help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lockwood, C. J.
Right arrow Articles by Schatz, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lockwood, C. J.
Right arrow Articles by Schatz, F.
The Journal of Clinical Endocrinology & Metabolism Vol. 89, No. 3 1467-1475
Copyright © 2004 by The Endocrine Society

Effects of Thrombin, Hypoxia, and Steroids on Interleukin-8 Expression in Decidualized Human Endometrial Stromal Cells: Implications for Long-Term Progestin-Only Contraceptive-Induced Bleeding

Charles J. Lockwood, Priya Kumar, Graciela Krikun, Susan Kadner, Peter Dubon, Hilary Critchley and Frederick Schatz

Department of Obstetrics and Gynecology (C.J.L., G.K., F.S.), Yale University School of Medicine, New Haven, Connecticut 06510; Department of Obstetrics and Gynecology (P.K., S.K., P.D.), New York University School of Medicine, New York, New York 10016; and Department of Obstetrics and Gynecology (H.C.), Centre for Reproductive Biology, University of Edinburgh, United Kingdom EH16 4SB

Address all correspondence and requests for reprints to: Charles J. Lockwood, M.D., The Anita O’Keefe Young Professor and Chair, Department of Obstetrics and Gynecology, Yale University School of Medicine, 333 Cedar Street, Room 335 Farnam Memorial Building, P.O. Box 208063, New Haven, Connecticut 06510.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abnormal uterine bleeding is the major reason for discontinuing long-term progesterone-only contraceptives (LTPOCs). Prior studies demonstrated that endometria exposed to the LTPOC, Norplant, display aberrant angiogenesis, leukocyte infiltration, and hypoxia-associated impaired blood flow. Paradoxically, human endometrial stromal cells (HESCs) of these specimens exhibit elevated expression of tissue factor (TF), the primary initiator of hemostasis via thrombin generation. The current study demonstrates that TF levels are also elevated in HESCs that are decidualized after insertion of Mirena, an intrauterine system that releases levonorgestrel directly into the endometrial canal and produces elevated perivascular levels of the proinflammatory and angiognenic cytokine IL-8. Because bleeding, inflammation, and ischemia-associated increased vascular permeability enhance access of plasma factor VII to HESC-expressed TF to generate thrombin, we evaluated the effects of steroids, thrombin, and hypoxia on HESC expression of IL-8. Confluent HESCs were incubated in a serum-containing medium for 7 d with vehicle control or estradiol (E2) plus medroxyprogesterone acetate (MPA). The medium was then exchanged for corresponding defined medium with and without thrombin, and the cultures were incubated in parallel for up to 48 h in a standard incubator (normoxia) or a sealed chamber at 0–1% O2 (hypoxia). Under normoxia, immunoreactive IL-8 levels in the conditioned medium were reduced to one-third of control levels during decidualization with E2+MPA (P < 0.05; n = 5). In E2+MPA-treated cultures, thrombin (0.1 U/ml to 2.5 U/m) elicited a dose-dependent reversal of this inhibition, elevating IL-8 up to 60-fold (P < 0.05; n = 5) for more than 24 h and steady-state IL-8 mRNA levels by 3-fold for 3 h. The specific inactivator, hirudin, blocked most of the effects of thrombin, whereas TRAP-14, an agonist of the protease-activated receptor for thrombin, enhanced IL-8 output. In the absence of thrombin, hypoxia elevated IL-8 output 5-fold in E2+MPA-treated HESCs (P < 0.02, n = 4), with thrombin exerting additive effects. In contrast to its effects in progestin-treated HESCs, hypoxia did not elevate IL-8 output in control cultures. This study suggests that inhibition of IL-8 expression in decidualized HESCs contributes to the antiinflammatory milieu of the luteal phase. However, LTPOC-induced hypoxia and excess thrombin generation enhance IL-8 expression in decidualized HESCs, thereby eliciting aberrant angiogenesis and inflammation that promote the onset of abnormal uterine bleeding.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LONG-TERM PROGESTIN-ONLY contraceptives (LTPOCs) are safe and highly effective but are frequently discontinued because of abnormal uterine bleeding (AUB) originating from increased numbers of distended, fragile, superficial microvessels (1, 2, 3). LTPOCs include formulations that release levonorgestrel from subdermally implanted rods (Norplant) or via an intrauterine system (Mirena), whereas Depo-Provera involves im injection of medroxyprogesterone acetate (MPA). Although progesterone withdrawal initiates physiological menstrual bleeding (4), circulating progestin levels remain high during LTPOC-induced AUB. Moreover, Norplant and Depo-Provera contraception are associated with elevated endometrial levels of the progesterone receptor isoforms, PRA and PRB, thus ruling out functional progestin withdrawal (3, 5, 6). Paradoxically, both perimenstrual and LTPOC-treated endometrium display such inflammatory features as a leukocyte infiltrate (7, 8, 9, 10, 11), enhanced prostaglandin-generating capacity (11, 12, 13), and elevated IL-8 levels (10, 11). Whereas progesterone withdrawal appears to initiate increased IL-8 expression in menstrual endometrium (14, 15), the mechanisms regulating endometrial IL-8 expression in LTPOC users are unclear.

In vitro decidualization of human endometrial stromal cells (HESCs) by estradiol (E2) plus MPA is associated with prolonged up-regulation of tissue factor (TF) mRNA and protein (16). Moreover, we showed that decidualized HESCs in sections of luteal phase and gestational endometrium display elevated levels of TF mRNA and protein commensurate with the requirement for hemostasis during blastocyst invasion (17, 18). Consistent with the controlled hemorrhage of menstruation, progesterone withdrawal and mifepristone treatment reduce HESC-expressed TF (19). Paradoxically, TF levels are enhanced in decidualized HESCs at bleeding sites after Norplant treatment (3). The current study extends our previous immunohistochemical evaluation of endometrial TF expression after Norplant and Depo-Provera administration to include the endometrium after insertion of the Mirena intrauterine system. This contraceptive formulation produces markedly elevated local progestin levels and a highly decidualized endometrium (10, 11).

TF is the transmembrane receptor for circulating factor VII and its activated form factor VIIa. Consequently, TF-bound VIIa converts factor X to Xa, which then complexes with its cofactor Va to convert prothrombin to thrombin. Thrombin initiates hemostasis by cleaving fibrinogen to fibrin (20). However, thrombin can also bind to the type-1 protease-activated receptor (PAR-1) to induce a variety of cell responses (21) including augmentation of IL-8 expression in fibroblasts and epithelial and endothelial cells (22, 23, 24, 25, 26). To test the hypothesis that AUB-associated thrombin generation could enhance IL-8 expression in decidualized HESCs, the effects of thrombin were evaluated on IL-8 expression in control and progestin-decidualized HESCs. Because LTPOC administration could elicit hypoxia stemming from impaired endometrial perfusion and vasomotion (27), the separate and interactive effects of hypoxia and thrombin were also assessed on IL-8 expression by control and by in vitro progestin-exposed HESCs.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissues

After receiving written informed consent and approval from the Institutional Research Board of New York University Medical Center and Bellevue Hospital, specimens of predecidualized endometrium from the follicular and luteal phases were obtained from hysterectomies for benign conditions (e.g. myomas without abnormal uterine bleeding) from women of reproductive age and transported to a sterile laminar flow hood. A small portion of each specimen was formalin fixed and histologically dated by the criteria of Noyes et al. (28). The remainder was used to isolate HESCs.

Decidua were collected from patients undergoing elective terminations in the first trimester between 6 and 12 wk of gestation at Bellevue Hospital under Institutional Research Board approval. Endometrial tissue was obtained before and after intrauterine insertion of Mirena for contraception and/or heavy menstruation. The subjects had regular menstrual cycles and had not used hormonal or intrauterine contraception in the 6 months before insertion of Mirena. An endometrial biopsy was collected in an outpatient setting by Pipelle suction curette (Laboratoire CCD, Paris, France) in either the follicular or luteal phase before Mirena insertion. With each of four patients acting as her own control, additional endometrial samples were collected 1, 3, 6, and 12 months after insertion of Mirena. Ethical approval was obtained, and all women gave written informed consent for collection of endometrial biopsies.

Isolation of HESCs

Endometrial fragments were digested with 0.25% type I collagenase (Worthington, Lakewood NJ) for 30 min in a shaking water bath at 37 C. The digestate was filtered through a 38-µm stainless steel sieve. The sieve retained the glands, whereas the stromal cells passed through the sieve along with some epithelial cells and blood elements. Purification of the stromal cell-enriched fraction to virtual homogeneity, as determined by immunostaining for cytokeratin and vimentin used a Percoll gradient together with incubation for 30 min at 37 C in a standard humidified 95% air: 5% CO2, incubator. During this period, HESCs, but not the other cell types, attach to polystyrene tissue culture plastic (17, 29).

Culture of HESCs

HESCs were grown to confluence in BMS, which consists of basal medium, a phenol red-free 1:1 vol/vol mix of DMEM (Life Technologies, Inc., Grand Island, NY) and Ham’s F-12 (Flow Laboratories, Rockville, MD), with 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml fungizone that was supplemented with 10% charcoal-stripped calf serum. Confluent HESCs were incubated in parallel in BMS + 0.1% ethanol (vehicle control) or 10-8 mol/liter E2, or 10-7 mol/liter MPA (Sigma, St. Louis, MO), or E2 plus MPA with one change of medium. After 7 d in a standard incubator, the cultures were washed twice with Hank’s balanced salt solution to remove residual serum. Experimental treatments were carried out in a defined medium (DM) consisting of basal medium plus ITS+ (Collaborative Research, Waltham, MA), 5 µM FeSO4, 50 µM ZnSO4, 1 nM CuSO4, 20 nM Na2SeO3, trace elements (Life Technologies, Inc.), 50 µg/ml ascorbic acid (Sigma), and 50 ng/ml epidermal growth factor (Becton Dickinson, Bedford, MA) containing corresponding vehicle control or steroid(s) added with or without thrombin (American Diagnostica, Greenwich, CT) or the thrombin receptor agonist peptide TRAP14 (Bachem Biosciences Inc., King of Prussia, PA). In some experiments, thrombin and hirudin (Sigma) were mixed and preincubated for 30 min at room temperature before incubation with HESCs. After the experimental test period in DM, the collected medium was centrifuged and the cells were washed with Hank’s balanced salt solution and lysed with 0.4% sodium dodecyl sulfate. Medium supernatants and cell lysates were stored at -70 C. In parallel incubations, total RNA was extracted from cultured HESCs with Tri-reagent (Sigma).

Hypoxia

Confluent HESCs in DM were placed in a humidified sealed chamber containing a portable gas oxygen analyzer. The chambers were purged with 5% CO2: 95% N2 for 15 min after the oxygen analyzers read 0–1% O2 (12–14 mm Hg). The sealed chambers were placed in a standard 37 C incubator for 48 h. Only those cultures whose chambers read 2% O2 or less after 48 h were used for this study. Parallel normoxic incubations were maintained in a standard incubator (pO2 120–130 mm Hg).

Biochemical assays

Immunoreactive IL-8 was measured in the conditioned media by ELISA (R&D Systems, Minneapolis, MN). The ELISA has a sensitivity of 3.5 pg/ml, an intraassay and interassay coefficient of variation of 4.6 and 6.7%, respectively. The DNA and protein content of the cell lysates were determined by the method of Hinegardner (30) and the Bio-Rad Laboratories assay (Hercules, CA), respectively.

Western blot analysis

Supernatants of conditioned medium were concentrated 5-fold using Microcon centrifugal filter devices (Millipore Corp., Bedford, MA) and then subjected to electrophoresis on a 10–20% sodium dodecyl sulfate polyacrylamide linear gradient gel (Bio-Rad Laboratories). The gel was electroblotted onto a 0.2-µm nitrocellulose membrane (Bio-Rad Laboratories). After transfer, the membrane was blocked overnight in PBS with 1% casein and then incubated for 2 h with a 1:333 dilution of a mouse antihuman IL-8 monoclonal antibody (R&D Systems). Membranes were rinsed in PBS and 0.2% Tween 20 before and after incubation with horseradish peroxidase-conjugated antimouse IgG (ICN Biomedicals, Aurora, OH). Chemiluminescence was detected with enhanced chemiluminescence reagents (Perkin-Elmer Life Sciences, Boston, MA) and audioradiography film (Amersham Pharmacia, Buckinghamshire, UK) according to the manufacturers’ instructions.

Northern blot analysis

The cDNA probe for IL-8 was generated by RT-PCR of total RNA isolated from HESCs. Primers were selected from the published mRNA sequence as follows: forward, 5'-gacaagagccaggaagaaac; reverse, 5'-ctacaacagacccacacaatac. Total RNA (1 µg) was reversed transcribed using Moloney leukemia virus reverse transcriptase (Perkin-Elmer) and oligo d(T)16 as primer. IL-8 cDNA was amplified using AmpliTaq DNA polymerase and the specific primers under the following conditions: 95 C, 1 min 45 sec (1x); 95 C, 15 sec; 54 C 30 sec; 72 C, 30 sec (35x); and 72 C, 7 min (1x). The 459-bp product was extracted from an agarose gel, purified by spin-column (Qiagen Inc., Valencia, CA), and labeled with 32P-dCTP (Megaprime DNA labeling system, Amersham Pharmacia Biotech UK Ltd., Buckinghamshire, UK).

Fifteen microgram of total RNA from each of the experimental cultures were electrophoresed on a 1.2% agarose gel containing 0.66 mol/liter formaldehyde, transferred to GeneScreen nylon membrane (NEN Life Science Products, Boston, MA), and hybridized with 32P-labeled IL-8 cDNA. The washed membranes were exposed to Kodak XAR film (Eastman Kodak, Rochester, NY). RNA loading was standardized by reprobing the stripped membranes with a 32P-labeled probe for glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Real-time quantitative RT-PCR

Extracted RNA from experimental cell incubations were subjected to semiquantitative RT-PCR using a kit from Invitrogen (Carlsbad, CA) and carrying out 35 cycles with the Eppendorf Mastercycler (Eppendorf, Westbury, NY). To perform quantitative real-time RT-PCR, RT was initially carried out with AMV reverse transcriptase (Invitrogen). A quantitative standard curve was created between 500 pg and 250 ng of cDNA with a Light Cycler (Roche, Indianapolis, IN) by monitoring increasing fluorescence of PCR products during amplification. Upon establishing the standard curve, quantitation of the unknowns was determined with the Roche Light Cycler and adjusted to the quantitative expression of ß-actin from the corresponding unknowns. Melting curve analysis determined the specificity of the amplified products and the absence of primer-dimer formation. All products obtained yielded correct melting temperatures. The following primers were synthesized and gel purified at the Yale DNA Synthesis Laboratory, Critical Technologies:

ß-actin: sense (5' to 3'), CGTACCACTGGCATCGTGAT; antisense (5' to 3'), GTGTTGGCGTACAGGTCTTTG; 452-bp product.

IL-8: sense (5' to 3'), GACAAGAGCCAGGAAGAAAC; antisense sense (5' to 3'), CTACAACAGACCCACACAATAC; 459-bp product.

Immunohistochemistry (IHC)

Paraformaldehyde-fixed, paraffin-embedded sections. Specimens of endometrium from control and Mirena-treated patients as well as first-trimester decidua were fixed in 4% paraformaldehyde and embedded in paraffin. Peroxidase staining was conducted with the ABC elite kit from Vector Laboratories (Burlingame, CA) as previously described (17). The mouse monoclonal antibody to TF was a kind gift from Dr. Yale Nemerson (Mount Sinai School of Medicine, New York, NY). Controls consisted of using preimmune serum in place of the TF antiserum.

Frozen sections. Frozen serial sections from endometrial biopsies obtained after insertion of the Mirena intrauterine system or from matched controls were immunostained as described by Critchley et al. (31). Briefly, sections were microwave heated, fixed in 4% neutral buffered formaldehyde, and then washed in PBS with 1.5% polyvinylpyrrolidone before blocking for endogenous peroxidase. After a further wash with PBS with 1.5% polyvinylpyrrolidone, sections were incubated in avidin then biotin (Vector, Vector Laboratories, Peterborough, UK), washed again, and then incubated in corresponding control serum for either IL-8 or TF. Serial sections were incubated in either a 1:1000–1:2000 dilution of rabbit anti-IL-8 antibody (31) or a 1:500–1:1000 dilution of mouse anti-TF antibody for 60 min at 37 C. Nonimmune rabbit (IL-8) and mouse (TF) IgG were used as negative controls. Binding of the primary antibody was detected with a biotinylated goat antirabbit IL-8 or horse antimouse TF antibody (Vector) followed by the ABC elite kit (Vector). Staining was visualized by diaminobenzidine. Sections were counterstained with hematoxylin.

Statistical analysis

Statistical analysis was performed by the Mann-Whitney rank sum test with P < 0.05 considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunostaining for tissue factor in gestational and Mirena-treated endometria

As we reported previously (17, 18), decidualized HESCs of first-trimester decidua display prominent IHC staining for TF (Fig. 1 AGo). Consistent with the continuous release of progestin directly to the uterus, the biopsy obtained 3 months after insertion of the Mirena intrauterine system contains stromal cells that display features similar to those of the first trimester decidua. Thus, these are highly decidualized, cuboidal cells with edematous cytoplasm and prominent staining for TF at the cell membranes (Fig. 1BGo). By comparison note the lack of decidualization and the relative absence of TF immunostaining in the control follicular phase endometrial specimen obtained from the same woman before Mirena contraception (Fig. 1CGo).



View larger version (59K):
[in this window]
[in a new window]
 
FIG. 1. Immunohistochemistry of TF in gestational endometrium following Mirena insertion. IHC staining was carried out on paraformaldehyde-fixed, paraffin-embedded sections (see Materials and Methods). A, First-trimester decidua. Arrows indicate prominent immunostaining for TF at cell membranes of decidualized stromal cells. A blood vessel is designated by V. B, Endometrial biopsy 3 months after insertion of the Mirena intrauterine system. Note marked decidualization of and prominent staining for TF at stromal cell membranes (arrows). G, Atrophic gland (typical of LTPOC treatment). C, Control follicular phase endometrial specimen obtained from the same women before Mirena contraception. The stromal cells are not decidualized and display a relative absence of TF immunostaining. A blood vessel is designated by V. Magnification, x200.

 
Immunostaining for tissue factor and IL-8 in Mirena-treated endometria

To obtain in vivo support of our hypothesis that AUB-associated thrombin generation enhances IL-8 expression in decidualized HESCs, IHC staining was carried out for TF and IL-8 in frozen serial endometrial sections 3 months after initiating Mirena intrauterine contraception. The results of Fig. 2AGo are in accordance with those previously described for Fig. 1BGo, i.e. prominent IHC staining for TF in decidualized HESCs. As in our previous studies (15, 31), Fig. 2BGo displays prominent IHC staining for IL-8 in perivascular cells. However, Fig. 2BGo also demonstrates IL-8 IHC staining in a patch of decidualized HESCs distal from blood vessels. This observation is consistent with the underlying hypothesis of this study whereby vascular damage and bleeding associated with Mirena contraception would generate thrombin from TF expressed by highly decidualized HESCs. Thrombin then acts as an autocrine enhancer of IL-8 in these cells.



View larger version (115K):
[in this window]
[in a new window]
 
FIG. 2. Immunohistochemistry of TF and IL-8 in serial sections of endometrium following Mirena insertion. Endometrial biopsies were obtained 3 months after Mirena insertion and IHC staining was carried out on frozen sections (see Materials and Methods). A, Immunostaining for TF. Staining is prominent at cell membranes of decidualized stromal cells. Blood vessel is designated by V. B, Immunostaining for IL-8. Staining is prominent around blood vessels (V), with staining also evident in decidualized HESCs (D). Magnification, x200.

 
Regulation of IL-8 protein expression in cultured HESCs

Figure 3Go demonstrates that E2 plus MPA reduced secreted levels of IL-8 by HESC monolayers, compared with parallel cultures incubated with control medium. Additional experiments revealed that this inhibition was greater than that elicited by MPA alone, whereas E2 was not inhibitory when added alone (results not shown). This differential IL-8 response to ovarian steroids was previously demonstrated for several decidualization markers in cultured HESCs [reviewed in Lockwood and Schatz (4)] and is consistent with progestin inhibition of IL-8 secretion reported in human endometrial explants (32). Figure 3Go also shows that in E2 plus MPA-decidualized cultures, thrombin elicited a statistically significant, dose-dependent increase in IL-8 output over the 48-h test period. The lowest concentration of thrombin (0.1 U/ml) completely reversed the 66% inhibition in IL-8 output elicited by E2 plus MPA and produced a 5-fold stimulation. The highest concentration of thrombin assessed (2.5 U/ml) elevated IL-8 levels 18-fold, compared with parallel cultures incubated with E2 plus MPA alone. Thrombin was also effective in enhancing IL-8 expression in control cultures.



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 3. Effects of thrombin on IL-8 output by control and decidualized HESC monolayers. Confluent HESCs derived from specimens obtained from five different patients were incubated for 7 d in vehicle control (C) or E2 (E) + MPA (P) to induce decidualization and then switched to DM with corresponding vehicle or E + P with or without thrombin (T) at the indicated concentrations. After 48 h, IL-8 levels were measured by ELISA in conditioned DM and normalized to cell DNA (see Materials and Methods). *, E + P vs. C, P < 0.05, n = 5; **, C vs. C + 0.5 U/ml T; P < 0.01, n = 5; ***, E + P vs. E + P + 0.1 U/ml T or 0.5 U/ml T or 2.5 U/ml T; P < 0.05, n = 5.

 
Figure 4AGo indicates that the thrombin inactivator, hirudin, blocked most of the enhancing effects of thrombin on IL-8 in E2 plus MPA-treated HESCs. Consistent with our report that the PAR-1 is constitutively expressed in HESCs (33), Fig. 4Go, A and B, indicate that the synthetic peptide PAR-1 agonist, TRAP-14, was effective in up-regulating secreted levels of IL-8 in the in vitro decidualized HESCs.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 4. Effects of thrombin, TRAP, and hirudin on IL-8 output by in vitro decidualized HESCs. Confluent HESCs were decidualized for 7 d in E2 + MPA and then switched to DM containing E2 + MPA(C) with or without thrombin (T), or TRAP at the indicated concentrations, or 2.5 U/ml thrombin + 8 U/ml hirudin (H) (prepared as described in Materials and Methods). After 48 h, IL-8 was measured by ELISA in conditioned DM and normalized to cell protein (see Materials and Methods). A, Ordinate: IL-8 (pg/ml)/µg cell protein; average of two experiments. B, Ordinate, Fold increase vs. E2 + MPA; mean +-SEM, n = 3.

 
Figure 5Go displays the separate and interactive effects of hypoxia, thrombin, and E2 + MPA on IL-8 output by HESCs. As expected (see Fig. 3Go), thrombin enhanced IL-8 output in control cultures. However, hypoxia failed to affect basal or thrombin-enhanced IL-8 output in these cultures. By contrast, hypoxia enhanced IL-8 output by about 4-fold (P < 0.02, n = 5) in cultures decidualized with E2 + MPA. In these cultures, the stimulatory effects of hypoxia and 0.5 u/ml thrombin were additive.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 5. Effects of hypoxia and thrombin on IL-8 output by control and in vitro decidualized HESCs. Confluent HESCs were incubated for 7 d in vehicle control (C) or decidualized by E2 (E) + MPA (P) and then switched to DM with corresponding vehicle or steroids, with or without 0.5 U/ml of thrombin. Parallel incubations in DM were carried out under hypoxia. After 48 h, IL-8 was measured by ELISA in conditioned DM and normalized to cell DNA (see Materials and Methods). *, E + P normoxia vs. E + P hypoxia, P < 0.02, n = 5.

 
The Western blot shown in Fig. 6Go validates the ELISA results for IL-8. Thus, it shows that the conditioned medium from E2 + MPA-decidualized HESCs, incubated with thrombin or TRAP-14 or under hypoxia contains a prominent band that migrates with the mobility of authentic IL-8.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 6. Western blot of thrombin, TRAP, and hypoxia effects on IL-8 output by in vitro decidualized HESCs. Confluent HESCs were decidualized for 7 d in E2 + MPA and then incubated for 48 h in DM containing E2 + MPA with or without thrombin, or TRAP, or thrombin under hypoxia. The conditioned medium was concentrated and subjected to Western blotting (see Materials and Methods). Lane 1, E2 + MPA; lane 2, E2 + MPA plus 238 U/ml TRAP; lane 3, E2 + MPA plus 2.5 U/ml thrombin; lane 4, E2 + MPA plus 2.5 U/ml thrombin under hypoxia.

 
Regulation of IL-8 mRNA expression in cultured HESCs

In contrast with the prolonged enhancement in IL-8 protein levels, the Northern blot displayed in Fig. 7Go indicates that the addition of thrombin to E2 + MPA-decidualized HESCs elicited a transient increase in steady-state IL-8 mRNA levels. Thus, IL-8 mRNA levels were up-regulated by about 3-fold at 3 h. Both basal and thrombin-elevated IL-8 levels abated thereafter and were undetectable after 12 h (not shown).



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 7. Northern blot of thrombin effects on IL-8 mRNA levels in in vitro decidualized HESCs. Confluent HESCs were decidualized for 7 d in E2 + MPA and then switched to DM containing E2 + MPA with or without 0.5 U/ml of thrombin. RNA was extracted at the times indicated. Northern blotting was carried out for IL-8 mRNA, and the blot was stripped and reprobed for GAPDH mRNA. Steady-state levels of GAPDH mRNA were used to normalize for differences in RNA loading.

 
The results depicted in Fig. 8Go confirms by quantitative RT-PCR that thrombin enhances IL-8 mRNA levels in vitro decidualized HESCs. In accordance with the effects on secreted levels, TRAP-14 was also an agonist of IL-8 mRNA levels, whereas hirudin antagonized the up-regulatory effects of thrombin.



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 8. Quantitative RT-PCR of thrombin, TRAP, and hirudin effects on IL-8 mRNA levels in vitro decidualized HESCs. Confluent HESCs were decidualized for 7 d in E2 + MPA and then switched to DM containing E2 + MPA with or without thrombin (T), or TRAP, or hirudin (H) or thrombin + hirudin. RNA was extracted after 4 h of incubation and subjected to quantitative RT-PCR for IL-8 and the ß- actin housekeeping gene (see Materials and Methods). Ordinate, IL-8 mRNA/actin mRNA.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-8 is a multifunctional member of CXC chemokine superfamily that is generated as a 99-amino acid precursor and secreted after cleavage of its 20-amino acid leader sequence. Monocytes, neutrophils, endothelial cells, epithelial cells, and fibroblasts produce IL-8 (34). IL-8 exerts several well-characterized effects on neutrophils that are mediated by two heptahelical receptors coupled to GTP binding proteins (35). These effects include chemoattraction, shape change, enhanced expression of adhesion molecules, stimulation of transendothelial cell migration, and respiratory burst (36, 37). IL-8 is also chemotactic for natural killer cells (38) and T lymphocytes (39) and induces angiogenesis (40). The observation that IL-8 enhances growth and adhesion of HESCs to extracellular matrices (41, 42) suggests that it promotes attachment of endometrial implants during the pathogenesis of endometriosis, given the high levels of IL-8 in endometriotic peritoneal fluid (43).

In human endometrium IL-8 mRNA and protein have been localized to perivascular sites (14, 15, 31), and the IL-8 protein was also observed in luminal and glandular epithelial cells (44). Given the potent neutrophil chemoattractant effects of IL-8 (36, 37), the current results demonstrating that progestin inhibits the expression of IL-8 by HESCs may explain the virtual absence of neutrophils in the progesterone-dominated midluteal phase human endometrium (7, 8). That uteri of PRA and PRB knockout mice display a marked influx of leukocytes emphasizes the importance of progesterone in exerting antiinflammatory actions in the uterus (45).

In the premenstrual phase, a decline in circulating progesterone levels promotes degradation of the extracellular matrix (ECM) surrounding decidualized HESCs and the basal lamina underlying endometrial epithelial and endothelial cells (46, 47). The resulting disruption of the structural integrity of the stroma and uterine luminal epithelium and destabilization of the vasculature culminates in sloughing of the functional endometrial layer. Stromal and epithelial cell-derived matrix metalloproteinases (MMPs) are generally thought to mediate menstruation-associated endometrial ECM degradation (48, 49, 50, 51). However, the marked infiltration of the perimenstrual endometrium by neutrophils and natural killer cells, which express ECM-degrading MMPs, as well as cytokines that modulate MMP production in epithelial and stromal cells, suggests an important role for leukocytes in menstruation (reviewed in Ref. 7). A similar infiltration of the LTPOC-treated endometrium (9, 10, 11) suggests that leukocytes are also involved in mediating degradation of the vascular support structure that produces distended, structurally compromised vessels in these patients. Indeed, Norplant-induced AUB is associated with an increase in MMP-9-positive neutrophils in the endometrium (9).

Previously we observed a positive correlation between the intensity of IHC staining for TF and the progression of progesterone-regulated decidualization of luteal phase and gestational HESCs (17, 18). Moreover, we found that after Norplant administration TF levels were specifically elevated in decidualized HESCs in bleeding compared with adjacent nonbleeding sites and that abnormally distended, fragile vessels were preferentially localized to these bleeding sites (3). The current study confirms previous reports that the Mirena intrauterine system, which releases levonorgestrel directly to the uterus, produces highly decidualized HESCs and shows for the first time that they display levels of TF that approximate the intense expression found in first-trimester decidual cells. Although expression of TF by perivascular decidual cells is necessary, it is not sufficient to account for net thrombin generation. Vascular compromise is required to permit access to circulating clotting factors such as VII and X. In the absence of such access, thrombin would not be generated. However, as a result of LTPOC treatment, the endometrium is subjected to hypoxia, aberrant angiogenesis, inflammation-related increased vascular permeability, vascular damage, and bleeding. These processes subsequently would promote net thrombin generation by increasing availability of circulating clotting factors to decidualized stromal cell- expressed TF.

The study hypothesizes that in the LTPOC-derived endometrium, the occurrence of hypoxia secondary to impaired uterine blood flow (27), inflammation-related increased vascular permeability, vascular damage, and bleeding would promote net thrombin generation via transudation of factor VII to decidualized HESC-expressed TF. Autocrine stimulation by thrombin would then enhance IL-8 expression in decidualized HESCs. Therefore, we evaluated the separate and interactive effects of thrombin and hypoxia on IL-8 expression in control vs. in vitro decidualized, i.e. E2 + MPA-treated, HESCs. In the latter, thrombin transiently enhanced steady-state IL-8 mRNA levels while producing a prolonged, dose-dependent elevation in secreted IL-8 levels. This increase counteracted the E2 + MPA-mediated inhibition, resulting in a net, severalfold elevation in IL-8 levels. That thrombin-enhanced IL-8 expression in HESCs is mediated by the constitutively expressed PAR-1 receptor (33) was confirmed by the current observation demonstrating that TRAP-14, a PAR-1 agonist, also enhanced IL-8 output in E2 + MPA decidualized HESCs. Whereas thrombin, but not hypoxia, enhanced IL-8 output in control HESCs, the combination of thrombin and hypoxia exhibited additive effects in elevating IL-8 output in E2 + MPA-decidualized HESCs.

Based on our previous studies (3, 6, 52) and the findings by Hickey et al. (27), we propose that focal hypoxia stemming from impaired endometrial perfusion and vasomotion acts as an initiating point in LTPOC-associated AUB. Thus, hypoxia was shown in this study to directly enchance IL-8 expression in decidualized HESCs. However, hypoxia is a potent inducer of vascular endothelial growth factor (VEGF) expression in decidualized HESCs (52, 53, 54, 55), which is consistent with reports of elevated endometrial VEGF levels after Norplant treatment (56, 57, 58). Although increased vascular permeability is integral to VEGF-induced angiogenesis (59), overexpressed VEGF causes endothelial cells to become abnormally permeable and ultimately leaky (60). These changes would promote transudation of factor VII to decidual cell-expressed TF and generate thrombin. Like VEGF, thrombin is angiogenic and enhances endothelial cell permeability (61). Because thrombin is also an autocrine enhancer of VEGF expression in decidualized HESCs (52), a feed-forward cycle of VEGF and thrombin generation is created. Moreover, like augmentation of VEGF expression, this report shows that hypoxia and thrombin also drive IL-8 expression in decidualized HESCs. That thrombin, VEGF, and IL-8 each promote angiogenesis via separate endothelial cell receptors (40, 59, 61) suggests that they synergize to elicit abnormal angiogenesis and impaired vessel maintenance, thus contributing to the enlarged, structurally compromised, fragile vessels that are prone to bleed. The onset of AUB further promotes these pathological changes by increasing access of circulating factor VII to decidual cell-expressed TF.

In addition to disrupting vascular integrity via aberrant angiogenesis, our studies suggest that LTPOC treatment also destabilizes endometrial vessels by inducing protease- mediated degradation of the ECM supporting structure. Previously we showed that thrombin enhances urokinase type plasminogen activator and MMP expression by decidualized HESCs (33, 62). Moreover, consistent with the results of this study, thrombin and hypoxia-enhanced IL-8 production in decidualized HESCs is expected to act as a leukocyte chemoattractant. The concerted effects of decidualized HESC and leukocyte-derived proteases would account for the thin atrophic stroma seen in LTPOC users. The resulting disruption of the ECM that serves as a blood vessel support scaffolding would exacerbate AUB.


    Acknowledgments
 
We appreciate the technical expertise of Teresa Henderson (University of Edinburgh) and Rebeca Caze, Dr. Mizanur Rahman, Dr. Caroline Tang, and Lynn Buchwalder (Yale University).


    Footnotes
 
This work was supported by a grant from the National Institutes of Health RO1 HD033937 (to C.J.L.).

Abbreviations: AUB, Abnormal uterine bleeding; DM, defined medium; E2, estradiol; ECM, extracellular matrix; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HESC, human endometrial stromal cell; IHC, immunohistochemistry; LTPOC, long-term progesterone-only contraceptive; MMP, matrix metalloproteinase; MPA, medroxyprogesterone acetate; PAR-1, type-1 protease-activated receptor; TF, tissue factor; VEGF, vascular endothelial growth factor.

Received January 28, 2003.

Accepted November 23, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rogers PAW, Au CL, Affandi B 1993 Endometrial microvascular density during the normal menstrual cycle and following exposure to long-term levonorgestrel. Hum Reprod 8:1396–1404[Abstract/Free Full Text]
  2. Hickey M, Fraser I, Dwarte D, Graham S 1996 Endometrial vasculature in NORPLANT users: preliminary results from a hysteroscopic study. Hum Reprod 11(Suppl 2):35–44
  3. Runic R, Schatz F, Wan L, Demopoulos R, Krikun G, Lockwood CJ 2000 Effects of Norplant on endometrial tissue factor expression and blood vessel structure. J Clin Endocrinol Metab 85:3853–3859[Abstract/Free Full Text]
  4. Lockwood CJ, Schatz F 1996 A biological model for the regulation of peri-implantational hemostasis and menstruation. J Soc Gynecol Invest 3:159–165
  5. Critchley HOD, Bailey DA, Au CL, Affandi B, Rogers PA 1993 Immunohistochemical sex steroid receptor distribution in endometrium from long-term subdermal levonorgestrel users and during normal menstrual cycle. Hum Reprod 8:1632–1639[Abstract/Free Full Text]
  6. Lockwood CJ, Runic R, Wan L, Demopoulos R, Schatz F 2000 The role of tissue factor in regulating endometrial hemostasis: implications for progestin-only contraception. Hum Reprod 15:144–151[Medline]
  7. Salamonsen LA, Wooley DE 1999 Menstruation: induction by matrix metalloproteinases and inflammatory cells. J Reprod Immunol 44:1–27[CrossRef][Medline]
  8. Bulmer JN, Morrison L, Longfellow M, Ritson A, Pace D 1991 Granulated lymphocytes in human endometrium: histochemical and immunohistochemical studies. Hum Reprod 6:791–798[Abstract/Free Full Text]
  9. Vincent AJ, Malakooti N, Zhang J, Rogers PA. Affandi B, Salamonsen LA 1999 Endometrial breakdown in women using Norplant is associated with migratory cells expressing matrix metaloproteinase-9 (gelatinase B). Hum Reprod 14: 807–815
  10. Critchley HOD, Wang H, Jones RL, Kelly RW, Drudy TA, Gebbie AE, Buckley CH, McNeilly AS, Glasier AF 1998 Morphological and functional features in endometrial decidualization following long term intrauterine levonorgestrel delivery. Hum Reprod 13:1218–1224[Abstract/Free Full Text]
  11. Jones RL, Critchley HOD 2000 Morphological and functional changes in human endometrium following intrauterine levonorgestrel delivery. Hum Reprod 15:162–172[Medline]
  12. Critchley HOD, Wang H, Kelly RW, Gebbie AE, Glasier AF 1998 Progestin receptor isoforms and prostaglandin dehydrogenase in the endometrium of women using a levonorgestrel-releasing intrauterine system. Hum Reprod 13:1210–1217[Abstract/Free Full Text]
  13. Baird DT, Cameron ST, Critchley HOD Drudy TA. Howe A, Jones RL, Lea RG, Kelly RW 1996 Prostaglandins and menstruation. Eur J Obstet Gynecol Rep Biol 7:15–17
  14. Critchley HOD, Jones RW, Lea RG 1999 Role of inflammatory mediators in human endometrium during progesterone withdrawal and early pregnancy. J Clin Endocrinol Metab 84:240–248[Abstract/Free Full Text]
  15. Milne SA, Critchley HOD, Drudy TA, Kelly RW, Baird DT 1999 Perivascular interleukin-8 messenger ribonucleic acid expression in human endometrium varies across the menstrual cycle and in early pregnancy decidua. J Clin Endocrinol Metab 84:2563–2567[Abstract/Free Full Text]
  16. Lockwood CJ, Nemerson Y, Krikun G, Hausknecht V, Markiewicz L, Alvarez M, Guller S, Schatz F 1993 Steroid-modulated stromal cell tissue factor expression: a model for the regulation of endometrial hemostasis and menstruation. J Clin Endocrinol Metab 77:1014–1019[Abstract]
  17. Lockwood CJ, Nemerson Y, Guller S, Krikun G, Alvarez M, Hausknecht V, Gurpide E, Schatz F 1993 Progestational regulation of human endometrial stromal cell tissue factor expression during decidualization. J Clin Endocrinol Metab 76:231–236[Abstract]
  18. Lockwood CJ, Krikun G, Papp C, Toth-Pal E, Markiewicz L, Wang E-Y, Kerenyi T, Zhou X, Hausnecht V, Papp Z, Schatz F 1994 The role of progestationally regulated stromal cell tissue factor and type-1 plasminogen activator inhibitor (PAI-1) in endometrial hemostasis and menstruation. Ann NY Acad Sci 734:57–79[Abstract]
  19. Lockwood CJ, Krikun G, Papp C, Aigner S, Nemerson Y, Schatz F 1994 Biological mechanisms underlying RU 486 clinical effects: inhibition of endometrial stromal cell tissue factor content. J Clin Endocrinol Metab 79:786–790[Abstract]
  20. Nemerson Y 1988 Tissue factor and hemostasis. Blood 71:1–8[Free Full Text]
  21. Cocks TM, Moffatt JD 2000 Protease-activated receptors: sentries for inflammation? Trends Pharmacol Sci 21:103–108[CrossRef][Medline]
  22. Ludwicka-Bradley A, Tourkina E, Suzuki S, Tyson E, Bonner M, Fenton II JW, Hoffman S, Silver RM 2000 Thrombin upregulates interleukin-8 in lung fibroblasts via cleavage of proteolytically activated receptor-I and protein kinase C-activation. Am J Respir Cell Mol Biol 22:235–243[Abstract/Free Full Text]
  23. Ueno A, Murakami K, Yamanouchi K, Watanabe M, Kondo T 1996 Thrombin stimulates production of interleukin-8 in human umbilical vein endothelial cells. Immunology 88:76–81[CrossRef][Medline]
  24. Asokananthan N, Graham PT, Fink J, Knight DA, Bakker AJ, McWilliam AS, Thompson PJ, Stewart GA 2002 Activation of protease-activated receptor (PAR)-1, PAR-2, and PAR-4 stimulates IL-6, IL-8, and prostaglandin E2 release from human respiratory epithelial cells. J Immunol 168:3577–3585[Abstract/Free Full Text]
  25. Takata M, Urakaze M, Temaru R, Yamazaki K, Nakamura N, Nobata Y, Kishida M, Sato A, Kobayashi M 2001 Pravastatin suppresses the interleukin-8 production induced by thrombin in human aortic endothelial cells cultured with high glucose by inhibiting the p44/42 mitogen activated protein kinase. Br J Pharmacol 34:753–762[CrossRef]
  26. Suk K, Cha S 1999 Thrombin-induced interleukin-8 production and its regulation by interferon-{gamma} and prostaglandin E2 in human monocytic U937 cells. Immunol Lett 67:233–237
  27. Hickey M, Carati C, Manconi F, Gannon BJ, Dwarte D, Fraser IS 2000 The measurement of endometrial perfusion in Norplant users: a pilot study. Hum Reprod 15: 1086–1091
  28. Noyes RW, Hertig AT, Rock J 1950 Dating the endometrial biopsy. Fertil Steril 1:3–25[Medline]
  29. Arcuri F, Monder C, Lockwood CJ, Schatz F 1996 Expression of 11ß-hydroxysteroid dehydrogenase during decidualization of human endometrial stromal cells. Endocrinology 137:595–599[Abstract]
  30. Hinegardner RT 1971 An improved fluorometric assay for DNA. Anal Biochem 39:197–201[CrossRef][Medline]
  31. Critchley HO, Kelly RW, Kooy J 1994 Perivascular location of a chemokine interleukin-8 in human endometrium: a preliminary report. Hum Reprod 8:1406–1409
  32. Kelly RW, Ilingsworth P, Baldie G, Leask R, Brouwer S, Calder AA 1994 Progesterone control of interleukin-8 production in endometrium and chorio-decidual cells underlines the role of the neutrophil in menstruation and parturition. Hum Reprod 9:253–258[Abstract/Free Full Text]
  33. Lockwood CJ, Krikun G, Aigner S, Schatz F 1996 Thrombin effects on steroid-modulated cultured endometrial stromal cell fibrinolytic potential. J Clin Endocrinol Metab 81:107–112[Abstract]
  34. Roebuck KA 1999 Regulation of interleukin-8 gene expression. J Interferon Cytokine Res 19:429–438[CrossRef][Medline]
  35. Wu D, Larosa GJ, Simon MI (1993) G protein-coupled signal transduction pathways for interleukin-8. Science 261: 101–103
  36. Ben-Baruch A, Bengali KM, Biragyn A, Johnston JJ, Wang JM, Kim J, Chuntharapai A, Michiel DF, Oppenheim JJ, Kelvin DJ 1995 Interleukin-8 receptor ß. The role of the carboxyl terminus in signal transduction. J Biol Chem 270:9121–9128[Abstract/Free Full Text]
  37. Baggiolini M 1988 Chemokines and leukocyte traffic. Nature 392:565–568
  38. Loetscher P, Seitz M, Clark-Lewis I, Baggiolini M, Moser B 1996 Activation of NK cells by CC chemokines. Chemotaxis, Ca2+ mobilization, and enzyme release. J Immunol 156:322–327[Abstract]
  39. Larsen CG, Anderson AO, Apella E, Oppenheim JJ, Matsushima K 1989 The neutrophil activating peptide (NAP-1) is also chemotactic for T lymphocytes. Science 243:1464–1466[Abstract/Free Full Text]
  40. Strieter RM, Kunkel SL, Elner VM 1992 Interleukin-8—a corneal factor that induces neovascularization. Am J Pathol 141:1279–1284[Abstract]
  41. Arici A, Seli E, Zyneloglu HB, Senturk LM. Oral E, Olive DL 1998 Interleukin-8 induces proliferation of endometrial stromal cell: a potential autocrine growth factor. J Clin Endocrinol Metab 83:1201–1205[Abstract/Free Full Text]
  42. Garcia-Velasco JA, Arici A 1999 Interleukin-8 stimulates adhesion of endometrial stromal cells to fibronectin. Fertil Steril 72:336–340[CrossRef][Medline]
  43. Gazvani MR, Christmas S, Quenby S, Kirwan J, Johnson PM, Kingsland CR 1998 Peritoneal fluid concentrations of interleukin-8 in women with endometriosis: relationship to stage of disease. Hum Reprod 13:1957–1961[Abstract/Free Full Text]
  44. Arici A, Seli E, Senturk LM, Gutierrez LS, Oral E, Taylor HS 1998 Interleukin-8 in the human endometrium. J Clin Endocrinol Metab 83:1783–1787[Abstract/Free Full Text]
  45. Mulac-Jericevik B, Mullinax RA, DeMayo, FJ, Lydon JP, Conneely OM 2000 Subgroup of reproductive functions of progesterone-mediated progesterone receptor-B isoform. Science 289:1751–1754[Abstract/Free Full Text]
  46. Roberts DK, Parmley TH, Walker NJ, Horbelt DV 1992 Ultrastructure of the microvasculature in the human endometrium throughout the normal menstrual cycle. Am J Obstet Gynecol 166:1393–1406[Medline]
  47. Ludwig H, Spornitz UM 1991 Microarchitecture of the endometrium by scanning electron microscopy: menstrual desquamination and remodeling. Ann NY Acad Sci 622:28–46[Abstract]
  48. Rodgers WH, Matrisian LM, Navree M, Giudice LC, Gorstein F, Osteen KG 1994 Patterns of matrix metalloproteinase expression in cycling endometrium imply differential functions and regulation by steroid hormones. J Clin Invest 94:946–953[Medline]
  49. Schatz F, Papp C, Aigner S, Krikun G, Hausknecht V, Lockwood CJ 1997 Biological mechanisms underlying the clinical effects of RU 486: modulation of cultured endometrial stromal cell stromelysin-1 and prolactin expression. J Clin Endocrinol Metab 82:188–193[Abstract/Free Full Text]
  50. Lockwood CJ, Krikun G, Hausknecht V, Papp C, Schatz F 1998 Matrix metalloproteinase and matrix metalloproteinase inhibitor expression in endometrial stromal cells during progestin-initiated decidualization and menstruation-related progestin withdrawal. Endocrinology 139:4607–4613[Abstract/Free Full Text]
  51. Salamonsen LA, Butt AR, Hammond FR, Garcia S, Zhang J 1997 Production of endometrial matrix metalloproteinases but not their tissue inhibitors is modulated by progesterone withdrawal in an in vitro model for menstruation. J Clin Endocrinol Metab 82:1409–1415[Abstract/Free Full Text]
  52. Lockwood CJ, Krikun G, Koo ABC, Kadner S, Schatz F 2002 Differential effects of thrombin and hypoxia on endometrial stromal and glandular epithelial cell vascular endothelial growth factor expression. J Clin Endocrinol Metab 87:4280–4286[Abstract/Free Full Text]
  53. Popovici RM, Irwin JC, Giaccia AJ, Giudice LC 1999 Hypoxia and cAMP stimulate vascular endothelial growth factor (VEGF) in human endometrial stromal cells: potential relevance to menstruation and endometrial regeneration. J Clin Endocrinol Metab 84:2245–2248[Abstract/Free Full Text]
  54. Sharkey AM, Day K, McPherson A, Malik S, Licence D, Smith SK, Charnock-Jones DS 2000 Vascular endothelial growth factor expression in human endometrium is regulated by hypoxia. J Clin Endocrinol Metab 85:402–409[Abstract/Free Full Text]
  55. Graubert MD, Asuncion Ortega M, Kessel B, Mortola JF, Iruela-Arispe ML 2001 Vascular repair after menstruation involves regulation of vascular endothelial growth factor-receptor phosphorylation by sFLT-1. Am J Pathol 158:1399–1410[Abstract/Free Full Text]
  56. Lau TM, Affandi B, Rogers PA 1999 The effects of levonorgestrel implants on vascular endothelial growth factor expression in the endometrium. Mol Hum Reprod 5:57–63[Abstract/Free Full Text]
  57. Lebovic DI, Schifren JL, Ryan IP, Mueller MD, Korn AP, Darney PD, Taylor RN 2000 Ovarian steroid and cytokine modulation of human endometrial angiogenesis. Hum Reprod 15(Suppl 3):67–77
  58. Charnock-Jones DS, Macpherson AM, Archer DF, Leslie S, Makkink WK, Sharkey AM, Smith SK 2000 The effects of progestins on vascular endothelial growth factor, oestrogen receptor, and progesterone receptor immunoreactivity and endothelial cell density in human endometrium. Hum Reprod 15(Suppl 3):85–95
  59. Ferrara N 1999 Molecular and biological properties of vascular endothelial growth factor. J Mol Med 77:527–543[CrossRef][Medline]
  60. Kohn S, Nagy JA, Dvorak HF, Dvorak AM 1992 Pathways of macromolecular tracer transport across venules and small veins. Structural basis for the hyperpermeability of tumor blood vessels. Lab Invest 67:596–607[Medline]
  61. Tsopananoglou NE, Maragoudakis ME 1999 On the mechanism of thrombin-induced angiogenesis: potentiation of vascular endothelial growth factor activity by up-regulation of its receptors. J Biol Chem 274:23969–23976[Abstract/Free Full Text]
  62. Rosen T, Schatz F, Kuczynski E, Lam H, Koo AB, Lockwood CJ 2002 Thrombin-enhanced matrix metalloproteinase-1 expression: a mechanism linking placental abruption with premature rupture of the membranes. J Matern Fetal Med 11:11–17



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
C. J. Lockwood, P. Toti, F. Arcuri, M. Paidas, L. Buchwalder, G. Krikun, and F. Schatz
Mechanisms of Abruption-Induced Premature Rupture of the Fetal Membranes: Thrombin-Enhanced Interleukin-8 Expression in Term Decidua
Am. J. Pathol., November 1, 2005; 167(5): 1443 - 1449.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. J. Lockwood, M. Paidas, G. Krikun, L. A. Koopman, R. Masch, E. Kuczynski, H. Kliman, R. N. Baergen, and F. Schatz
Inflammatory Cytokine and Thrombin Regulation of Interleukin-8 and Intercellular Adhesion Molecule-1 Expression in First Trimester Human Decidua
J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4710 - 4715.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. A. Pritts, I. P. Ryan, M. D. Mueller, D. I. Lebovic, J. L. Shifren, C. J. Zaloudek, A. P. Korn, P. D. Darney, and R. N. Taylor
Angiogenic Effects of Norplant Contraception on Endometrial Histology and Uterine Bleeding
J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2142 - 2147.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Harada, Y. Osuga, Y. Hirota, K. Koga, C. Morimoto, T. Hirata, O. Yoshino, O. Tsutsumi, T. Yano, and Y. Taketani
Mechanical Stretch Stimulates Interleukin-8 Production in Endometrial Stromal Cells: Possible Implications in Endometrium-Related Events
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1144 - 1148.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lockwood, C. J.
Right arrow Articles by Schatz, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lockwood, C. J.
Right arrow Articles by Schatz, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology