The Journal of Clinical Endocrinology & Metabolism Vol. 89, No. 4 1963-1968
Copyright © 2004 by The Endocrine Society
A Novel Mutation in the Preprovasopressin Gene Identified in a Kindred with Autosomal Dominant Neurohypophyseal Diabetes Insipidus
Justin T. Wahlstrom,
Michael J. Fowler,
Wendell E. Nicholson and
William J. Kovacs
Division of Diabetes, Endocrinology, and Metabolism (J.T.W., M.J.F., W.E.N., W.J.K.), Vanderbilt University School of Medicine, Nashville, Tennessee 37232; and United States Department of Veterans Affairs (W.J.K.), Tennessee Valley Healthcare System, Nashville, Tennessee 37212
Address all correspondence and requests for reprints to: William J. Kovacs, M.D., Division of Diabetes, Endocrinology, and Metabolism, Vanderbilt University School of Medicine, Room 715 Preston Research Building, Nashville, Tennessee 37232. E-mail: william.kovacs{at}vanderbilt.edu.
 |
Abstract
|
|---|
Autosomal dominant neurohypophyseal diabetes insipidus (ADNDI) is a defect in free water conservation caused by mutations in the single gene that encodes both vasopressin (VP) and its binding protein, neurophysin II (NP II). Most of the human mutations in this gene have been in the portion encoding the NP molecule; the resultant abnormal gene products are believed to cause cellular toxicity as improperly folded precursor molecules accumulate in the endoplasmic reticulum. We identified a new American kindred with ADNDI and found a novel mutation in the VP molecule. A 78-yr-old man was noted to have hypotonic polyuria and plasma hyperosmolarity; the urinary concentration defect was reversed by administration of VP. His symptomatology dated to childhood, and his family history was consistent with autosomal transmission of the polyuric syndrome, with affected members in three generations, including several females. Affected individuals were found to be heterozygous for a 3-bp deletion in exon 1 of arginine VP (AVP)-NP II, predicting a deletion of phenylalanine 3 (known to be critical for receptor binding) in the VP nonapeptide. Neuro 2A cells stably transfected with the mutant AVP-NP construct showed increased rates of apoptosis as assessed by flow cytometric methods. These observations support the concept that cellular toxicity of abnormal AVP-NP gene products underlies the development of ADNDI, and the data further demonstrate that mutations affecting the AVP moiety can result in initiation of these pathological processes.
 |
Introduction
|
|---|
AUTOSOMAL DOMINANT NEUROHYPOPHYSEAL diabetes insipidus (ADNDI) is an inherited disorder of free water conservation characterized by childhood onset of polyuria and polydipsia. Affected individuals are apparently normal at birth, but characteristically develop symptoms of vasopressin (VP) deficiency during childhood. Molecular genetic analysis of kindreds with this rare disorder has revealed 40 different mutations in the single gene on chromosome 20 that encodes both arginine VP (AVP) and its intracellular binding protein, neurophysin II (AVP-NP II gene) (1). The vast majority of mutations in kindreds with ADNDI have been localized to the neurophysin-encoding portion of the gene. The neurophysin molecule plays an essential role in the intracellular trafficking by which VP prohormone molecules are sorted and directed to the regulated secretory pathway (2, 3, 4), and studies in vitro suggest that impairment of the normal intracellular trafficking of the prohormones with altered neurophysin sequences leads to accumulation of the abnormal protein in the endoplasmic reticulum (ER), with consequent cellular toxicity (5, 6, 7, 8, 9). Mutations in the signal peptide-encoding portion of the AVP-NP II gene have also been identified in two kindreds (6, 7, 10, 11); these mutations also result in accumulation of a mutant prohormone in the ER. Dominant transmission of the phenotype and the delayed onset of clinically apparent disease are consistent with a model of progressive accumulation and cytotoxicity of the mutant protein product.
Recently, the first kindred was identified with ADNDI due to a mutation affecting the VP moiety (a histidine for tyrosine substitution at amino acid position 2). The authors postulated that impaired binding of the mutant AVP molecule to NP II, which depends on the three N-terminal amino acids of AVP, results in impaired folding and/or dimerization of the precursors with resultant interference in normal processing of the prohormone through the secretory pathway (1). We describe here the identification of a new American kindred with ADNDI. This family also harbors a mutation in the AVP-encoding region of the AVP-NP II gene. A 3-bp deletion in one allele results in deletion of phenylalanine at position 3 in AVP, with preservation of the rest of the coding sequence of AVP-NP II. Our studies in vitro indicate that this abnormal gene product is cytotoxic to neuronal cells; these data are consistent with crystallographic evidence for a critical role of AVP residues 13 in proper binding, folding, and processing of the AVP-NP II precursor (12).
 |
Subjects and Methods
|
|---|
Subjects
Involvement of human subjects was approved by the Vanderbilt University Institutional Review Board, and informed consent was obtained from each individual who participated. The index case is a 78-yr-old man who was recognized to have hypotonic polyuria after a surgical procedure. He had experienced polyuria and polydipsia since childhood but had avoided medical attention by assiduously maintaining access to water at all times. He had served in the U. S. Army and was wounded in combat in Europe during World War II. At no time was he hospitalized for treatment of dehydration. His family (Fig. 1
) had recognized that some members required large volumes of water, and to accommodate these individuals (known in the family as "water-dogs"), a number of extra wells had been dug on the family farm. During hospitalization for a surgical procedure, the index case (Fig. 1
; III-5) was noted to have a urine output of 12 liters in the first 24 h. Urine osmolality measured 121 mosm/kg at a time when his plasma osmolality was 321 mosm/kg. A single dose of 1-desamino-8-D-AVP reversed the polyuria, and urinary osmolality rose to 437 mosm/kg. One of the patients brothers (Fig. 1
; III-3) had been formally diagnosed with diabetes insipidus. A twin sister (III-4) died in infancy. The patients daughter (Fig. 1
; IV-2) was also a clinically affected member of the kindred, but had not sought medical attention for her polyuric state. The patients granddaughter (Fig. 1
; V-1) is an elementary school student. She had not sought medical attention for her polyuria. She attempted to restrict her water intake to avoid the necessity of repeatedly requesting lavatory permission during school hours. On at least one occasion she had fainted upon rising from her seat for recitation, presumably because of orthostasis from dehydration. Although the patients two brothers, mother, grandmother, one aunt, and one uncle had been recognized by the family to have the "water-dog" phenotype, only one brother had sought medical attention and received treatment. Several members of the kindred gave informed consent to characterization of their AVP-NP II gene (Fig. 1
; III-5, III-3, IV-2, V-1).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1. Partial pedigree of a family with ADNDI. The index case (III-5) is marked by an arrow. Four individuals (III-3, III-5, IV-2, and V-1) were seen by us and diagnosed with central diabetes insipidus. Other affected members of the kindred (solid symbols) were those identified by family members as having the "water-dog" phenotype.
|
|
DNA analysis
Genomic DNA was isolated from whole blood samples collected from individuals and controls using a commercially available kit (QIAMP DNA Blood Minikit; Qiagen, Chatsworth, CA). The AVP-NP II gene was amplified by PCR in an automated thermal cycler using a commercially available kit (GC-Rich PCR Kit; Roche Applied Science, Indianapolis, IN). Primer pairs used were those previously designed and used by Ito et al. (13) and Ueta et al. (14). Genomic DNA (500 ng) was amplified using 0.2 µM primers specific for exon 1 (5' primer, TGCCTGAATCACTGCTGACCGCTGGGGACC; 3' primer, GCTATGGCTGCCC TGAGATGGCCCACAGTG) or for exons 2/3 and the intervening intron (5' primer, TCGCTGC GTTCCCCTCCAACCCCTCGACTC; 3' primer, CCTCTCTCCCCTTCCCTCTTCCCGCCAGAG). Total reaction volume was 50 µl; 45 cycles of melting (95 C for 30 sec), annealing (65 C for 30 sec), and extension (72 C for 40 sec) were carried out, with a final 7 min at 72 C for extension. PCR products were run on 1% agarose gels at 100 V for 30 min, then the bands were excised, extracted from agarose using a commercial kit (QIAEX II Gel Extraction Kit; Qiagen), and sequenced in the Vanderbilt University Medical Center DNA Sequencing Core using an automated sequencer (ABI 377; Applied Biosystems, Foster City, CA).
Cloning of PCR products
PCR products were ligated into pCRScript vector (Stratagene, La Jolla, CA) and the ligation products used to transform competent DH5
Escherichia coli cells. Single colonies were selected, and minipreps of these clones were prepared and sequenced as above.
Expression of normal and mutant AVP-NP II genes in Neuro 2A cells
A full-length wild-type human AVP cDNA in the expression vector pRc/RSV (Invitrogen, Carlsbad, CA) was the generous gift of Dr. Larry Jameson (Northwestern University, Chicago, IL). A mutant construct corresponding to the trinucleotide deletion found in the affected kindred was created using the wild-type expression plasmid and a commercial site-directed mutagenesis kit (QuikChange, Stratagene). Identity of the mutant construct was confirmed by DNA sequencing.
Neuro 2A cells, a murine neurobloastoma line (American Type Culture Collection, Rockville, MD), were grown in MEM with 10% fetal calf serum at 37 C in an atmosphere of 5% CO2. Cells were transfected with either wild-type AVP-NP II construct or with the mutant construct harboring the trinucleotide deletion using a commercial reagent kit (Transfectam; Promega, Madison, WI). Lines stably expressing the AVP-NP II cDNAs were isolated using G418 (Geneticin; Invitrogen) at a concentration of 300 µg/ml. Clonal lines were isolated by limiting dilution and continuously cultured in medium with added G418.
AVP RIA
Neuro 2A cells stably expressing wild-type AVP-NP II construct were changed from complete culture medium to MEM alone for 48 h before harvest of supernatants for assay of AVP by RIA. Supernatants (1 ml) were desalted on PD-10 columns (Amersham Biosciences, Piscataway, NJ). Aliquots were taken for RIA using an anti-AVP antibody generously provided by Dr. Yutaka Oki (Hamamatsu University School of Medicine, Hamamatsu, Japan). This antibody was raised against the complete AVP nonapeptide coupled to bovine thyroglobulin through the amino terminus; it has no cross-reactivity with lysine VP, arginine vasotocin, or oxytocin. 125I-AVP tracer was from Amersham Biosciences, and AVP reference standard was from Sigma (St. Louis, MO). Samples were assayed in triplicate. Sensitivity of the assay was 6 pg/ml.
Neurophysin Western blot
Supernatants from PD-10 columns were also assayed for secreted NP II in the medium. Samples were denatured in sample buffer and run on denaturing 420% polyacrylamide gels (Ready Gel; Bio-Rad, Hercules, CA). Gels were electrophoretically transferred to polyvinylidine difluoride membranes using a semidry blotting apparatus (Trans-blot SD; Bio-Rad). Membranes were blocked in PBS with 5% nonfat dry milk and 0.1% Tween 20 and then incubated with primary antibody (antineurophysin II; Genex Biosciences, Inc., Haywood, CA) at 1.0 µg/ml (in PBS with 1% nonfat dry milk and 0.02% Tween 20) for 1 h at room temperature. Membranes were washed and then incubated in horseradish peroxidase-linked goat antirabbit antibody (Amersham Biosciences) at a dilution of 1:5000. After a series of final washes, the blots were developed using a chemiluminescent reagent kit (ECL-Plus; Amersham).
Flow cytometric assessment of apoptosis
Neuro 2A cells expressing wild-type and mutant AVP-NP cDNA constructs were harvested by trypsinization and washed in PBS with 2% fetal calf serum and 0.02% sodium azide. Cells were pelleted by brief centrifugation and resuspended by dropwise addition of 70% ethanol to a volume of 2 ml. Cells were stained with propidium iodide and analyzed for DNA content by flow cytometry.
 |
Results
|
|---|
DNA samples from three affected family members and one asymptomatic family member as well as normal controls were analyzed by PCR amplification. Amplification with specific primers for exon 1 yielded a single DNA fragment of approximately the expected 344-bp size in each of these individuals (data not shown). Primers for the exon 2intron Bexon 3 fragment yielded a fragment of approximately 744 bp in all individuals (data not shown). Direct automated sequencing of the PCR products revealed abnormal DNA sequence in exon 1 of all affected family members. Sequence data for these individuals was normal up to the point of the codon designating the third amino acid (phenylalanine) in the AVP molecule. After that, the directly sequenced PCR products from affected individuals became ambiguous with two apparent bases at each subsequent position (Fig. 2A
). The ambiguously read sequence appeared to reflect a trinucleotide (CTT) deletion in one allele of AVP-NP II. This was confirmed by DNA sequencing of the cloned PCR products from DNA isolated from affected individuals. Half of the exon 1 fragment clones had normal sequence, and half of the clones had inserts with a trinucleotide deletion (CTT) (Fig. 2B
). PCR products from the exon 2 and 3 primers had normal sequence in all individuals in the kindred (data not shown).

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 2. A, Direct sequencing of DNA fragments amplified from exon 1 of the AVP-NP II gene of a normal individual (top tracing) and from the index case with ADNDI (lower tracing). Sequence is unambiguously normal in the affected individuals DNA up to the position marked 230 in the sequence shown. Thereafter, the sequence becomes unreadable because of the presence of two bases at each position in the sequence. B, DNA sequence of cloned fragments of exon 1 of the AVP-NP II of the index case. Half of the clones had an unambiguously normal sequence (top tracing), and half of the clones had a CTT or TTC deletion in the coding sequence of exon 1 (lower tracing).
|
|
The trinucleotide deletion in exon 1 of one AVP-NP II allele of the affected individuals includes either parts of two codons (CTT from the tyrosine and phenylalanine codons) or deletion of the entire phenylalanine codon (TTC). These different possibilities are not experimentally distinguishable; with either, the resultant nucleotide sequence preserves the translation of the peptide in frame, with the deletion of phenylalanine 3 of the AVP moiety (Fig. 3
). Thus, the prohormone product encoded by the mutant AVP-NP II gene in the affected individuals would be predicted to have normal signal peptide, neurophysin, and glycopeptide sequence, but with a short (8 amino acid) AVP moiety lacking phenylalanine at position 3.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 3. Predicted sequence of the mutant AVP peptide from the kindred with ADNDI. The amino acids shown are the normal AVP nonapeptide sequence. The circled Phe residue would be absent from the mutant peptide due to either the CTT (upper line) or TTC (lower line) deletion.
|
|
We examined the consequences of expression of the mutant AVP form in cells stably transfected with a cDNA created by site-directed mutagenesis to encode the abnormal gene product. Neuro 2A cells expressing a wild-type AVP-NP II cDNA secreted immunoassayable AVP into the medium, whereas untransfected cells or cells expressing the mutant construct had no immunoassayable AVP (Fig. 4A
). These results do not distinguish between a failure of cellular secretion and a nonimmunoreactive AVP species (which seems most likely with the Phe 3 deletion from the AVP nonapeptide). Similar results were obtained using two different anti-AVP antibodies, both raised against N-terminal conjugates of AVP (data not shown). However, immunoblots of neurophysin released from these cells into the medium suggest that similar levels of expression of the normal and mutant genes were achieved in the transfected cells (Fig. 4B
). With this evidence for comparable levels of expression of normal and mutant gene products in the stably transfected cells, we examined whether expression of the mutant AVP was associated with altered rates of cellular proliferation or apoptosis. No differences in cellular proliferation rates were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay (data not shown), but flow cytometric analysis of propidium iodide-stained cells revealed an increased rate of apoptosis in Neuro 2A cells expressing the mutant AVP (5.47 ± 0.87% vs. 0.68 ± 0.21% in control cells; P = 0.006) (Fig. 5
). These data are consistent with a cytotoxic effect of the mutant protein product.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4. Immunodetection of AVP-NP II gene products in cells stably transfected with cDNAs encoding normal and mutant AVP-NP II constructs. A, RIA of AVP secreted into the medium by Neuro 2A cells stably transfected with normal AVP-NP II cDNA (WT) or with mutant AVP-NP II cDNA corresponding to the mutation observed in the kindred described (MUT). B, Immunoblot of neurophysin secreted into the medium from the same cells. Western blots from two separate experiments are shown.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5. Flow cytometric analysis of DNA content of Neuro 2A cells stably transfected with wild-type AVP-NP II cDNA (A) and with mutant AVP-NP II cDNA corresponding to the mutation identified in the kindred described (B). Populations of cells in G0/G1, S, and G2/M phase of the cell cycle are marked in A. A hypodiploid population of cells, corresponding to apoptotic cells is marked in B. A summary of data three such independent flow cytometric experiments is shown in C. The percentage of hypodiploid apoptotic cells is shown for Neuro 2A cells transfected with normal (WT) and mutant (MUT) AVP-NP II cDNA. Data shown are mean ± SEM for three independent experiments.
|
|
 |
Discussion
|
|---|
We describe here a kindred with autosomal dominant transmission of neurohypophyseal diabetes insipidus. Members of three generations have been examined, and four affected individuals have been successfully treated with ddAVP. Each was apparently normal at birth, but had onset of a polyuric state in childhood, and they compensated by taking in large quantities of water. The discovery of this kindred by ascertainment of the 78-yr-old index case emphasized to us that, even with quite severe diabetes insipidus, a resourceful individual who maintains access to free water can remain undiagnosed. The case further illustrates the value of careful inquiry into family history of disease and the necessity of investigation of polyuric states by laboratory testing.
Each of the affected individuals in this kindred bears a single mutant AVP-NP II allele harboring a trinucleotide deletion that results in an AVP peptide lacking phenylalanine in position 3. The deletion is either the TTC of a single codon (for phenylalanine 3) or a CTT deletion spanning two codons (Tyr 2 and Phe 3) in the AVP moiety, but the predicted mRNA maintains the rest of the coding sequence in frame, with deletion of phenylalanine 3 from the predicted protein product. This is only the second kindred described with ADNDI due to a mutation affecting the AVP sequence (1). One other kindred has been described with neurohypophyseal diabetes insipidus and a mutation in the AVP molecule (replacing proline 7 with leucine), but transmission of that particular defect was in an autosomal recessive pattern (15).
Previous observations in other families with ADNDI suggest that retention of mutant protein products in the ER-Golgi system results in toxicity to the neuronal cells expressing them (5, 6, 7, 8, 9, 10, 11). Such cellular toxicity is believed to result in the progressive loss of hypothalamic magnocellular neurons, with concomitant progressive loss of AVP secretory capacity. The clinical correlate of this neuronal loss is believed to be the loss of the posterior pituitary bright spot on T1-weighted magnetic resonance imaging in individuals with ADNDI (16, 17, 18, 19). Loss of this intensive posterior pituitary signal appears to be age related in such patients (16), consistent with progressive neuronal loss during chidhood. We do not have imaging data on the members of the kindred reported here, but each of the affected individuals that we have examined (spanning three generations and ages 1578 yr) had clinically overt VP deficiency.
The mechanism by which the Phe 3 deletion produces clinical diabetes insipidus in the heterozygous state is suggested by clinical observation and experimental data. We considered whether the Phe 3-deleted AVP might act as an antagonist at the renal V2 receptor, but the kindred described here, like most families with ADNDI, exhibited delayed onset of the clinical evidence of diabetes insipidus, arguing against antagonist properties of the mutant product, which would be expected to be evident from early neonatal life. Our studies using transfected cells in vitro suggest that the Phe 3-deleted AVP-NP gene product is cytotoxic. The observations differ somewhat from those described by others (7) in that we found evidence for DNA fragmentation, more characteristic of an apoptotic process than of cellular necrosis.
Our observations on this newly recognized American kindred support the recent findings reported by Rittig et al. (1). These authors have described the first kindred with ADNDI caused by a mutation in the VP moiety itself (histidine substitution for tyrosine at position 2 in the nonapeptide). They have proposed that this amino acid substitution affects AVP-NP II binding. The resultant abnormal folding and dimerization of the prohormone leads to abnormal trafficking through the secretory pathway and ultimately to cellular toxicity.
Our findings of this kindred with deletion of Phe 3 in the VP molecule support a critical role for this amino acid residue in the proper binding of AVP to NP II, and further suggest that disruption of that interaction leads to cellular toxicity as improperly folded protein products accumulate.
 |
Acknowledgments
|
|---|
We are indebted to Dr. Yutaka Oki (Hamamatsu University, Hamamatsu, Japan) for provision of the anti-AVP antiserum, to Dr. Larry Jameson (Northwestern University, Chicago, IL) for the gift of the AVP-NP expression construct, and to Dr. David N. Orth for many helpful discussions of the work.
 |
Footnotes
|
|---|
This work was supported by a Merit Review Grant (to W.J.K.) from the United States Department of Veterans Affairs. Our studies used the resources of core laboratories of the Vanderbilt University Diabetes Research and Training Center (NIH Grant P60 DK020593). J.T.W. received support from the Vanderbilt University School of Medicines Medical Scholars Program.
Abbreviations: ADNDI, Autosomal dominant neurohypophyseal diabetes insipidus; AVP, arginine VP; ER, endoplasmic reticulum; NP II, neurophysin II; VP, vasopressin.
Received September 4, 2003.
Accepted December 22, 2003.
 |
References
|
|---|
- Rittig S, Siggaard C, Ozata M, Yetkin I, Gregersen N, Pedersen EB, Robertson GL 2002 Autosomal dominant neurohypophyseal diabetes insipidus due to substitution of histidine for tyrosine(2) in the vasopressin moiety of the hormone precursor. J Clin Endocrinol Metab 87:33513355[Abstract/Free Full Text]
- De Bree FM, Burbach JP 1998 Structure-function relationships of the vasopressin prohormone domains. Cell Mol Neurobiol 18:173191[CrossRef][Medline]
- De Bree FM 2000 Trafficking of the vasopressin and oxytocin prohormone through the regulated secretory pathway. J Neuroendocrinol 12:589594[CrossRef][Medline]
- De Bree FM, Knight D, Howell L, Murphy D 2000 Sorting of the vasopressin prohormone into the regulated secretory pathway. FEBS Lett 475:175180[CrossRef][Medline]
- Nijenhuis M, van den Akker EL, Zalm R, Franken AA, Abbes AP, Engel H, de Wied D, Burbach JP 2001 Familial neurohypophysial diabetes insipidus in a large Dutch kindred: effect of the onset of diabetes on growth in children and cell biological defects of the mutant vasopressin prohormone. J Clin Endocrinol Metab 86:34103420[Abstract/Free Full Text]
- Ito M, Yu RN, Jameson JL 1999 Mutant vasopressin precursors that cause autosomal dominant neurohypophyseal diabetes insipidus retain dimerization and impair the secretion of wild-type proteins. J Biol Chem 274:90299037[Abstract/Free Full Text]
- Ito M, Jameson JL, Ito M 1997 Molecular basis of autosomal dominant neurohypophyseal diabetes insipidus. Cellular toxicity caused by the accumulation of mutant vasopressin precursors within the endoplasmic reticulum. J Clin Invest 99:18971905[Medline]
- Olias G, Richter D, Schmale H 1996 Heterologous expression of human vasopressin-neurophysin precursors in a pituitary cell line: defective transport of a mutant protein from patients with familial diabetes insipidus. DNA Cell Biol 15:929935[Medline]
- Nijenhuis M, Zalm R, Burbach JP 2000 A diabetes insipidus vasopressin prohormone altered outside the central core of neurophysin accumulates in the endoplasmic reticulum. Mol Cell Endocrinol 167:5567[CrossRef][Medline]
- Siggaard C, Rittig S, Corydon TJ, Andreasen PH, Jensen TG, Andresen BS, Robertson GL, Gregersen N, Bolund L, Pedersen EB 1999 Clinical and molecular evidence of abnormal processing and trafficking of the vasopressin preprohormone in a large kindred with familial neurohypophyseal diabetes insipidus due to a signal peptide mutation. J Clin Endocrinol Metab 84:29332941[Abstract/Free Full Text]
- Beuret N, Rutishauser J, Bider MD, Spiess M 1999 Mechanism of endoplasmic reticulum retention of mutant vasopressin precursor caused by a signal peptide truncation associated with diabetes insipidus. J Biol Chem 274:1896518972[Abstract/Free Full Text]
- Chen LQ, Rose JP, Breslow E, Yang D, Chang WR, Furey Jr WF, Sax M, Wang BC 1991 Crystal structure of a bovine neurophysin II dipeptide complex at 2.8 A determined from the single-wavelength anomalous scattering signal of an incorporated iodine atom. Proc Natl Acad Sci USA 88:42404244[Abstract/Free Full Text]
- Ito M, Mori Y, Oiso Y, Saito H 1991 A single base substitution in the coding region for neurophysin II associated with familial central diabetes insipidus. J Clin Invest 87:725728
- Ueta Y, Taniguchi S, Yoshida A, Murakami I, Mitani Y, Hisatome I, Manabe I, Sato R, Tsuboi M, Ohtahara A, Nanba E, Shigemasa C 1996 A new type of familial central diabetes insipidus caused by a single base substitution in the neurophysin II coding region of the vasopressin gene. J Clin Endocrinol Metab 81:17871790[Abstract]
- Willcutts MD, Felner E, White PC 1999 Autosomal recessive familial neurohypophyseal diabetes insipidus with continued secretion of mutant weakly active vasopressin. Hum Mol Genet 8:13031307[Abstract/Free Full Text]
- Mahoney CP, Weinberger E, Bryant C, Ito M, Jameson JL, Ito M 2002 Effects of aging on vasopressin production in a kindred with autosomal dominant neurohypophyseal diabetes insipidus due to the
E47 neurophysin mutation. J Clin Endocrinol Metab 87:870876[Abstract/Free Full Text]
- Gagliardi PC, Bernasconi S, Repaske DR 1997 Autosomal dominant neurohypophyseal diabetes insipidus associated with a missense mutation encoding Gly23
Val in neurophysin II. J Clin Endocrinol Metab 82:36433646[Abstract/Free Full Text]
- Repaske DR, Medlej R, Gultekin EK, Krishnamani MR, Halaby G, Findling JW, Phillips III JA 1997 Heterogeneity in clinical manifestation of autosomal dominant neurohypophyseal diabetes insipidus caused by a mutation encoding Ala-1
Val in the signal peptide of the arginine vasopressin/neurophysin II/copeptin precursor. J Clin Endocrinol Metab 82:5156[Abstract/Free Full Text]
- Rutishauser J, Boni-Schnetzler M, Boni J, Wichmann W, Huisman T, Vallotton MB, Froesch ER 1996 A novel point mutation in the translation initiation codon of the pre-pro-vasopressin-neurophysin II gene: cosegregation with morphological abnormalities and clinical symptoms in autosomal dominant neurohypophyseal diabetes insipidus. J Clin Endocrinol Metab 81:192198[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
Y.-W. Lee, K. W. Lee, J. W. Ryu, J. O. Mok, C.-S. Ki, H. K. Park, Y. J. Kim, S. J. Kim, D. W. Byun, K. I. Suh, et al.
Mutation of Glu78 of the AVP-NPII Gene Impairs Neurophysin as a Carrier Protein for Arginine Vasopressin in a Family with Neurohypophyseal Diabetes Insipidus
Ann. Clin. Lab. Sci.,
January 1, 2008;
38(1):
12 - 14.
[Abstract]
[Full Text]
[PDF]
|
 |
|