| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
-Like Protein 1/Preadipocyte Factor-1, Proliferating Cell Nuclear Antigen, and QM/Jif-1
Departments of Surgical Sciences (P.S., D.L., G.W., J.R.) and Medical Sciences (P.G., M.S., Y.Z., A.G., K.Ö., S.W., B.S.), University Hospital, 751 85 Uppsala, Sweden
Address all correspondence and requests for reprints to: Britt Skogseid, Department of Medical Sciences, University Hospital, 751 85 Uppsala, Sweden. E-mail: britt.skogseid{at}medsci.uu.se.
| Abstract |
|---|
|
|
|---|
-like protein 1/preadipocyte factor-1 (involved in differentiation and growth of the pancreatic endocrine cells), proliferating cell nuclear antigen, and QM/Jif-1 (a negative regulator of c-Jun) became down-regulated. These findings might contribute to the understanding of the tissue-specific features of MEN1. We also show that homozygous inactivation of the MEN1 gene statistically correlates to higher expression of
-like protein 1/preadipocyte factor-1, proliferating cell nuclear antigen, and QM/Jif-1, as well as lower MEN1 expression, in a limited sample of malignant endocrine pancreatic tumors. | Introduction |
|---|
|
|
|---|
Based on the observation that tumors of affected individuals have lost the wild-type allele, it is suggested that the MEN1 gene is a tumor suppressor gene. Loss of heterozygosity (LOH) at 11q13 has been found not only in MEN1, but also in low frequency in sporadic pituitary tumors (5) and in 3070% of sporadic tumors of the parathyroids and the endocrine pancreas (6, 7, 8). A subset of the sporadic tumors with LOH at 11q13 exhibits mutations in the MEN1 gene ranging from 3058% in different studies (6, 7, 8).
MEN1 RNA and protein are expressed in all normal tissues studied (9), thus leaving the basis for endocrine predominance of neoplasia unexplained. Mutations in the MEN1 gene frequently predict protein truncation that possibly leads to inactivated function consistent with the idea of a tumor suppressor gene (10). It has been shown that menin interacts with the activator protein-1 (AP-1) transcription factor JunD (11) and that this could be mediated by a histone deacetylase-dependent mechanism (12). Furthermore, menin interacts with Smad3 (13) and inhibits NF
B-mediated transactivation (14). It has been shown that menin interacts with the homeobox-containing protein pem, the tumor metastasis suppressor nm23, the glial fibrillary acidic protein and vimentin, the 32-kDa subunit of replication protein A, and nonmuscle myosin II-A heavy chain, and it has been shown that menin uncouples Elk-1, JunD, and c-Jun phosphorylation from MAPK activation (15, 16, 17, 18, 19, 20). Recently, it was shown that menin is a repressor of telomerase activity through hTERT (protein component of telomerase) in human fibroblasts, and, when depleting menin, it immortalizes the cells causing a transformation phenotype when coupled with expression of simian virus 40 large and small T antigen and oncogenic ras (21). Furthermore, overexpression of menin was reported to suppress insulin-induced AP-1 activity in CHO-IR cells, expressing high levels of insulin receptor, and menin suppressed c-Fos induction at the transcriptional level (22). Overexpression of menin in RAS-transformed NIH3T3 cells partially suppressed the RAS-mediated tumor phenotype in vitro and in vivo (23). Mouse models of MEN1 further support the role of this gene as a tumor suppressor gene (24, 25). However, the effects of MEN1 in human neuroendocrine cells and its role in gene regulation remain elusive. We identified a human endocrine pancreatic tumor cell line (BON1) with barely detectable protein expression of menin compared with a panel of other cell lines and stably transfected the BON1 cells with a MEN1 construct to investigate whether menin could reverse the phenotype in human tumor cells low in menin expression, and if doing so, we hoped to determine what genes would become differentially expressed. We monitored cell growth in vitro, and by using Atlas cDNA macroarrays (Clontech, Palo Alto, CA), we identified genes differentially expressed in low menin-expressing compared with menin-expressing neuroendocrine tumor cells. These findings of genes found on cDNA macroarray analysis were corroborated with Northern blots or real-time quantitative RT-PCR (QPCR). By using QPCR, we also compared the expression levels of the corroborated genes between malignant human endocrine pancreatic tumors with homozygous inactivation of the MEN1 gene to malignant endocrine pancreatic tumors without MEN1 gene alterations.
| Materials and Methods |
|---|
|
|
|---|
BON1 wild type (BON/wt; a human endocrine pancreatic tumor cell line with serotonin, neurotensin, and chromogranin A production) (26) was a kind gift from Dr. J. C. Thompson (Department of Surgery, University of Texas Medical Branch, Galveston, TX). We received an early passage in the beginning of the 1990s, cleared it from Mycoplasma, and stored it at 150 C until used in this study. BON/wt showed barely detectable expression of menin at the protein level compared with other cell lines (Fig. 1
, left). To culture BON1 cells, a 1:1 mixture of F12K (Life Technologies, Gaithersburg, FL) and DMEM (SVA, Uppsala, Sweden) medium was used and supplemented with 5% fetal bovine serum. The cells also received 1% penicillin-streptomycin and 1% L-glutamine (Biochrom KG, Berlin, Germany) and were housed in an incubator maintaining an atmosphere of 90% humidity and 5.0% CO2 at 37 C. All cell samplings for preparation of RNA and proteins were consistently performed on cells cultured to a confluency of 80%. Culture for Mycoplasma was negative both before and after the experimental series.
|
For transfections, the coding region of the MEN1 cDNA was inserted into the pcDNA3 plasmid vector (Invitrogen, Carlsbad, CA) using standard cloning techniques. This construct was transfected to the BON1 cell line according to the Lipofectin reagent protocol (Life Technologies), and stable transfectants were selected in gentamycin (Life Technologies) at a concentration of 400 µg/ml. We clonally expanded three different clones named BON/M1A, M1B, and M1C. Furthermore, BON1 was transfected with pcDNA3 without insert [BON1 vector control (BON/v)]. After clonal expansion, transfectants were cultured in the presence of 400 µg/ml gentamycin and used at passages 4 and 5.
mRNA analysis
Total RNA from the BON1 cells described earlier was isolated at passages 4 and 5 as previously described (27). Cells were harvested at the same confluency of 80%. Forty micrograms were used to isolate mRNA using PolyAtract (Promega, Madison, WI) and examined for MEN1 mRNA expression by Northern blot analysis. Northern blots were performed as described (28). For the detection of MEN1 mRNA, cDNA excised from pCR Bac (Invitrogen) containing human MEN1 cDNA (4) was used as a probe, and for the detection of JunD mRNA, a probe was made using a PCR product generated from cDNA with JunD-specific primers (12). To control for variations in loading and transfer among samples, the MEN1 and JunD signals were normalized to ß-actin signals obtained on the same blot. Northern blots were repeated twice using the different mRNA pools from passages 4 and 5. All calculations of relative densitometric units were done using the ImageQuant software (Amersham Biosciences, Uppsala, Sweden) corrected for variations in loading and transfer.
Protein analysis
Total cell lysates from the different clones (BON/wt, BON/v, BON/M1A, M1B, and M1C) at passages 4 and 5 and from COS-7 (monkey kidney; American Type Culture Collection, Manassas, VA) (29), HEK-293 (human embryonic kidney; American Type Culture Collection) (30), Jurkat (human T-cell leukemia; American Type Culture Collection) (31), and U-343 (human glioma; a kind gift from Dr. E. Bongcam-Rudloff, Uppsala, Sweden) (32) were prepared, and 20 µg of protein sample from each clone and cell line were analyzed for menin expression by Western blotting using an antimenin antibody (N19, dilution 1:100; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Cells were consistently harvested at a confluency of 80%. Protein was prepared by lysing the cells in a lysis buffer containing 1% sodium dodecyl sulfate, 1 mM sodium-orthovanadate, and 10 mM Tris buffer and then boiled for 5 min. Western blotting and filter development was performed as described previously (33). ß-actin (Santa Cruz Biotechnology) immunoblotting was used as a control for variations in loading and transfer of protein when examining the BON1 clones, and tubulin (Santa Cruz Biotechnology) was used for the same purpose when examining the cell line panel in Fig. 1
. The expression of menin was estimated to be 1520 times higher in two of the MEN1 transfected clones (M1B and M1C) compared with the basal wild-type level and at approximately the same level as COS-7, HEK-293, and Jurkat. Vector and M1A did not express detectable levels of menin (Fig. 1
).
Cell counting
Cells (20 x 103) of BON/M1A, M1B, and M1C, BON/wt, and BON/v were seeded in triplicates onto 24-well plates (Nunc, Rochester, NY) at t = 0. Cells were washed once with PBS and then trypsinized in 0.5 ml of Trypsin/EDTA and counted in triplicates at 48, 96, and 144 h using a cell counter (Beckman Coulter, Inc., Fullerton, CA). This procedure was done twice at passages 4 and 5, respectively, for BON/wt, BON/v, and BON/M1A, M1B, and M1C.
Animals and xenografting
Female balb/c nude mice weighing 2030 g (Bomholt Gaard, Copenhagen, Denmark) were housed in cages and fed standard laboratory food and water ad libitum. They were injected sc on the hindleg with 2 x 106 cells in 0.5 ml of the appropriate growth medium. BON/wt, BON/v, and BON/M1C were injected sc in eight animals in each group. Tumors were allowed to grow for 3 wk before the mice were killed. The tumors were dissected, snap frozen in liquid nitrogen, and finally cryosectioned for further analysis.
TUNEL
Frozen sections were digested at room temperature (RT) for 10 min with proteinase K at 20 mg/ml (Roche Molecular Biochemicals, Basel, Switzerland). Digestion was stopped by washing in distilled water. Sections were treated with 3% H2O2 for 5 min at RT and washed with distilled water. TdT buffer (30 mM Trizma base, pH 7.2; 140 mM sodium cacodylate, and 1 mM cobalt chloride) containing Tdt (0.3 EU/µl; Life Technologies, Inc.) and biotin dUTP (Roche Molecular Biochemicals) were added to cover the sections and incubated in a humid atmosphere at 37 C for 60 min. Slides were transferred to TB buffer (300 mM sodium chloride and 30 mM sodium citrate) to terminate the reaction, kept for 15 min at RT, and then washed in PBS for 5 min. After blocking with 2% BSA in PBS for 10 min at RT, sections were subsequently incubated with Extra-avidin peroxidase (Sigma Chemical Co., St. Louis, MO) at 37 C for 30 min and stained with 3-amino-9-ethyl-carbazole for 30 min at 37 C, washed with PBS, and then counterstained with 3,3'-Diaminobenzidine. Cells were counted per tumor area with a 1-cm2 grid at a magnification of x400. Cells were counted at three hot-spot areas over tumor tissue. Positive apoptotic cells were calculated as a percentage [apoptotic index (AI)].
Atlas arrays
Total RNA was isolated at passages 4 and 5 from BON/v and BON/M1C using the Atlas pure total RNA labeling system (Clontech). Total RNA (22.5 µg) from BON/v, passages 4 and 5, and BON/M1C, passages 4 and 5, was enriched for mRNA according to the manual. A cDNA probe synthesis was performed on the different mRNAs using [
32P]dATP (Amersham, Uppsala, Sweden) and the CDS primer mix included in the Atlas Human Cancer Array 1.2 kit (Clontech). Preblotted filters included in the kit were then probed with the respective derived cDNA probes and developed according to the manual. This was repeated twice with the cDNAs from passages 4 and 5. The expression levels of 1176 different cDNAs were then analyzed using a phosphor imager (Molecular Dynamics, Sunnyvale, CA). We compared the expression levels between the filters using the AtlasImage 1.0 software (Clontech). Normalization of expression levels was achieved using six housekeeping genes as reference according to the manual. We used a cutoff difference of 3 times according to the manual to further investigate genes of interest. Corroboration of up-regulated and down-regulated genes was achieved using Northern blots or QPCR, using primers specific for the identified genes (Clontech). Northern blots were performed as described earlier using fragments generated from human cDNA with the gene-specific primers for JunD. Northern blots were repeated twice. Details of the Atlas procedures and a list of the 1176 cDNAs are found on Clontechs web site (www.clontech.com).
Tumor material
Five sporadic endocrine pancreatic tumors earlier characterized in terms of LOH and MEN1 point mutations (7) were chosen for this study, together with three MEN1 endocrine pancreatic tumors with LOH at 11q13 and mutated MEN1, analyzed using the methods in Hessman et al. (7) (Table 1
). Three malignant endocrine pancreatic tumors with LOH at 11q13 and concomitant MEN1 point mutation (2575, 5511, and 3219), three MEN1 tumors (1400, 2274, and 3821), and two malignant endocrine pancreatic tumors without LOH and MEN1 mutation (6114 and 5287) were initially snap frozen in liquid nitrogen in the operating theater and stored at 70 C until analysis. Total RNA was isolated in duplicates as described previously. cDNA was made according to the manual using a cDNA kit from Pharmacia Biotech (Uppsala, Sweden).
|
Relative RNA expression of
-like protein 1 (dlk1)/preadipocyte factor-1 (Pref-1), QM/Jif-1, and proliferating cell nuclear antigen (PCNA) in the BON/v and BON/M1A, M1B, and M1C cell lines were determined by real-time QPCR (34). We also compared the MEN1, dlk1/Pref-1, QM/Jif-1, and PCNA expression between malignant endocrine pancreatic tumors with LOH at 11q13 and concomitant MEN1 mutation to tumors without MEN1 gene alterations. cDNA gene-specific primers and fluorogenic probes (TaqMan probes) were designed and used to amplify and quantitate the dlk1/Pref-1 and QM/Jif-1 transcripts in cDNA derived from the BON1 transfected clones above and in tumor cDNA. Cell line cDNA was made from pools of RNA from passages 4 and 5 using a cDNA kit from Pharmacia Biotech. Tumor cDNA was made from total RNA with the same cDNA kit. Relative quantity of dlk1/Pref-1 and QM/Jif-1 was measured against standard curves generated from dilution series of target-specific PCR fragments of dlk1/Pref-1 and QM/Jif-1, respectively (35). Primers and probes were designed using PrimerExpress software (Applied Biosystems, Perkin-Elmer, Foster City, CA). Primers used for TaqMan were as follows (5'3'): dlk1 forward, ggcttctcaggcaatttctgc; dlk1 reverse, cgtcgttctggcatgggtt; QM/Jif-1 forward, cgcaccaagctgcagaaca; and QM/Jif-1 reverse, gcggccaggaaacttgaagt. TaqMan probes were as follows (5'3'): dlk1 probe, agatcgtggccaacagctgcaccc; and QM/Jif-1 probe, agcatgtgattgaggccctgcgc.
To amplify and quantitate MEN1 and PCNA, commercially available primer and probe sets were used and measured against standard curves generated from dilution series of human pooled cDNA (Applied Biosystems). For MEN1, the Hs00365720_m1 primer and probe mix was used, and for PCNA, the predeveloped primer and probe mix 4318361F was used (Applied Biosystems). All TaqMan probes used spanned exon/exon boundaries. Reactions were performed and analyzed using an Applied Biosystems PRISM 7700 Sequence Detector (Applied Biosystems). Standard cycling conditions were used (35).
At each set-up, three duplicates of each cDNA was used and repeated twice. This was done both for cell line and tumor cDNA. The gene-specific signals were normalized to that of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping gene to correct for differences in RNA quantity; the GAPDH primer and probe mix was bought from Applied Biosystems. All TaqMan assay reagents were obtained from Perkin-Elmer Applied Biosystems.
Sequencing of the MEN1 gene
Total genomic DNA from the BON1 cell line was isolated, and sequencing of exons 210 of the MEN1 gene was performed as previously described (7). Sequence reactions were performed using dye terminator chemistry (DNA sequencing kit; Applied Biosystems, Perkin-Elmer) and MEN1-specific primers (7) with thermal cycling on a GeneAmp PCR Systems 9600 (Perkin-Elmer). Sequence gels were run and analyzed using the 373A automated sequencer (Applied Biosystems, Perkin-Elmer). We did not find any mutations in the MEN1 gene exons 210 (data not shown).
Statistics
All values of mean, range, and SEM were calculated using the StatView statistical package (SAS Institute, Inc., Cary, NC). Means were compared by both the parametric Students t test and the nonparametric Mann-Whitney U test. Differences with P < 0.05 were considered significant.
Ethical approval
Permission for this study was obtained from the Uppsala Ethics Committee, Uppsala, Sweden.
| Results |
|---|
|
|
|---|
Using Western blots, we compared the human endocrine pancreatic tumor cell line BON1 to a panel of other cell lines, COS-7 (monkey kidney), HEK-293 (human embryonic kidney), Jurkat (human T-cell leukemia), and U-343 (human glioma), and this showed that both BON1 and U-343 had barely detectable protein expression of menin (Fig. 1
, left). After transfection of BON1 with a MEN1 construct, three clones (BON/M1A, BON/M1B, and BON/M1C) were identified as expressing MEN1 mRNA, with expression levels ranging from 515 times higher than that of wild type and BON1 transfected with vector without insert (BON/v) (Fig. 2
). Protein expression was investigated by Western blots, and only BON/M1B and BON/M1C showed expression of menin at levels equaling that of other cell lines (Fig. 1
, right). Thus, BON/M1A with obvious MEN1 mRNA expression refrained from producing the protein and could instead be used as a nonmenin-expressing MEN1 gene transfected clone in parallel to BON cells transfected with empty vector (BON/v). Cell counting was performed to assess growth rate comparing the MEN1 transfected clones of BON1 to that of BON/wt and BON/v. A significant growth inhibition was recorded in the menin-expressing clones BON/M1B and M1C compared with BON/wt and BON/v. For clone BON/M1B, the mean final reduction by cell number at 144 h was 68% (P < 0.01) compared with BON/wt and 45% (P < 0.01) compared with BON/v (the experiment was repeated at two different passages). Equal results were obtained with clone BON/M1C, and growth inhibition was 71% (P < 0.01) compared with BON/wt and 49% (P < 0.01) compared with BON/v (repeated at two different passages). Transfection with empty vector (BON/v) obviously affected growth but to a lesser degree because the inhibition was 42% compared with BON/wt. The clone BON/M1A, which express MEN1 mRNA but not the protein, was also inhibited to a lesser degree than the menin-expressing transfected clones (25% compared with wild type, P < 0.05; Fig. 3
). Thus, more prominent growth inhibition coincided with the menin expression verified in BON/M1B and BON/M1C.
|
|
Differentially expressed genes
We used a filter-based commercial human cancer cDNA macroarray (Clontech) to analyze expression levels of cDNA derived from the total mRNA transcripts present in BON/v and BON/M1C. The hybridization experiment was repeated twice with mRNA from passages 4 and 5 from both BON/v and BON/M1C. We found 18 genes to be differentially expressed when comparing the menin-expressing clone BON/M1C and the control (BON/v) (Table 2
). Four of these genes were chosen for further studies, and differential expression indicated by macroarray could be verified either by using Northern blots or real-time QPCR. Differential expression of JunD was verified using Northern blots of mRNA. JunD showed enhanced expression by 2 and 4 times in the menin-expressing clones BON/M1B and M1C, respectively, compared with the empty vector control and the nonmenin-expressing MEN1 gene transfected clone M1A (Fig. 4
). We performed QPCR to verify differential expression of dlk1/Pref-1 (involved in the differentiation and growth of the pancreatic endocrine cells and expressed in neuroendocrine tumors) (36, 37), PCNA (38), and QM/Jif-1 (a negative regulator of c-Jun) (39). To perform QPCR, we compared cDNA made from pools of the original total RNA from BON/v, and BON/M1A, M1B, and M1C. This showed that dlk1/Pref-1, PCNA, and QM/Jif-1 expression levels were down-regulated in the menin-expressing clones BON/M1B and M1C compared with BON/v and BON/M1A. The expression of dlk1/Pref-1 in BON/M1B and M1C was down-regulated by 9 and 10 times, respectively, compared with BON/v (P < 0.05), and it was more than 40 times lower than the expression of dlk1/Pref-1 in BON/M1A (P < 0.05). PCNA was expressed 9 and 10 times less in BON/M1B and M1C, respectively, compared with BON/v (P < 0.05), and 10 and 11 times less than in BON/M1A (P < 0.05). Further, QM/Jif-1 expression was 3 and 4 times lower in BON/M1B and M1C, respectively (P < 0.05), compared with both BON/v and BON/M1A (Fig. 5
).
|
|
|
The RNA expression of MEN1, dlk1/Pref-1, PCNA, and QM/Jif-1 was analyzed by QPCR in human malignant endocrine pancreatic tumors with homozygous inactivation of the MEN1 gene (n = 6) and compared with the RNA levels of these genes in two malignant endocrine pancreatic tumors without MEN1 gene alterations.
QPCR data from individual tumors are shown in Fig. 6![]()
and Table 3
. In summary, the mean RNA level of MEN1 was 9 times higher in the two tumors without MEN1 inactivation compared with the six tumors with homozygous MEN1 inactivation (P < 0.05). The range of MEN1 expression in the six tumors with homozygous MEN1 inactivation was 635 times lower than the mean expression in the two nonmutated tumors.
|
|
|
On analysis of the QPCR data for PCNA in the same tumor samples, we could record a similar pattern of RNA expression as we did for dlk1/Pref-1. Thus, in four of the six tumors with homozygous MEN1 gene inactivation, the RNA level for PCNA was elevated by 2.538 times compared with lesions without MEN1 gene mutations. The mean level of expression for all six tumors with MEN1 gene alterations was 8 times higher than the mean level of the tumors lacking MEN1 gene mutations (P < 0.05). In two of the six tumors, we could not show higher PCNA levels, and these were the same two tumors (2575 and 3219) that refrained from showing higher dlk1/Pref-1 than lesions without MEN1 gene mutations.
Furthermore, when comparing QM/Jif-1 RNA levels between the group of tumors with both MEN1 copies inactivated compared with the tumors without inactivation, the mean level of expression for all six tumors with MEN1 gene alterations was 6 times higher than the mean level of the tumors lacking MEN1 gene mutations (P < 0.05). In four of the six tumors, QM/Jif-1 was elevated from 216 times compared with the tumors lacking MEN1 gene mutations. Two of the six tumors (3219 and 5511, both represent sporadic cases) showed levels similar to lesions without MEN1 gene alterations.
| Discussion |
|---|
|
|
|---|
The human neuroendocrine tumor cell line BON1 showed barely detectable protein expression of menin and was, therefore, suitable for transfection with a MEN1 construct with the intention to investigate the tumor suppressor effect by menin on growth rate and identify possible genes that would become differentially expressed as a result of menin expression. One earlier study used a menin-expressing mouse cell line for overexpression of the MEN1 gene, showing growth inhibition (23). Our data, however, represent the primary in vitro observation on the suppressor characteristics of the MEN1 gene in human endocrine tissue.
Transfection of MEN1 led to an in vitro suppression of growth in two (BON/M1B and M1C) of the three transfected clones by 45 and 49%, respectively, compared with cells transfected with an empty vector (BON/v). The third clone (M1A) was only growth inhibited to the same extent as the BON/v control despite high mRNA expression of MEN1. Further analysis showed that the protein menin was not translated in this particular clone. In conjunction with earlier transfection studies of BON1 cells (28), we clearly saw that the transfection with an empty vector obviously inhibited growth of BON1 cells. This vector effect is, however, less prominent than the inhibitory effect displayed by menin protein expression. Thus, menin protein expression seems to be crucial for the recorded growth-inhibitory effects. When sequencing MEN1 in BON/wt, we did not find any mutations in exons 210. Furthermore, fluorescence in situ hybridization analysis probing with the MEN1 gene in BON/wt cells have shown a copy number of two in 90%, of one in 8%, and of three in 2% of 300 cells analyzed (Lopez-Egido, J. R., S. M. Claessen, M. Macville, J. C. M. Albrechts, B. Skogseid, and E.-J. M. Speel, submitted for publication); therefore, the low levels of menin expression in BON/wt seems to depend on other mechanisms yet unknown.
By using a filter-based human cancer array from Clontech, we were able to identify 18 differentially expressed genes in menin-expressing BON1 cells. We deliberately used BON transfected with empty vector as control, and not wild-type cells, to avoid false-positive findings and to be able to subtract the effects on gene expression exerted by the vector itself. We verified four of the differentially expressed genes (JunD, dlk1/Pref-1, PCNA, and QM/Jif-1) by Northern blot or real-time QPCR in the cell clones.
Six malignant endocrine pancreatic tumors with MEN1 mutation and LOH at 11q13, along with two malignant endocrine pancreatic tumors without MEN1 gene alterations, were used to investigate whether these four corroborated genes correlated to MEN1 losses in a clinical setting. We also compared the RNA expression of MEN1, and found that the two malignant tumors lacking MEN1 alterations had a mean of 6 times higher MEN1 expression (range, 635 times) compared with the six tumors with MEN1 mutation and LOH at 11q13. We were not able to construct working primers and probe sets for JunD on QPCR, and they were not commercially available, which is why analysis of JunD had to be excluded from the tumor material. By using QPCR, we found that dlk1/Pref-1, PCNA, and QM/Jif-1 are statistically significantly higher expressed (45, 8, and 6 times, respectively) in MEN1-mutated tumors. Four of the six tumors with homozygous MEN1 gene inactivation corroborate the differential gene expression pattern found in the in vitro experiments. On the other hand, two tumors did not, which could reflect the biological diversity frequently seen in human tumors, although they share in common a loss of MEN1 and are malignant; this also emphasizes the need of future studies of more comprehensive tumor material.
The dlk1/Pref-1 protein is a transmembrane and belongs to the epidermal growth factor-like family of homeotic proteins. Members of this family participate in cell-to-cell interactions that control differentiation decisions (41, 42). The dlk1/Pref-1 gene generates several proteins by alternative splicing of the RNA [dlk1/Pref-1, pG2, and fetal antigen 1 (FA1)] (37, 43). The extracellular part of dlk1/Pref-1 corresponds to the soluble protein FA1, which probably is formed by proteolytic cleavage of dlk1/Pref-1 (44). The expression of dlk1/Pref-1 in adults is limited to the zona glomerulosa of the adrenal gland (45), the ß-cells of the endocrine pancreas (37), the somatotrophs of the anterior pituitary gland (46), the monoaminergic neurons of the central nervous system (47), and the Leydig and hilus cells of the testes and ovaries (48). In contrast, dlk1/Pref-1 is widely expressed in the fetus (48, 49). In the pancreas, for example, it is expressed in most of the parenchymal cells at embryonic d 1316, but later (from embryonic d 19), it becomes restricted to ß-cells and islet-like clusters (50). Furthermore, levels fall markedly at birth, which coincides with the gain in glucose sensitivity of the insulin secretory apparatus (50). dlk1/Pref-1 has been shown to be involved in several differentiation processes, including the differentiation and growth of the endocrine cells of the pancreas and the adrenal gland (36, 37). Recently, it was shown that dlk1/Pref-1 also affects growth. In Balb/c 3T3 cells diminished of dlk1/Pref-1, a faster growth in response to glucocorticoids was found. Also, spontaneously fast-growing Balb/c 3T3 cells were dlk1/Pref-1 negative (51). Furthermore, it was shown that low dlk1/Pref-1 levels appear to activate ERK/MAPK signaling in adipocytes in response to IGF-I and insulin, leading to differentiation (52). In ß-cells, dlk1/Pref-1 was found to be up-regulated by GH and prolactin (PRL) (50). GH and PRL stimulate biosynthesis and proliferation by a yet unknown mechanism (53). A recent report investigated the regulation of synthesis and expression of dlk1/Pref-1 and its soluble form FA1 by GH, PRL, and glucose in neonatal rat pancreatic islets. GH and PRL stimulated both mRNA expression and the release of the soluble form. Long-term glucose exposure increased FA1 release. Culture media with FA1 present had no effect on proliferation, and transfection with dlk1/Pref-1 to rat insulinoma cells (RINm5F) decreased proliferation and insulin content (54). An important signaling mechanism that controls pancreatic cell growth and differentiation is the Notch pathway (55). Several studies collectively show that Notch signaling controls the choice between differentiated endocrine- and progenitor-cell fates in developing pancreas. Activation of Notch is essential to prevent premature pancreatic progenitor-cell differentiation, thereby allowing subsequent proliferation of the pancreatic progenitor cells (reviewed in Ref. 56). It has been proposed that the early expression of dlk1/Pref-1 may suppress the differentiation of the endocrine cells while allowing expansion of their progenitor cells, and later, when dlk1/Pref-1 expression decreases in the glandular cells, differentiation to ß-cells proceeds simultaneously with up- regulation of dlk1/Pref-1 in a subpopulation of these cells (54). This model is analogous to the cell-specification hypothesis for Notch and
interactions supported by studies of endocrine pancreatic development in Hes-1 mutant mice (57).
Our study shows a possible connection between dlk1/Pref-1 and menin expression, which indicates a role for menin in pancreatic organogenesis. If menin normally restricts the expression of dlk1/Pref-1 in pancreatic progenitor cells, a loss of menin function might lead to dysregulation of both the growth and differentiation of these progenitor cells. It is possible that the endocrine pancreatic tumors of MEN1 patients develop in pancreatic progenitor cells and not in mature ß-cells on homozygous inactivation of the MEN1 gene, allowing an increase of dlk1/Pref-1 expression. We and others have studied the subcellular localization of menin in adult and fetal human pancreas by immunogold labeling and electron microscopy (58, 59). These data imply that menin is scarce in adult ß-cells compared with fetal cells. The mature senescent ß-cells, already differentiated, do not seem to need menin or dlk1/Pref-1, whereas the fetal cells, both
and ß-cells to be, express menin abundantly. Loss of menin in a progenitor cell might result in dlk1/Pref-1 overexpression and subsequent tumor formation. This, together with the described interactions with JunD, NF
, Smad3, nm23, and hTERT (protein component of telomerase) might explain the endocrine pancreatic tumor development in MEN1.
Furthermore, multiple lipomas are a common feature of MEN1. They can be found in 34% of gene carriers compared with 6% of a control population (60). dlk1/Pref-1 is involved in adipocyte differentiation both by the secreted dlk1/Pref-1 variant and a membrane-associated dlk1/Pref-1, and the control of its expression is essential for adipogenic response to insulin. The secreted variant inhibited differentiation and enforced down-regulation of dlk1/Pref-1 lead to differentiation of adipocytes (61). Thus, at least hypothetically, our findings suggest a plausible explanation to the overrepresentation of lipomas seen in MEN1 patients. Adrenocortical lesions are also overrepresented in MEN1, especially in patients with a history of endocrine pancreatic tumors (62, 63). It has been speculated whether the endocrine pancreatic tumor might release factors affecting adrenocortical proliferation. Because the extracellular domain of dlk1/Pref-1 can be secreted (36), it could be, although highly speculative, that this secretory product is involved in the adrenocortical proliferation seen in MEN1. The finding of menin-dependant expression of dlk1/Pref-1 in neuroendocrine tumor cells might be the first hint to the basis of the organ-specific lesions in MEN1 and could also suggest a connection between MEN1 and adipocyte/adrenocortical proliferation.
QM/Jif-1 was down-regulated as a result of menin expression in our MEN1 gene transfected cells. Human QM was originally cloned by subtractive hybridization between a tumorigenic Wilms tumor cell line and a nontumorigenic microcell hybrid during the search for the Wilms tumor suppressor gene (64). QM is also known as 60S ribosomal protein L10 and is most likely involved in the late steps of the 60S ribosomal subunit assembly (65, 66). QM seems to be highly conserved throughout eukaryotic evolution, but there is little information about the function of human QM as of today, apart from the 60S ribosomal assembly. However, both the chicken homolog of QM/Jif-1 and human QM was reported to interact with the proto-oncogene c-Jun and to inhibit transactivation of AP-1-regulated promotors in vitro (39, 67). Activation of c-Jun has been reported to be involved in various types of cell death, including TNF- or Fas-induced apoptosis (68) and apoptosis induced by BRCA1 (69). One might speculate whether the down-regulation of QM expression in MEN1 transfected cells induces an apoptotic pathway through decrease of QM-mediated inhibition of c-Jun as part of the tumor suppressor effect mediated by MEN1. However, we could not find any increase in AI on xenografted MEN1 transfected cells compared with controls. It is interesting that restoration of menin expression affects the expression of two genes involved in the AP-1 complex, JunD and QM/Jif-1.
JunD expression was up-regulated in menin-expressing BON/M1B and M1C, suggesting that menin also might exert regulatory effects on the expression levels of JunD apart from affecting its transcriptional activity (11, 12).
The finding of decreased PCNA expression after MEN1 transfection might reflect the lower proliferation rate recorded in menin-expressing cells and thus a secondary effect, but it might also be that menin acts through signaling pathways affecting PCNA expression.
In conclusion, we transfected the human endocrine pancreatic cell line BON1, which has barely detectable endogenous menin expression, with a MEN1 construct restoring menin expression. This led to a suppression of growth, and it also altered the expression of four genes. The expression of JunD was up-regulated, whereas dlk1/Pref-1, PCNA, and QM/Jif-1 were down-regulated in the menin-expressing cells. We also demonstrated higher dlk1/Pref-1, PCNA, and QM/Jif-1 expression in four of six endocrine pancreatic tumors with homozygous inactivation of the MEN1 gene. Our data are the first to confirm the proposed tumor suppressor function in vitro of MEN1 in human neuroendocrine cells and provides the primary observation of genes that become differentially expressed as a result of menin expression. These genes could be of importance in mediating the tumor suppressor effect proposed by menin, and the identification of these genes might contribute to the understanding of the tissue-specific predominance of neoplasia seen in MEN1, although this presented hypothesis needs further careful evaluation and confirmatory studies.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: AI, Apoptotic index; AP-1, activator protein-1; BON/v, BON1 transfected with vector without insert; BON/wt, BON1 wild type; dlk1,
-like protein 1; FA1, fetal antigen 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LOH, loss of heterozygosity; MEN1, multiple endocrine neoplasia type 1; PCNA, proliferating cell nuclear antigen; PLCB3, phospholipase Cß3; Pref-1, preadipocyte factor-1; PRL, prolactin; QPCR, quantitative RT-PCR; RT, room temperature.
Received July 16, 2003.
Accepted February 3, 2004.
| References |
|---|
|
|
|---|
B proteins and inhibits NF-
B-mediated transactivation. Oncogene 20:49174925[CrossRef][Medline]
therapy in patients with carcinoid tumours. Eur J Cancer 34:20462052
-like protein in pancreatic islets: molecular cloning and expression pattern during development and growth of the endocrine pancreas. Endocrinology 138:39403948
-like protein/fetal antigen-1 in pancreatic ß-cells: possible physiological implications. J Endocrinol 176:257266[Abstract]
-like (dlk) variants and requires the expression of membrane-associated dlk. Differentiation 64:103114[Medline]
This article has been cited by other articles:
![]() |
J. R. LOPEZ-EGIDO, Y. WANG, M. GRONBERG, P. GRIMFJARD, S. WANG, P. STALBERG, and B. SKOGSEID Differentially Regulated Genes in MEN1-transfected BON Cells Using RT-differential Display and Oligonucleotide Microarrays Anticancer Res, June 1, 2009; 29(6): 1859 - 1866. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Matoso, Z. Zhou, R. Hayama, A. Flesken-Nikitin, and A. Yu. Nikitin Cell lineage-specific interactions between Men1 and Rb in neuroendocrine neoplasia Carcinogenesis, March 1, 2008; 29(3): 620 - 628. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |