| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Obstetrics and Gynecology (C.J.L., G.K., F.S.), Yale University School of Medicine, New Haven, Connecticut 06510; Department of Obstetrics and Gynecology (P.K., S.K., P.D.), New York University School of Medicine, New York, New York 10016; and Department of Obstetrics and Gynecology (H.C.), Centre for Reproductive Biology, University of Edinburgh, United Kingdom EH16 4SB
Address all correspondence and requests for reprints to: Charles J. Lockwood, M.D., The Anita OKeefe Young Professor and Chair, Department of Obstetrics and Gynecology, Yale University School of Medicine, 333 Cedar Street, Room 335 Farnam Memorial Building, P.O. Box 208063, New Haven, Connecticut 06510.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In vitro decidualization of human endometrial stromal cells (HESCs) by estradiol (E2) plus MPA is associated with prolonged up-regulation of tissue factor (TF) mRNA and protein (16). Moreover, we showed that decidualized HESCs in sections of luteal phase and gestational endometrium display elevated levels of TF mRNA and protein commensurate with the requirement for hemostasis during blastocyst invasion (17, 18). Consistent with the controlled hemorrhage of menstruation, progesterone withdrawal and mifepristone treatment reduce HESC-expressed TF (19). Paradoxically, TF levels are enhanced in decidualized HESCs at bleeding sites after Norplant treatment (3). The current study extends our previous immunohistochemical evaluation of endometrial TF expression after Norplant and Depo-Provera administration to include the endometrium after insertion of the Mirena intrauterine system. This contraceptive formulation produces markedly elevated local progestin levels and a highly decidualized endometrium (10, 11).
TF is the transmembrane receptor for circulating factor VII and its activated form factor VIIa. Consequently, TF-bound VIIa converts factor X to Xa, which then complexes with its cofactor Va to convert prothrombin to thrombin. Thrombin initiates hemostasis by cleaving fibrinogen to fibrin (20). However, thrombin can also bind to the type-1 protease-activated receptor (PAR-1) to induce a variety of cell responses (21) including augmentation of IL-8 expression in fibroblasts and epithelial and endothelial cells (22, 23, 24, 25, 26). To test the hypothesis that AUB-associated thrombin generation could enhance IL-8 expression in decidualized HESCs, the effects of thrombin were evaluated on IL-8 expression in control and progestin-decidualized HESCs. Because LTPOC administration could elicit hypoxia stemming from impaired endometrial perfusion and vasomotion (27), the separate and interactive effects of hypoxia and thrombin were also assessed on IL-8 expression by control and by in vitro progestin-exposed HESCs.
| Materials and Methods |
|---|
|
|
|---|
After receiving written informed consent and approval from the Institutional Research Board of New York University Medical Center and Bellevue Hospital, specimens of predecidualized endometrium from the follicular and luteal phases were obtained from hysterectomies for benign conditions (e.g. myomas without abnormal uterine bleeding) from women of reproductive age and transported to a sterile laminar flow hood. A small portion of each specimen was formalin fixed and histologically dated by the criteria of Noyes et al. (28). The remainder was used to isolate HESCs.
Decidua were collected from patients undergoing elective terminations in the first trimester between 6 and 12 wk of gestation at Bellevue Hospital under Institutional Research Board approval. Endometrial tissue was obtained before and after intrauterine insertion of Mirena for contraception and/or heavy menstruation. The subjects had regular menstrual cycles and had not used hormonal or intrauterine contraception in the 6 months before insertion of Mirena. An endometrial biopsy was collected in an outpatient setting by Pipelle suction curette (Laboratoire CCD, Paris, France) in either the follicular or luteal phase before Mirena insertion. With each of four patients acting as her own control, additional endometrial samples were collected 1, 3, 6, and 12 months after insertion of Mirena. Ethical approval was obtained, and all women gave written informed consent for collection of endometrial biopsies.
Isolation of HESCs
Endometrial fragments were digested with 0.25% type I collagenase (Worthington, Lakewood NJ) for 30 min in a shaking water bath at 37 C. The digestate was filtered through a 38-µm stainless steel sieve. The sieve retained the glands, whereas the stromal cells passed through the sieve along with some epithelial cells and blood elements. Purification of the stromal cell-enriched fraction to virtual homogeneity, as determined by immunostaining for cytokeratin and vimentin used a Percoll gradient together with incubation for 30 min at 37 C in a standard humidified 95% air: 5% CO2, incubator. During this period, HESCs, but not the other cell types, attach to polystyrene tissue culture plastic (17, 29).
Culture of HESCs
HESCs were grown to confluence in BMS, which consists of basal medium, a phenol red-free 1:1 vol/vol mix of DMEM (Life Technologies, Inc., Grand Island, NY) and Hams F-12 (Flow Laboratories, Rockville, MD), with 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml fungizone that was supplemented with 10% charcoal-stripped calf serum. Confluent HESCs were incubated in parallel in BMS + 0.1% ethanol (vehicle control) or 10-8 mol/liter E2, or 10-7 mol/liter MPA (Sigma, St. Louis, MO), or E2 plus MPA with one change of medium. After 7 d in a standard incubator, the cultures were washed twice with Hanks balanced salt solution to remove residual serum. Experimental treatments were carried out in a defined medium (DM) consisting of basal medium plus ITS+ (Collaborative Research, Waltham, MA), 5 µM FeSO4, 50 µM ZnSO4, 1 nM CuSO4, 20 nM Na2SeO3, trace elements (Life Technologies, Inc.), 50 µg/ml ascorbic acid (Sigma), and 50 ng/ml epidermal growth factor (Becton Dickinson, Bedford, MA) containing corresponding vehicle control or steroid(s) added with or without thrombin (American Diagnostica, Greenwich, CT) or the thrombin receptor agonist peptide TRAP14 (Bachem Biosciences Inc., King of Prussia, PA). In some experiments, thrombin and hirudin (Sigma) were mixed and preincubated for 30 min at room temperature before incubation with HESCs. After the experimental test period in DM, the collected medium was centrifuged and the cells were washed with Hanks balanced salt solution and lysed with 0.4% sodium dodecyl sulfate. Medium supernatants and cell lysates were stored at -70 C. In parallel incubations, total RNA was extracted from cultured HESCs with Tri-reagent (Sigma).
Hypoxia
Confluent HESCs in DM were placed in a humidified sealed chamber containing a portable gas oxygen analyzer. The chambers were purged with 5% CO2: 95% N2 for 15 min after the oxygen analyzers read 01% O2 (1214 mm Hg). The sealed chambers were placed in a standard 37 C incubator for 48 h. Only those cultures whose chambers read 2% O2 or less after 48 h were used for this study. Parallel normoxic incubations were maintained in a standard incubator (pO2 120130 mm Hg).
Biochemical assays
Immunoreactive IL-8 was measured in the conditioned media by ELISA (R&D Systems, Minneapolis, MN). The ELISA has a sensitivity of 3.5 pg/ml, an intraassay and interassay coefficient of variation of 4.6 and 6.7%, respectively. The DNA and protein content of the cell lysates were determined by the method of Hinegardner (30) and the Bio-Rad Laboratories assay (Hercules, CA), respectively.
Western blot analysis
Supernatants of conditioned medium were concentrated 5-fold using Microcon centrifugal filter devices (Millipore Corp., Bedford, MA) and then subjected to electrophoresis on a 1020% sodium dodecyl sulfate polyacrylamide linear gradient gel (Bio-Rad Laboratories). The gel was electroblotted onto a 0.2-µm nitrocellulose membrane (Bio-Rad Laboratories). After transfer, the membrane was blocked overnight in PBS with 1% casein and then incubated for 2 h with a 1:333 dilution of a mouse antihuman IL-8 monoclonal antibody (R&D Systems). Membranes were rinsed in PBS and 0.2% Tween 20 before and after incubation with horseradish peroxidase-conjugated antimouse IgG (ICN Biomedicals, Aurora, OH). Chemiluminescence was detected with enhanced chemiluminescence reagents (Perkin-Elmer Life Sciences, Boston, MA) and audioradiography film (Amersham Pharmacia, Buckinghamshire, UK) according to the manufacturers instructions.
Northern blot analysis
The cDNA probe for IL-8 was generated by RT-PCR of total RNA isolated from HESCs. Primers were selected from the published mRNA sequence as follows: forward, 5'-gacaagagccaggaagaaac; reverse, 5'-ctacaacagacccacacaatac. Total RNA (1 µg) was reversed transcribed using Moloney leukemia virus reverse transcriptase (Perkin-Elmer) and oligo d(T)16 as primer. IL-8 cDNA was amplified using AmpliTaq DNA polymerase and the specific primers under the following conditions: 95 C, 1 min 45 sec (1x); 95 C, 15 sec; 54 C 30 sec; 72 C, 30 sec (35x); and 72 C, 7 min (1x). The 459-bp product was extracted from an agarose gel, purified by spin-column (Qiagen Inc., Valencia, CA), and labeled with 32P-dCTP (Megaprime DNA labeling system, Amersham Pharmacia Biotech UK Ltd., Buckinghamshire, UK).
Fifteen microgram of total RNA from each of the experimental cultures were electrophoresed on a 1.2% agarose gel containing 0.66 mol/liter formaldehyde, transferred to GeneScreen nylon membrane (NEN Life Science Products, Boston, MA), and hybridized with 32P-labeled IL-8 cDNA. The washed membranes were exposed to Kodak XAR film (Eastman Kodak, Rochester, NY). RNA loading was standardized by reprobing the stripped membranes with a 32P-labeled probe for glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
Real-time quantitative RT-PCR
Extracted RNA from experimental cell incubations were subjected to semiquantitative RT-PCR using a kit from Invitrogen (Carlsbad, CA) and carrying out 35 cycles with the Eppendorf Mastercycler (Eppendorf, Westbury, NY). To perform quantitative real-time RT-PCR, RT was initially carried out with AMV reverse transcriptase (Invitrogen). A quantitative standard curve was created between 500 pg and 250 ng of cDNA with a Light Cycler (Roche, Indianapolis, IN) by monitoring increasing fluorescence of PCR products during amplification. Upon establishing the standard curve, quantitation of the unknowns was determined with the Roche Light Cycler and adjusted to the quantitative expression of ß-actin from the corresponding unknowns. Melting curve analysis determined the specificity of the amplified products and the absence of primer-dimer formation. All products obtained yielded correct melting temperatures. The following primers were synthesized and gel purified at the Yale DNA Synthesis Laboratory, Critical Technologies:
ß-actin: sense (5' to 3'), CGTACCACTGGCATCGTGAT; antisense (5' to 3'), GTGTTGGCGTACAGGTCTTTG; 452-bp product.
IL-8: sense (5' to 3'), GACAAGAGCCAGGAAGAAAC; antisense sense (5' to 3'), CTACAACAGACCCACACAATAC; 459-bp product.
Immunohistochemistry (IHC)
Paraformaldehyde-fixed, paraffin-embedded sections. Specimens of endometrium from control and Mirena-treated patients as well as first-trimester decidua were fixed in 4% paraformaldehyde and embedded in paraffin. Peroxidase staining was conducted with the ABC elite kit from Vector Laboratories (Burlingame, CA) as previously described (17). The mouse monoclonal antibody to TF was a kind gift from Dr. Yale Nemerson (Mount Sinai School of Medicine, New York, NY). Controls consisted of using preimmune serum in place of the TF antiserum.
Frozen sections. Frozen serial sections from endometrial biopsies obtained after insertion of the Mirena intrauterine system or from matched controls were immunostained as described by Critchley et al. (31). Briefly, sections were microwave heated, fixed in 4% neutral buffered formaldehyde, and then washed in PBS with 1.5% polyvinylpyrrolidone before blocking for endogenous peroxidase. After a further wash with PBS with 1.5% polyvinylpyrrolidone, sections were incubated in avidin then biotin (Vector, Vector Laboratories, Peterborough, UK), washed again, and then incubated in corresponding control serum for either IL-8 or TF. Serial sections were incubated in either a 1:10001:2000 dilution of rabbit anti-IL-8 antibody (31) or a 1:5001:1000 dilution of mouse anti-TF antibody for 60 min at 37 C. Nonimmune rabbit (IL-8) and mouse (TF) IgG were used as negative controls. Binding of the primary antibody was detected with a biotinylated goat antirabbit IL-8 or horse antimouse TF antibody (Vector) followed by the ABC elite kit (Vector). Staining was visualized by diaminobenzidine. Sections were counterstained with hematoxylin.
Statistical analysis
Statistical analysis was performed by the Mann-Whitney rank sum test with P < 0.05 considered significant.
| Results |
|---|
|
|
|---|
As we reported previously (17, 18), decidualized HESCs of first-trimester decidua display prominent IHC staining for TF (Fig. 1 A
). Consistent with the continuous release of progestin directly to the uterus, the biopsy obtained 3 months after insertion of the Mirena intrauterine system contains stromal cells that display features similar to those of the first trimester decidua. Thus, these are highly decidualized, cuboidal cells with edematous cytoplasm and prominent staining for TF at the cell membranes (Fig. 1B
). By comparison note the lack of decidualization and the relative absence of TF immunostaining in the control follicular phase endometrial specimen obtained from the same woman before Mirena contraception (Fig. 1C
).
|
To obtain in vivo support of our hypothesis that AUB-associated thrombin generation enhances IL-8 expression in decidualized HESCs, IHC staining was carried out for TF and IL-8 in frozen serial endometrial sections 3 months after initiating Mirena intrauterine contraception. The results of Fig. 2A
are in accordance with those previously described for Fig. 1B
, i.e. prominent IHC staining for TF in decidualized HESCs. As in our previous studies (15, 31), Fig. 2B
displays prominent IHC staining for IL-8 in perivascular cells. However, Fig. 2B
also demonstrates IL-8 IHC staining in a patch of decidualized HESCs distal from blood vessels. This observation is consistent with the underlying hypothesis of this study whereby vascular damage and bleeding associated with Mirena contraception would generate thrombin from TF expressed by highly decidualized HESCs. Thrombin then acts as an autocrine enhancer of IL-8 in these cells.
|
Figure 3
demonstrates that E2 plus MPA reduced secreted levels of IL-8 by HESC monolayers, compared with parallel cultures incubated with control medium. Additional experiments revealed that this inhibition was greater than that elicited by MPA alone, whereas E2 was not inhibitory when added alone (results not shown). This differential IL-8 response to ovarian steroids was previously demonstrated for several decidualization markers in cultured HESCs [reviewed in Lockwood and Schatz (4)] and is consistent with progestin inhibition of IL-8 secretion reported in human endometrial explants (32). Figure 3
also shows that in E2 plus MPA-decidualized cultures, thrombin elicited a statistically significant, dose-dependent increase in IL-8 output over the 48-h test period. The lowest concentration of thrombin (0.1 U/ml) completely reversed the 66% inhibition in IL-8 output elicited by E2 plus MPA and produced a 5-fold stimulation. The highest concentration of thrombin assessed (2.5 U/ml) elevated IL-8 levels 18-fold, compared with parallel cultures incubated with E2 plus MPA alone. Thrombin was also effective in enhancing IL-8 expression in control cultures.
|
|
|
|
In contrast with the prolonged enhancement in IL-8 protein levels, the Northern blot displayed in Fig. 7
indicates that the addition of thrombin to E2 + MPA-decidualized HESCs elicited a transient increase in steady-state IL-8 mRNA levels. Thus, IL-8 mRNA levels were up-regulated by about 3-fold at 3 h. Both basal and thrombin-elevated IL-8 levels abated thereafter and were undetectable after 12 h (not shown).
|
|
| Discussion |
|---|
|
|
|---|
In human endometrium IL-8 mRNA and protein have been localized to perivascular sites (14, 15, 31), and the IL-8 protein was also observed in luminal and glandular epithelial cells (44). Given the potent neutrophil chemoattractant effects of IL-8 (36, 37), the current results demonstrating that progestin inhibits the expression of IL-8 by HESCs may explain the virtual absence of neutrophils in the progesterone-dominated midluteal phase human endometrium (7, 8). That uteri of PRA and PRB knockout mice display a marked influx of leukocytes emphasizes the importance of progesterone in exerting antiinflammatory actions in the uterus (45).
In the premenstrual phase, a decline in circulating progesterone levels promotes degradation of the extracellular matrix (ECM) surrounding decidualized HESCs and the basal lamina underlying endometrial epithelial and endothelial cells (46, 47). The resulting disruption of the structural integrity of the stroma and uterine luminal epithelium and destabilization of the vasculature culminates in sloughing of the functional endometrial layer. Stromal and epithelial cell-derived matrix metalloproteinases (MMPs) are generally thought to mediate menstruation-associated endometrial ECM degradation (48, 49, 50, 51). However, the marked infiltration of the perimenstrual endometrium by neutrophils and natural killer cells, which express ECM-degrading MMPs, as well as cytokines that modulate MMP production in epithelial and stromal cells, suggests an important role for leukocytes in menstruation (reviewed in Ref. 7). A similar infiltration of the LTPOC-treated endometrium (9, 10, 11) suggests that leukocytes are also involved in mediating degradation of the vascular support structure that produces distended, structurally compromised vessels in these patients. Indeed, Norplant-induced AUB is associated with an increase in MMP-9-positive neutrophils in the endometrium (9).
Previously we observed a positive correlation between the intensity of IHC staining for TF and the progression of progesterone-regulated decidualization of luteal phase and gestational HESCs (17, 18). Moreover, we found that after Norplant administration TF levels were specifically elevated in decidualized HESCs in bleeding compared with adjacent nonbleeding sites and that abnormally distended, fragile vessels were preferentially localized to these bleeding sites (3). The current study confirms previous reports that the Mirena intrauterine system, which releases levonorgestrel directly to the uterus, produces highly decidualized HESCs and shows for the first time that they display levels of TF that approximate the intense expression found in first-trimester decidual cells. Although expression of TF by perivascular decidual cells is necessary, it is not sufficient to account for net thrombin generation. Vascular compromise is required to permit access to circulating clotting factors such as VII and X. In the absence of such access, thrombin would not be generated. However, as a result of LTPOC treatment, the endometrium is subjected to hypoxia, aberrant angiogenesis, inflammation-related increased vascular permeability, vascular damage, and bleeding. These processes subsequently would promote net thrombin generation by increasing availability of circulating clotting factors to decidualized stromal cell- expressed TF.
The study hypothesizes that in the LTPOC-derived endometrium, the occurrence of hypoxia secondary to impaired uterine blood flow (27), inflammation-related increased vascular permeability, vascular damage, and bleeding would promote net thrombin generation via transudation of factor VII to decidualized HESC-expressed TF. Autocrine stimulation by thrombin would then enhance IL-8 expression in decidualized HESCs. Therefore, we evaluated the separate and interactive effects of thrombin and hypoxia on IL-8 expression in control vs. in vitro decidualized, i.e. E2 + MPA-treated, HESCs. In the latter, thrombin transiently enhanced steady-state IL-8 mRNA levels while producing a prolonged, dose-dependent elevation in secreted IL-8 levels. This increase counteracted the E2 + MPA-mediated inhibition, resulting in a net, severalfold elevation in IL-8 levels. That thrombin-enhanced IL-8 expression in HESCs is mediated by the constitutively expressed PAR-1 receptor (33) was confirmed by the current observation demonstrating that TRAP-14, a PAR-1 agonist, also enhanced IL-8 output in E2 + MPA decidualized HESCs. Whereas thrombin, but not hypoxia, enhanced IL-8 output in control HESCs, the combination of thrombin and hypoxia exhibited additive effects in elevating IL-8 output in E2 + MPA-decidualized HESCs.
Based on our previous studies (3, 6, 52) and the findings by Hickey et al. (27), we propose that focal hypoxia stemming from impaired endometrial perfusion and vasomotion acts as an initiating point in LTPOC-associated AUB. Thus, hypoxia was shown in this study to directly enchance IL-8 expression in decidualized HESCs. However, hypoxia is a potent inducer of vascular endothelial growth factor (VEGF) expression in decidualized HESCs (52, 53, 54, 55), which is consistent with reports of elevated endometrial VEGF levels after Norplant treatment (56, 57, 58). Although increased vascular permeability is integral to VEGF-induced angiogenesis (59), overexpressed VEGF causes endothelial cells to become abnormally permeable and ultimately leaky (60). These changes would promote transudation of factor VII to decidual cell-expressed TF and generate thrombin. Like VEGF, thrombin is angiogenic and enhances endothelial cell permeability (61). Because thrombin is also an autocrine enhancer of VEGF expression in decidualized HESCs (52), a feed-forward cycle of VEGF and thrombin generation is created. Moreover, like augmentation of VEGF expression, this report shows that hypoxia and thrombin also drive IL-8 expression in decidualized HESCs. That thrombin, VEGF, and IL-8 each promote angiogenesis via separate endothelial cell receptors (40, 59, 61) suggests that they synergize to elicit abnormal angiogenesis and impaired vessel maintenance, thus contributing to the enlarged, structurally compromised, fragile vessels that are prone to bleed. The onset of AUB further promotes these pathological changes by increasing access of circulating factor VII to decidual cell-expressed TF.
In addition to disrupting vascular integrity via aberrant angiogenesis, our studies suggest that LTPOC treatment also destabilizes endometrial vessels by inducing protease- mediated degradation of the ECM supporting structure. Previously we showed that thrombin enhances urokinase type plasminogen activator and MMP expression by decidualized HESCs (33, 62). Moreover, consistent with the results of this study, thrombin and hypoxia-enhanced IL-8 production in decidualized HESCs is expected to act as a leukocyte chemoattractant. The concerted effects of decidualized HESC and leukocyte-derived proteases would account for the thin atrophic stroma seen in LTPOC users. The resulting disruption of the ECM that serves as a blood vessel support scaffolding would exacerbate AUB.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: AUB, Abnormal uterine bleeding; DM, defined medium; E2, estradiol; ECM, extracellular matrix; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HESC, human endometrial stromal cell; IHC, immunohistochemistry; LTPOC, long-term progesterone-only contraceptive; MMP, matrix metalloproteinase; MPA, medroxyprogesterone acetate; PAR-1, type-1 protease-activated receptor; TF, tissue factor; VEGF, vascular endothelial growth factor.
Received January 28, 2003.
Accepted November 23, 2003.
| References |
|---|
|
|
|---|
and prostaglandin E2 in human monocytic U937 cells. Immunol Lett 67:233237
This article has been cited by other articles:
![]() |
C. J. Lockwood, G. Krikun, M. Hickey, S. J. Huang, and F. Schatz Decidualized Human Endometrial Stromal Cells Mediate Hemostasis, Angiogenesis, and Abnormal Uterine Bleeding Reproductive Sciences, February 1, 2009; 16(2): 162 - 170. [Abstract] [PDF] |
||||
![]() |
C. J. Lockwood, P. Toti, F. Arcuri, M. Paidas, L. Buchwalder, G. Krikun, and F. Schatz Mechanisms of Abruption-Induced Premature Rupture of the Fetal Membranes: Thrombin-Enhanced Interleukin-8 Expression in Term Decidua Am. J. Pathol., November 1, 2005; 167(5): 1443 - 1449. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Lockwood, M. Paidas, G. Krikun, L. A. Koopman, R. Masch, E. Kuczynski, H. Kliman, R. N. Baergen, and F. Schatz Inflammatory Cytokine and Thrombin Regulation of Interleukin-8 and Intercellular Adhesion Molecule-1 Expression in First Trimester Human Decidua J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4710 - 4715. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Pritts, I. P. Ryan, M. D. Mueller, D. I. Lebovic, J. L. Shifren, C. J. Zaloudek, A. P. Korn, P. D. Darney, and R. N. Taylor Angiogenic Effects of Norplant Contraception on Endometrial Histology and Uterine Bleeding J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2142 - 2147. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Harada, Y. Osuga, Y. Hirota, K. Koga, C. Morimoto, T. Hirata, O. Yoshino, O. Tsutsumi, T. Yano, and Y. Taketani Mechanical Stretch Stimulates Interleukin-8 Production in Endometrial Stromal Cells: Possible Implications in Endometrium-Related Events J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1144 - 1148. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |