thyroid nodule for this study was the largest one, which proved to be a 5-cm metastasis from renal cell carcinoma. Although two smaller nodules in this patient’s gland were histologically identified as PTC, they were not the nodules biopsied for BRAF mutation detection and, therefore, were not included in the final analysis. Patient 24 had Graves’ disease without a thyroid tumor. Patient 41 had thyroidectomy for intractable amiodarone-induced thyrotoxicosis without tumor. In several patients who were found to have incidental foci of microscopic PTC (1–5 mm), only the histological findings in the dominant nodule that had been aspirated were considered in the analysis (Table 1Go). Altogether, the final histopathological diagnoses of the biopsied thyroid nodules included in this study were PTC (n = 16), follicular thyroid cancer (FTC, n = 5), Hurthle cell carcinoma (n = 1), benign adenoma or hyperplasia (n = 18), metastatic renal cancer (n = 1), Graves’ disease (n = 1), Hashimoto’s thyroiditis (n = 1), amiodarone-induced thyroiditis (n = 1), and one nonoperated indeterminate lesion.


View this table:
[in this window]
[in a new window]
 
TABLE 1. BRAF mutation status and characteristics of the individual biopsied thyroid nodules

 
Test of the sensitivity and specificity of the colorimetric method in detecting BRAF mutation

To define the specificity and sensitivity of the colorimetric mutation detection method for the BRAF T1796A transversion mutation, we compared its results to the "gold standard" of direct DNA sequencing in a large pool of genomic DNA samples isolated from various primary benign and malignant thyroid tumors, as well as several thyroid tumor cell lines. Figure 1AGo shows an example of wild allele and an example of mutated allele for BRAF T1796A transversion mutation by direct DNA sequencing. Figure 1BGo shows an example of the result on BRAF mutation detection using the colorimetric method, with the mutation-positive samples showing up as blue color and the mutation-negative samples showing no color. Figure 1CGo shows the results of quantitative colorimetric measurement of the data in Fig. 1BGo, with the mutation-negative and -positive groups clearly separated from each other. Altogether from different experiments, 23 samples found to be BRAF mutation positive by direct DNA sequencing were also detected as positive for mutation in the colorimetric assay, and 68 samples found to be BRAF mutation negative by direct DNA sequencing were also negative in the colorimetric assay.



View larger version (48K):
[in this window]
[in a new window]
 
FIG. 1. Comparison of conventional DNA sequencing and colorimetric assay in the detection of BRAF mutation—a test of the sensitivity and specificity of the colorimetric assay. A, A representative of DNA sequencing result of a T1796A transversion mutation-negative sample (wild allele) and a mutation-positive sample (mutated allele) in the sequence TACAGTGAAATCT. B, An experiment of the colorimetric assay, with the blue-colored wells representing mutation-positive samples, and the wells without color change representing mutation-negative samples. C, The results of quantitative colorimetric measurement of the data in panel B. As seen in panel C, the two groups of samples, determined to be mutation-negative (denoted with -) and mutation-positive (denoted with +), respectively, by conventional DNA sequencing technique, can be clearly separated from each other by the colorimetric assay. Thus, both the sensitivity and specificity of the colorimetric assay are 100% in detecting BRAF mutation.

 
Detection of BRAF T1796A transversion mutation on FNAB specimens

We analyzed preoperative cytological specimens for T1796A transversion BRAF mutation by both DNA sequencing and the colorimetric assay. Results are shown in Table 1Go for each individual patient and are summarized in Table 2Go for the entire group of 45 patients. The cytological specimens from all the 21 patients with benign lesions (18 benign neoplasms, one case of Graves’ disease, one case of Hashimoto’s thyroiditis, and one case of amiodarone-induced thyroiditis), the five patients with a histopathological diagnosis of FTC, and one patient with Hurthle cell carcinoma were all negative for BRAF mutation, as detected by both direct DNA sequencing and colorimetric assay. The cytological specimen from the renal cell carcinoma metastasis was also negative for BRAF mutation by either method. Among cytological specimens from the nodules in 16 patients with histopathological diagnoses of PTC, six were positive for BRAF mutation by direct DNA sequencing. These six BRAF mutation-positive PTC and, additionally, two more PTC, were also positive for BRAF mutation per analysis by the colorimetric assay, yielding a total prevalence of BRAF mutation of 50% in PTC (Table 2Go).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Summary of BRAF mutation data on preoperative thyroid FNAB specimens (per colorimetric assay)

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thyroid nodule is a common endocrine condition that sometimes represents a significant diagnostic challenge in differentiating benign from malignant lesions. Although FNAB cytology often provides a definitive diagnosis and sound therapeutic guidance, indeterminate cytological findings occur in 20% of the cases (9). Most of these patients must undergo thyroid surgery, although only a minority of them proves to harbor cancer. The extent of thyroid surgery in these patients has been a controversial issue; total thyroidectomy is potentially associated with higher risk for operative complications and the certain need for lifelong postoperative thyroid hormone replacement therapy, whereas hemithyroidectomy carries the risk of leaving significant cancer in the remaining lobe (20, 21, 22) and lessens the specificity of long-term monitoring with the circulating tumor marker thyroglobulin. Currently, some patients with indeterminate cytological findings undergo total thyroidectomy, whereas others choose to have hemithyroidectomy. Patients in the latter group who prove to have thyroid cancer are usually advised to undergo completion thyroidectomy. Consequently, for thyroid nodule patients with cytologically indeterminate findings, preoperative detection of a specific molecular cancer marker, such as the PTC-specific BRAF mutation, would be especially helpful. In addition, risk and prognostic assessment of thyroid cancer patients is normally performed based on a number of clinicopathological parameters. Unfortunately, tumor pathological parameters become known only after the surgery, and, therefore, an effective and efficient risk and prognostic evaluation of thyroid cancer usually cannot be achieved preoperatively. This also often creates an obstacle for optimal surgical planning, even when a diagnosis of thyroid cancer can be clearly made on FNAB cytology studies.

Use of molecular markers for diagnostic and prognostic evaluation of thyroid cancer has been explored extensively (23, 24). Although more than 50 molecular markers have been studied, none of them has yet become clinically useful (24). All of the markers studied to date, including thyroid peroxidase, human telomerase reverse transcriptase, and galectin-3, have had significant limitations, such as the lack of specificity, molecular instability, and variable reproducibility. For example, immunohistochemical staining of thyroid peroxidase, a differentiation marker suggestive of a benign neoplasm, often has an inadequate specificity to definitively diagnose thyroid cancer (24). RT-PCR detection of human telomerase reverse transcriptase on FNAB specimens initially showed promising specificity and sensitivity for diagnosing thyroid cancer (25), but more recent studies using quantitative RT-PCR have demonstrated high expression levels of this molecule in FNAB specimens from benign thyroid neoplasms as well (24). Similarly, galectin-3, which may be the most promising diagnostic marker for thyroid cancer (24), is sometimes also seen in benign adenomas (26). Classical genetic alterations in thyroid tumors, such as Ras mutation (27), RET/PTC rearrangements (28), and PAX8/PPAR{gamma} rearrangements (29) are now all known also to be found in some benign thyroid neoplasms. In contrast, the BRAF mutation appears promising as a diagnostic marker because it represents a stable molecular marker with 100% specificity and relatively high sensitivity for thyroid cancer (11, 12, 13, 14, 15, 16, 17, 18). Moreover, the T1796A transversion mutation BRAF mutation is a novel genetic marker that predicts a poor prognosis for PTC. Recently, Namba et al. (15) reported a significant association of BRAF mutation with distant metastasis and advanced pathological stages of PTC. Nikiforova et al. (17) reported a significant association of BRAF mutation with extrathyroidal invasion and advanced pathological stages of PTC. We (our unpublished data) have recently conducted a retrospective study on BRAF mutation and clinicopathologic outcomes in a large series of patients with PTC and confirmed the previous findings (15, 17). In addition, we also observed a statistically significant association of BRAF mutation with neck lymph node metastasis and a higher incidence of cancer recurrence over a long period of clinical follow-up. With multivariate analysis, we also found that BRAF mutation is an independent prognostic factor that clearly predicts a poor prognosis for PTC.

In the present study, we have demonstrated that detection of BRAF mutation on FNAB specimens can be easily and reliably performed, and that it correctly identified 50% of PTC. We have also shown the usefulness and reliability of a new colorimetric mutation detection technique in detecting BRAF mutation, demonstrating its 100% specificity and superior sensitivity over conventional DNA sequencing to detect BRAF mutation on FNAB specimens. DNA from FNAB specimens is invariably contaminated with wild allele of the BRAF gene from normal tissues, which often make the somatically mutated alleles indiscernible on direct DNA sequencing analysis. However, the colorimetric assay can detect the mutation even when only 1% of total DNA molecules are mutated alleles (TrimGen). In evaluating the sensitivity and specificity of this colorimetric assay, most of our BRAF mutation-negative samples were benign thyroid neoplasms, which have been consistently shown to lack BRAF mutation in numerous previous studies (11, 12, 13, 14, 15, 16, 17, 18). The cancer samples used, as described previously (19), were microdissected and contained almost exclusively cancer cells. Therefore, the BRAF mutation states determined by the direct sequencing technique on these samples could be reliably used as "gold standard" to assess the colorimetric assay for BRAF mutation detection (Fig. 1Go). Consistent with previous findings, BRAF mutation was found only in PTC with a prevalence (50%) comparable to that reported in most of the previous studies (11, 12, 13, 14, 15, 16, 17, 18); this further attests to the reliability of the results obtained with the colorimetric method. In two of our cases (nos. 19 and 36), the diagnostic FNAB cytological findings were indeterminate, whereas the BRAF mutation was identified both by direct DNA sequencing and colorimetric assay on FNAB-derived materials (Table 1Go). These two cases illustrate the potential usefulness of BRAF mutation detection on FNAB specimens to confirm the preoperative diagnosis and define optimal surgical management, i.e. total thyroidectomy, for some patients with cytologically indeterminate thyroid nodules.

Because the prevalence of BRAF mutation in the subset of thyroid nodules with indeterminate cytological findings on FNAB is not well defined and the number of the patients in the present study is limited, we are unable to extrapolate the full diagnostic utility of BRAF mutation detection on FNAB for these thyroid nodules. However, one might anticipate that detection of BRAF mutation on FNAB specimens may prove diagnostically helpful in a substantial number of cases because the prevalence of BRAF mutation in PTC is relatively high and PTC account for the vast majority of thyroid cancers. In view of the large and increasing number of newly discovered thyroid nodules (275,000/yr in the United States) in recent years that require evaluation (30), detection of BRAF mutation on FNAB specimens could be a useful diagnostic adjunctive technique in evaluation of thyroid nodules with indeterminate cytological findings, although this requires further definition by a larger study. More importantly, and perhaps most usefully, detection of BRAF mutation in adjunction with routine FNAB will make preoperative risk and prognostic evaluation of PTC more efficient and effective; it will help identify the BRAF mutation-positive PTC patients who are likely to have poor clinicopathological outcomes and therefore can be appropriately planned for optimal surgery (e.g. more extensive neck dissection) and vigilant postoperative clinical monitoring for cancer recurrence. In this sense, it may become an important future practice to examine BRAF mutation on FNAB specimens in every thyroid cancer patient preoperatively, even when the diagnosis of PTC is already clearly defined based on cytology findings.


    Footnotes
 
This work was supported in part by National Institutes of Health Grants UO1 CA 98-028 and RO1 DE13561-01. M.X. is the recipient of a Johns Hopkins Clinician Scientist Award.

Abbreviations: FNAB, Fine needle aspiration biopsy; FTC, follicular thyroid cancer; PTC, papillary thyroid cancer.

Received November 26, 2003.

Accepted February 16, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hundahl SA, Fleming ID, Fremgen AM, Menck HR 1998 A National Cancer Data Base report on 53,856 cases of thyroid carcinoma treated in the U.S., 1985–1995. Cancer 83:2638–2648[CrossRef][Medline]
  2. Paterson IC, Greenlee R, Adams Jones D 1999 Thyroid cancer in Wales 1985–1996: a cancer registry-based study. Clin Oncol (R Coll Radiol) 11:245–251
  3. Vander JB, Gaston EA, Dawber TR 1968 The significance of nontoxic thyroid nodules. Final report of a 15-year study of the incidence of thyroid malignancy. Ann Intern Med 69:537–540
  4. Brander A, Viikinkoski P, Nickels J, Kivisaari L 1991 Thyroid gland: US screening in a random adult population. Radiology 181:683–687[Abstract/Free Full Text]
  5. Bruneton JN, Balu-Maestro C, Marcy PY, Melia P, Mourou MY 1994 Very high frequency (13 MHz) ultrasonographic examination of the normal neck: detection of normal lymph nodes and thyroid nodules. J Ultrasound Med 13:87–90[Abstract]
  6. Werk Jr EE, Vernon BM, Gonzalez JJ, Ungaro PC, McCoy RC 1984 Cancer in thyroid nodules. A community hospital survey. Arch Intern Med 144:474–476[Abstract/Free Full Text]
  7. Belfiore A, Giuffrida D, La Rosa GL, Ippolito O, Russo G, Fiumara A, Vigneri R, Filetti S 1989 High frequency of cancer in cold thyroid nodules occurring at young age. Acta Endocrinol (Copenh) 121:197–202[Abstract/Free Full Text]
  8. Singer PA, Cooper DS, Daniels GH, Ladenson PW, Greenspan FS, Levy EG, Braverman LE, Clark OH, McDougall IR, Ain KV, Dorfman SG 1996 Treatment guidelines for patients with thyroid nodules and well-differentiated thyroid cancer. Arch Intern Med 156:2165–2172[Abstract/Free Full Text]
  9. Gharib H, Goellner JR, Zinsmeister AR, Grant CS, Van Heerden JA 1984 Fine-needle aspiration biopsy of the thyroid. The problem of suspicious cytologic findings. Ann Intern Med 101:25–28
  10. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W, Davis N, Dicks E, Ewing R, Floyd Y, Gray K, Hall S, Hawes R, Hughes J, Kosmidou V, Menzies A, Mould C, Parker A, Stevens C, Watt S, Hooper S, Wilson R, Jayatilake H, Gusterson BA, Cooper C, Shipley J, Hargrave D, Pritchard-Jones K, Maitland N, Chenevix-Trench G, Riggins GJ, Bigner DD, Palmieri G, Cossu A, Flanagan A, Nicholson A, Ho JW, Leung SY, Yuen ST, Weber BL, Seigler HF, Darrow TL, Paterson H, Marais R, Marshall CJ, Wooster R, Stratton MR, Futreal PA 2002 Mutations of the BRAF gene in human cancer. Nature 417:949–954[CrossRef][Medline]
  11. Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE, Fagin JA 2003 High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res 63:1454–1457[Abstract/Free Full Text]
  12. Cohen Y, Xing M, Mambo E, Guo Z, Wu G, Trink B, Beller U, Westra WH, Ladenson PW, Sidransky D 2003 BRAF mutation in papillary thyroid carcinoma. J Natl Cancer Inst 95:625–627[Abstract/Free Full Text]
  13. Soares P, Trovisco V, Rocha AS, Lima J, Castro P, Preto A, Maximo V, Botelho T, Seruca R, Sobrinho-Simoes M 2003 BRAF mutations and RET/PTC rearrangements are alternative events in the etiopathogenesis of PTC. Oncogene 22:4578–4580[CrossRef][Medline]
  14. Xu X, Quiros RM, Gattuso P, Ain KB, Prinz RA 2003 High prevalence of BRAF gene mutation in papillary thyroid carcinomas and thyroid tumor cell lines. Cancer Res 63:4561–4567[Abstract/Free Full Text]
  15. Namba H, Nakashima M, Hayashi T, Hayashida N, Maeda S, Rogounovitch TI, Ohtsuru A, Saenko VA, Kanematsu T, Yamashita S 2003 Clinical implication of hot spot BRAF mutation, V599E, in papillary thyroid cancers. J Clin Endocrinol Metab 88:4393–4397[Abstract/Free Full Text]
  16. Fukushima T, Suzuki S, Mashiko M, Ohtake T, Endo Y, Takebayashi Y, Sekikawa K, Hagiwara K, Takenoshita S 2003 BRAF mutations in papillary carcinomas of the thyroid. Oncogene 22:6455–6457[CrossRef][Medline]
  17. Nikiforova MN, Kimura ET, Gandhi M, Biddinger PW, Knauf JA, Basolo F, Zhu Z, Giannini R, Salvatore G, Fusco A, Santoro M, Fagin JA, Nikiforov YE 2003 BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. J Clin Endocrinol Metab 88:5399–5404[Abstract/Free Full Text]
  18. Xing M, Vasko V, Tallini G, Larin A, Wu G, Udelsman R, Ringel MD, Ladenson PW, Sidransky D 2004 BRAF T1796A transversion mutation in various thyroid neoplasms. J Clin Endocrinol Metab 89:1365–1368[Abstract/Free Full Text]
  19. Xing M, Usadel H, Cohen Y, Tokumaru Y, Guo Z, Westra WB, Tong BC, Tallini G, Udelsman R, Califano JA, Ladenson PW, Sidransky D 2003 Methylation of the thyroid-stimulating hormone receptor gene in epithelial thyroid tumors: a marker of malignancy and a cause of gene silencing. Cancer Res 63:2316–2321[Abstract/Free Full Text]
  20. Pacini F, Elisei R, Capezzone M, Miccoli P, Molinaro E, Basolo F, Agate L, Bottici V, Raffaelli M, Pinchera A 2001 Contralateral papillary thyroid cancer is frequent at completion thyroidectomy with no difference in low- and high-risk patients. Thyroid 11:877–881[CrossRef][Medline]
  21. Kupferman ME, Mandel SJ, DiDonato L, Wolf P, Weber RS 2002 Safety of completion thyroidectomy following unilateral lobectomy for well-differentiated thyroid cancer. Laryngoscope 112:1209–1212[CrossRef][Medline]
  22. Erdem E, Gulcelik MA, Kuru B, Alagol H 2003 Comparison of completion thyroidectomy and primary surgery for differentiated thyroid carcinoma. Eur J Surg Oncol 29:747–749[CrossRef][Medline]
  23. Ringel MD 2000 Molecular diagnostic tests in the diagnosis and management of thyroid carcinoma. Rev Endocr Metab Disord 1:173–181[CrossRef][Medline]
  24. Haugen BR, Woodmansee WW, McDermott MT 2002 Towards improving the utility of fine-needle aspiration biopsy for the diagnosis of thyroid tumours. Clin Endocrinol (Oxf) 56:281–290[CrossRef][Medline]
  25. Zeiger MA, Smallridge RC, Clark DP, Liang CK, Carty SE, Watson CG, Udelsman R, Saji M 1999 Human telomerase reverse transcriptase (hTERT) gene expression in FNA samples from thyroid neoplasms. Surgery 126:1195–1198[CrossRef][Medline]
  26. Orlandi F, Saggiorato E, Pivano G, Puligheddu B, Termine A, Cappia S, De Giuli P, Angeli A 1998 Galectin-3 is a presurgical marker of human thyroid carcinoma. Cancer Res 58:3015–3020[Abstract/Free Full Text]
  27. Moretti F, Nanni S, Pontecorvi A 2000 Molecular pathogenesis of thyroid nodules and cancer. Baillieres Best Pract Res Clin Endocrinol Metab 14:517–539[CrossRef][Medline]
  28. Elisei R, Romei C, Vorontsova T, Cosci B, Veremeychik V, Kuchinskaya E, Basolo F, Demidchik EP, Miccoli P, Pinchera A, Pacini F 2001 RET/PTC rearrangements in thyroid nodules: studies in irradiated and not irradiated, malignant and benign thyroid lesions in children and adults. J Clin Endocrinol Metab 86:3211–3216[Abstract/Free Full Text]
  29. Cheung L, Messina M, Gill A, Clarkson A, Learoyd D, Delbridge L, Wentworth J, Philips J, Clifton-Bligh R, Robinson BG 2003 Detection of the PAX8-PPAR {gamma} fusion oncogene in both follicular thyroid carcinomas and adenomas. J Clin Endocrinol Metab 88:354–357[Abstract/Free Full Text]
  30. Kim N, Lavertu P 2003 Evaluation of a thyroid nodule. Otolaryngol Clin North Am 36:17–33[CrossRef][Medline]



This article has been cited by other articles:


Home page
JCOHome page
M. Xing, D. Clark, H. Guan, M. Ji, A. Dackiw, K. A. Carson, M. Kim, A. Tufaro, P. Ladenson, M. Zeiger, et al.
BRAF Mutation Testing of Thyroid Fine-Needle Aspiration Biopsy Specimens for Preoperative Risk Stratification in Papillary Thyroid Cancer
J. Clin. Oncol., June 20, 2009; 27(18): 2977 - 2982.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. E. Nikiforov, D. L. Steward, T. M. Robinson-Smith, B. R. Haugen, J. P. Klopper, Z. Zhu, J. A. Fagin, M. Falciglia, K. Weber, and M. N. Nikiforova
Molecular Testing for Mutations in Improving the Fine-Needle Aspiration Diagnosis of Thyroid Nodules
J. Clin. Endocrinol. Metab., June 1, 2009; 94(6): 2092 - 2098.
[Abstract] [Full Text] [PDF]


Home page
RadiologyHome page
N. A. Johnson and M. E. Tublin
Postoperative Surveillance of Differentiated Thyroid Carcinoma: Rationale, Techniques, and Controversies
Radiology, November 1, 2008; 249(2): 429 - 444.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
W. Mendez, S. E. Rodgers, J. I. Lew, R. Montano, and C. C. Solorzano
Role of Surgeon-Performed Ultrasound in Predicting Malignancy in Patients with Indeterminate Thyroid Nodules
Ann. Surg. Oncol., September 1, 2008; 15(9): 2487 - 2492.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. N. Nikiforova, G. C. Tseng, D. Steward, D. Diorio, and Y. E. Nikiforov
MicroRNA Expression Profiling of Thyroid Tumors: Biological Significance and Diagnostic Utility
J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1600 - 1608.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
G. Riesco-Eizaguirre and P. Santisteban
New insights in thyroid follicular cell biology and its impact in thyroid cancer therapy
Endocr. Relat. Cancer, December 1, 2007; 14(4): 957 - 977.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
M. R. Sapio, A. Guerra, D. Posca, P. P. Limone, M. Deandrea, M. Motta, G. Troncone, A. Caleo, P. Vallefuoco, G. Rossi, et al.
Combined analysis of galectin-3 and BRAFV600E improves the accuracy of fine-needle aspiration biopsy with cytological findings suspicious for papillary thyroid carcinoma
Endocr. Relat. Cancer, December 1, 2007; 14(4): 1089 - 1097.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
L. R Rowe, B. G Bentz, and J. S Bentz
Detection of BRAF V600E activating mutation in papillary thyroid carcinoma using PCR with allele-specific fluorescent probe melting curve analysis
J. Clin. Pathol., November 1, 2007; 60(11): 1211 - 1215.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
C. Spittle, M. R. Ward, K. L. Nathanson, P. A. Gimotty, E. Rappaport, M. S. Brose, A. Medina, R. Letrero, M. Herlyn, and R. H. Edwards
Application of a BRAF Pyrosequencing Assay for Mutation Detection and Copy Number Analysis in Malignant Melanoma
J. Mol. Diagn., September 1, 2007; 9(4): 464 - 471.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
C. S. Mitsiades, J. Negri, C. McMullan, D. W. McMillin, E. Sozopoulos, G. Fanourakis, G. Voutsinas, S. Tseleni-Balafouta, V. Poulaki, D. Batt, et al.
Targeting BRAFV600E in thyroid carcinoma: therapeutic implications
Mol. Cancer Ther., March 1, 2007; 6(3): 1070 - 1078.
[Abstract] [Full Text] [PDF]


Home page
Arch SurgHome page
E. A. Mittendorf, A. Khiyami, and C. R. McHenry
When Fine-Needle Aspiration Biopsy Cannot Exclude Papillary Thyroid Cancer: A Therapeutic Dilemma
Arch Surg, October 1, 2006; 141(10): 961 - 966.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
L Fugazzola, E Puxeddu, N Avenia, C Romei, V Cirello, A Cavaliere, P Faviana, D Mannavola, S Moretti, S Rossi, et al.
Correlation between B-RAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: data from a multicentric Italian study and review of the literature.
Endocr. Relat. Cancer, June 1, 2006; 13(2): 455 - 464.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
M. R. Sapio, D. Posca, G. Troncone, G. Pettinato, L. Palombini, G. Rossi, G. Fenzi, and M. Vitale
Detection of BRAF mutation in thyroid papillary carcinomas by mutant allele-specific PCR amplification (MASA)
Eur. J. Endocrinol., February 1, 2006; 154(2): 341 - 348.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Xing, W. H. Westra, R. P. Tufano, Y. Cohen, E. Rosenbaum, K. J. Rhoden, K. A. Carson, V. Vasko, A. Larin, G. Tallini, et al.
BRAF Mutation Predicts a Poorer Clinical Prognosis for Papillary Thyroid Cancer
J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6373 - 6379.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
M Xing
BRAF mutation in thyroid cancer
Endocr. Relat. Cancer, June 1, 2005; 12(2): 245 - 262.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xing, M.
Right arrow Articles by Ladenson, P. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xing, M.
Right arrow Articles by Ladenson, P. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals