help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hoffstedt, J.
Right arrow Articles by Arner, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoffstedt, J.
Right arrow Articles by Arner, P.
The Journal of Clinical Endocrinology & Metabolism Vol. 89, No. 3 1391-1396
Copyright © 2004 by The Endocrine Society

Adipose Tissue Adiponectin Production and Adiponectin Serum Concentration in Human Obesity and Insulin Resistance

Johan Hoffstedt, Elisabet Arvidsson, Eva Sjölin, Kerstin Wåhlén and Peter Arner

Department of Medicine, Karolinska Institute, Huddinge University Hospital, 141 86 Stockholm, Sweden

Address all correspondence and requests for reprints to: Dr. Johan Hoffstedt, Department of Medicine, M61, Karolinska Institute, Huddinge University Hospital, 141 86 Stockholm, Sweden. E-mail: johan.hoffstedt{at}medhs.ki.se.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The role of adiponectin production for the circulating protein concentration in human obesity and insulin resistance is unclear. We measured serum concentration and sc adipose tissue secretion rate of adiponectin in 77 obese and 23 nonobese women with a varying degree of insulin sensitivity. The serum adiponectin concentration was similar in both groups. In obesity, adiponectin adipose tissue secretion rate per weight unit was reduced by 30% (P = 0.01), whereas total body fat secretion rate was increased by 100% (P < 0.0001). In the group being most insulin resistant (1/3), serum concentration (P < 0.001) and adipose tissue secretion rate per tissue weight (P < 0.05) were reduced, whereas total body fat secretion rate was increased (P < 0.01), by about 30%. The adipose tissue secretion rate of adiponectin was related to the serum concentration (P = 0.005) but explained only about 10% of the interindividual variation in circulating adiponectin and insulin sensitivity. The plasma adiponectin half life was long, 2.5 h. In conclusion, the role of protein secretion for the circulating concentration of adiponectin and insulin sensitivity under these conditions is minor because adiponectin turnover rate is slow. Although increased in obesity and insulin resistance, total body production of adiponectin is insufficient to raise the circulating concentration, may be due to reduced secretion rate per tissue unit.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
ADIPOSE TISSUE SECRETES several proteins that have various autocrine/paracrine or endocrine functions, including body weight regulation and glucose/lipid homeostasis. One protein is adiponectin, which is produced exclusively in adipose tissue and circulates in blood at high concentrations (1, 2). Studies in rodents suggest a role for adiponectin in insulin resistance. When injected, adiponectin accelerates the oxidation of nonesterified fatty acids, which is accompanied by decreased plasma levels of glucose (3). Long-term (12-d) administration of adiponectin decreases triglyceride storage in liver and muscle, improves hyperglycemia, and decreases plasma triglyceride and free fatty acid concentrations (4). In mouse hepatocytes, adiponectin improves the suppression of gluconeogenesis by insulin (5). Moreover, adiponectin-deficient mice show insulin resistance and neointimal formation (6). Two putative receptors for adiponectin have recently been detected; one is predominantly expressed in skeletal muscle, and the other one is expressed mainly in liver (7).

Some clinical studies on the regulation of adiponectin have been performed. Reduced serum levels of adiponectin in obese compared with nonobese subjects and negative correlations between adiponectin and body mass index (BMI) have been reported (8, 9, 10, 11). However, the relationship between BMI and circulating adiponectin becomes statistically insignificant if factors related to insulin sensitivity are taken into account (12, 13), suggesting that obesity per se does not influence serum adiponectin concentrations. Furthermore, serum concentrations of adiponectin have been found to be inversely correlated with insulin sensitivity in both nonobese (12, 13) and obese (9, 14, 15) subjects as well as in patients with type 2 diabetes mellitus (10, 14).

Very little is known about the secretion of adiponectin from adipose tissue and its role in the regulation of the amount of circulating adiponectin. Motoshima et al. (16) investigated adiponectin secretion from human fat cells, but no measurement of circulating adiponectin was performed. In the present study we have investigated the sc adipose tissue secretion rate, adipose mRNA expression, and serum concentrations of adiponectin in a large study population with a wide range of insulin sensitivity and consisting of both nonobese and massively obese women. We addressed the following as yet unanswered question: How important is adipose secretion of adiponectin for the corresponding serum concentration of the protein in obesity and insulin resistance?


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The study group consisted of 77 obese and 23 nonobese subjects recruited by local advertising. Their age was 20–50 yr. Obesity was defined according to the WHO criterion (BMI, >30 kg/m2). All subjects were apparently healthy and did not take any regular medication. None had a history of alcohol overconsumtion. None of the women was postmenopausal, completely sedentary, or involved in athletics. All subjects were examined in the morning (at ~0800 h) after an overnight fast. The examination was made in the middle of the menstruation cyclic according to self report. Height and weight were measured, and body fat (percentage) was determined by bioimpedance (model TBF 305, Tanika, Japan). A venous blood sample was obtained for the measurement of plasma levels of glucose and insulin at the hospital’s routine chemistry laboratory. In addition, serum levels of adiponectin were measured using an RIA method (Linco Research, Inc., St. Charles, MO) and were expressed as micrograms per milliliter. The homeostasis model assessment (HOMA) model was used to calculate in vivo insulin sensitivity according to the formula: fasting plasma glucose (mM) x fasting plasma insulin (mU/liter) x 22.5-1 (17). Finally, a sc fat biopsy (1–2 g) was obtained from the umbilical region under local anesthesia. The adipose tissue was cut into small pieces (10–25 mg) and then incubated at 37 C (3.0 ml medium/300 mg tissue) in a medium consisting of sterile Krebs-Ringer phosphate buffer (pH 7.4), endotoxin-free BSA (4 g/100 ml), and glucose (1 mg/ml), with air as the gas phase. After a 2-h incubation, a 1-ml aliquot of medium was removed and stored at -70 C for subsequent analysis of adiponectin using the RIA described above, and the incubated adipose tissue was removed for organic extraction and determination of its total lipid content (18). In methodological experiments, pieces of adipose tissue from three subjects were incubated as described above for various periods of time (60 min to 3 h). The release of adiponectin was linear with incubation time for at least 2 h, as shown in Fig. 1Go. Adiponectin release is expressed as nanograms per gram of lipid per 2 h.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1. Methodological experiment showing adipose tissue secretion of adiponectin from three subjects analyzed by simple regression analysis.

 
In a subgroup of the subjects, a 300-mg piece of adipose tissue was immediately stored at -70 C for subsequent analysis of adiponectin mRNA. Adipose tissue total RNA was extracted using the RNeasy total RNA kit (Qiagen, Hilden, Germany). The concentrations of RNA were determined spectrophotometrically at 260 nm. The absorption ratios at 260–280 nm were between 1.7–1.9. The RNA samples were stored at -70 C for subsequent cDNA synthesis from total adipose tissue RNA. The levels of adiponectin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA were measured twice in triplicate using a real-time PCR (iCycler, Bio-Rad, Hercules, CA). The primers used for adiponectin were GGTCTCGAA CTCCTGGCCTA (sense) and TGAGATATCGACTGGGCATGGT (antisense), and those used for the reference gene GAPDH were CACATGGCCTCCAAGGAGTAAG (sense) and CCAGCAGTGAGGGTCTCTCT (antisense). The length of the PCR amplicons was 94 bp for adiponectin and 82 bp for GAPDH. Adiponectin mRNA values were expressed as ratios of adiponectin/GAPDH mRNA, assuming that GAPDH is a housekeeping gene that is not regulated by factors such as obesity and insulin sensitivity. We chose GAPDH because it is constitutively expressed in various tissues and has been used widely as an internal RNA control for Northern blotting, ribonuclease protection, and RT-PCR.

Values are given as the mean ± SEM. Unpaired t test, ANOVA, Fisher’s test (for post hoc analysis of ANOVA data), and simple regression analysis were used for statistical comparisons. Values for plasma insulin and HOMA index were not normally distributed and therefore were logarithmically transformed before comparisons. Standard computer software was used for the statistical analysis.

The study was approved by the ethics committee of Huddinge University Hospital. All women gave informed consent to participate.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The clinical data of the obese and nonobese subjects are shown in Table 1Go. The study groups were of similar age. However, as expected, the obese subjects showed higher levels of BMI, percent body fat, plasma values of insulin and glucose, as well as HOMA index. In Fig. 2Go, serum levels and adipose tissue secretion levels of adiponectin are demonstrated. No difference in serum adiponectin concentration between obese and nonobese subjects was found (14.0 ± 0.8 vs. 13.1 ± 0.9 µg/ml; P = 0.55). In contrast, the sc adipose secretion rate of adiponectin was reduced in obese compared with nonobese subjects (309 ± 13 vs. 382 ± 28 ng/g lipid·2 h; P = 0.009).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Clinical data in nonobese and obese women

 


View larger version (10K):
[in this window]
[in a new window]
 
FIG. 2. Serum concentration and adipose tissue secretion rate of adiponectin in nonobese and obese subjects. Values are the mean ± SE, and data were compared by t test.

 
To investigate the influence of insulin sensitivity on serum concentrations and adipose secretion rate of adiponectin, all subjects were grouped together, and the whole cohort was divided into tertiles according to the HOMA index. As seen in Table 2Go, except for age, all clinical parameters analyzed were different between the subgroups. Furthermore, as shown in Fig. 3Go, both the serum concentration and the adipose tissue secretion rate of adiponectin were influenced by insulin sensitivity. With respect to serum adiponectin, the concentrations were 16.7 ± 1.3, 14.6 ± 1.1, and 10.4 ± 0.9 in the high (H), intermediate (I), and low (L) insulin sensitivity subgroups, respectively (by ANOVA: P < 0.001; by post hoc analysis: H vs. I, P = 0.18; H vs. L, P = 0.0001; I vs. L, P = 0.008). For adipose secretion, the corresponding rates were 365 ± 24 (H), 313 ± 19 (I), and 294 ± 16 (L) in the three subgroups, respectively (by ANOVA: P < 0.037; by post hoc analysis: H vs. I, P = 0.07; H vs. L, P = 0.01; I vs. L, P = 0.50). After dividing the HOMA index into quartiles, there was still a significant difference between the groups for both serum levels (P = 0.0001, by ANOVA) and adipose secretion levels (P = 0.01, by ANOVA). In simple regression analysis, both adiponectin serum levels (r = -0.37; P = 0.0002; adjusted r2 = 0.13) and adipose secretion rate (r = -0.30; P = 0.0026; adjusted r2 = 0.08) were correlated with the HOMA index.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Clinical data according to HOMA insulin sensitivity

 


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 3. Serum concentration and adipose tissue secretion rate of adiponectin in women with different levels of insulin sensitivity. Values are the mean ± SE, and data were compared by ANOVA.

 
The influence of sc adipose tissue secretion rate on serum concentrations of adiponectin was investigated by simple regression analysis in all subjects as well as in the various subgroups of insulin sensitivity (Table 3Go). In the whole study group, a significant correlation between serum levels and adipose secretion rates was found. The adjusted r2 for this relationship was 0.08 (P < 0.01). However, with respect to insulin sensitivity, serum concentrations and secretion rates of adiponectin were correlated (P < 0.05) in the H subgroup only; the adjusted r2 was 0.16 (Fig. 4Go).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Correlations (according to regression analysis) between serum levels and adipose tissue secretion rate of adiponectin in all subjects and in subgroups of different levels of insulin sensitivity

 


View larger version (14K):
[in this window]
[in a new window]
 
FIG. 4. Linear regression analysis of adipose tissue secretion rate vs. serum concentration of adiponectin in women with low (left graph) and high (right graph) insulin sensitivity.

 
We made an approximate estimate of adiponectin turnover in the nonobese group using the methods described for leptin (19). The calculation was based on the following assumptions: 1) the lipid content of adipose tissue is 0.8 times the tissue weight; 2) abdominal sc adipose tissue production rate of adiponectin is representative for all adipose depots in nonobese women (data in Ref. 16 show 30% differences in secretion rates between the visceral and the sc depots, but in women, the visceral fat depot is only a minor component of total fat, whereas the sc area is by far the largest region); 3) in vitro secretion rates of adiponectin are about the same as in vivo secretion rates; and 4) adiponectin concentrations in plasma and serum are almost identical. The total adiponectin production rate (nanograms per kilogram of total fat mass per hour) was: 382 x (mean in vitro production rate) x 0.32 (mean body fat fraction) x 66,000 (mean body weight in g) ÷ 0.8 (tissue lipid fraction) ÷ 2 (incubation time) = 5,042,400. The total plasma pool of adiponectin (nanograms) is 66 x 37 (plasma pool size) x 13,100 (serum adiponectin concentration) = 31,990,200. The plasma adiponectin fractional turnover (k) is 5,042,400 ÷ 31,990,200 = 0.158. The plasma adiponectin half-life is ln 2/k = 2.5 h.

Total body fat production rate of adiponectin (ng·kg total fat mass·h-1) was also investigated in relation to obesity and insulin resistance. It was found that total body fat production of adiponectin was about twice as high in obese women (9.1 ± 0.5 mg) as compared to nonobese women (4.2 ± 0.4 mg) (P < 0.0001). In relation to insulin sensitivity, the values of adiponectin total body fat production were 6.2 ± 0.7 (high), 8.9 ± 0.7 (intermediate), and 9.1 ± 0.7 (low) in the three groups of insulin sensitivity (P = 0.007). In simple regression analysis, adiponectin body fat production correlated with insulin sensitivity as measured by HOMA-index (r = 0.31, P = 0.002, adjusted r2 = 0.09).

Finally, adipose tissue mRNA adiponectin in relation to the amount of GAPDH was measured in 18 subjects. They were selected from each of the HOMA tertiles; six obese subjects with low HOMA index, six obese subjects with high HOMA index, and six nonobese subjects with low HOMA index. All subjects were selected at random. As shown in Fig. 5Go, the relative amount of adiponectin mRNA (i.e. adiponectin/GAPDH) was lower in obese subjects with both low (8.5 ± 1.2) and high (8.1 ± 1.6) HOMA index than in nonobese subjects (16.3 ± 2.7; P = 0.01, by ANOVA). However, there was no difference between subjects with high compared with low HOMA index (8.1 ± 1.6 vs. 12.4 ± 1.8; P = 0.15, bypost hoc analysis).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 5. Adiponectin mRNA in relation to GAPDH mRNA in adipose tissue from six nonobese women with high insulin sensitivity, six obese women with high insulin sensitivity, and six obese women with low insulin sensitivity. Values are the mean ± SE, and data were compared by ANOVA.

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
This large study was designed to evaluate the influence of obesity and insulin sensitivity on the production of adiponectin in sc adipose tissue and the role of adiponectin secretion for the serum concentrations of the protein. Because gender might be a confounding factor, we only studied women. In obesity, a reduced adipose secretion rate, but no change in serum concentrations of adiponectin, was found. In contrast, insulin-resistant subjects had lower values of both adipose secretion rate and serum concentrations of adiponectin than did subjects with high insulin sensitivity. At first glance, the results with adiponectin in obesity seem at odds with previous findings of reduced plasma concentrations of adiponectin in this condition (8, 9). However, it has also been shown that the level of insulin sensitivity has a major impact on adiponectin levels in man (9, 12, 13) and that the degree of hypoadiponectemia in obesity is related to insulin resistance, rather than to body fat content (12, 13, 14).

It has previously been shown that both obesity (20) and type 2 diabetes (21) are associated with reduced mRNA expression of adiponectin in human adipose tissue. The present study confirms that adiponectin adipose tissue mRNA is lower in obese than in nonobese subject. In contrast, there was no additive effect of insulin sensitivity on gene expression, which suggests that both transcriptional and posttranscriptional mechanisms are determinants of adiponectin adipose secretion in obese or insulin-resistant humans.

The present findings deviate from those in the study by Motoshima et al. (16), who found that human omental, but not sc, adipose tissue secretion of adiponectin was negatively correlated to BMI. However, the difference may be more apparent than real. First, the previous study sample was relatively small, and only three subjects had BMI below 30 kg/m2. Second, and more important, is that the earlier study used isolated fat cells that had been cultured for 12–24 h, whereas we used freshly isolated intact tissue pieces. Therefore, environmental or stromal factors, which could disappear during culture of isolated cells, could explain the differences in results.

To date it has not been known how important adipose tissue secretion of adiponectin is for regulating the circulating concentration of the protein. This is a relevant question because recent findings suggest that adiponectin is a true hormone acting through specific receptors in insulin target tissues, such as skeletal muscle and liver (7). To clarify this issue we made attempts to calculate adiponectin turnover in vivo. It should be stressed that turnover data are approximate, because they rely on several assumptions, such as the idea that regional variations in hormone secretion are relatively small (16) and in vitro secretion rates are similar to in vivo secretion rates. Nevertheless, the turnover rate seems very slow, because the plasma half-life is about 2.5 h. Most polypeptide hormones, including leptin, have plasma half-lives between 15 and 30 min (19, 22). This suggests that the rate of turnover of adiponectin is 5–10 times slower than that for most polypeptide hormones. As the rate of production also is slow, it is likely that the production rate of the hormone is not the major regulating factor for the high circulating hormone concentration. This theory is further supported by our findings of a rather weak (but significant) relationship between the secretion of adiponectin and the serum adiponectin level. The production rate could explain 8–16% of the interindividual variation in serum adiponectin if all or only the most insulin-sensitive women were investigated. Although the reason for the low level of correlation is unknown, it may be that factors other than adipose secretion, such as turnover and degradation, regulate serum concentrations of adiponectin. This assumption is based on studies of sc adipose tissue. By multiple regression analysis, it was recently reported that intraabdominal, but not sc, fat mass was related to adiponectin plasma concentrations, in addition to age and sex (13). However, sc adipose tissue is by far the most abundant fat depot in women. According to previous findings the in vitro rate of adiponectin secretion is about 30% higher in visceral than in sc adipose tissue (16). Despite this finding, the visceral fat depot is very small in comparison with the visceral depot (in particular in women). Therefore, the rate of adiponectin production is too slow to be the major regulator of the very large circulating pool of the hormone, even if an "extra 30%" production from visceral fat is considered.

It is not likely that diurnal variations in adiponectin turnover have influenced the results in an important way. The serum adiponectin concentration is highest in the morning, when our subjects were investigated, and lowest during the night, but the difference between these concentrations is small (~20%) (23). To study the total body fat production of adiponectin, it is necessary to express the secretion rate in relation to cell lipid content. We cannot exclude that the use of a different denominator, e.g. cell number or protein content, could have influenced the results.

It is of interest to observe that the estimated total body adiponectin production in obese women was two times higher than in nonobese women, whereas the circulating levels of the protein were similar in the two groups. Furthermore, insulin-resistant subjects had increased total body production of adiponectin despite decreased serum concentrations of the hormone. However, per weight unit of adipose tissue adiponectin production was decreased in obese, as well as in insulin-resistant, subjects. Taken together, these findings suggest an ineffective regulation of adiponectin in these conditions. It appears that upon body fat accumulation and insulin resistance development, there is not enough production of adiponectin to rise the circulating hormone level.

In conclusion, this study shows that adiponectin secretion from sc adipose tissue is reduced in obesity and insulin resistance when expressed per tissue weight, whereas total body fat production rate is increased. Moreover, sc adipose tissue secretion plays only a minor role in variations in circulating concentrations of adiponectin, probably because the turnover rate of the protein is slow in man.


    Acknowledgments
 
The skillful technical assistance of research nurses Britt-Marie Leijonhufvud and Katarina Hertel is greatly acknowledged.


    Footnotes
 
This work was supported by grants from the Swedish Research Council, the Swedish Diabetes Foundation, the Swedish Heart and Lung Association, the Novo Nordic Foundation, the Swedish Medical Society, and the Foundations of Thuring, Bergwall and Wiberg.

Abbreviations: BMI, Body mass index; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; H, high insulin sensitivity subgroup; HOMA, homeostasis model assessment; I, intermediate insulin sensitivity subgroup; L, low insulin sensitivity subgroup.

Received August 21, 2003.

Accepted December 11, 2003.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF 1995 A novel serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 270:26746–26749[Abstract/Free Full Text]
  2. Maeda K, Okubo K, Shimomura I, Funahashi T, Matsuzawa Y, Matsubara K 1996 cDNA cloning and expression of a novel adipose specific collagen-like factor, apM1 (AdiPose Most abundant Gene transcript 1). Biochem Biophys Res Commun 221:286–289[CrossRef][Medline]
  3. Fruebis J, Tsao TS, Javorschi S Ebbets-Reed D, Erickson MR, Yen FT, Bihain BE, Lodish HF 2001 Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci USA 98:2005–2010[Abstract/Free Full Text]
  4. Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, Mori Y, Ide T, Murakami K, Tsuboyama-Kasaoka N, Ezaki O, Akanuma Y, Gavrilova O, Vinson C, Reitman ML, Kagechika H, Shudo K, Yoda M, Nakano Y, Tobe K, Nagai R, Kimura S, Tomita M, Froguel P, Kadowaki T 2001 The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med 7:941–946[CrossRef][Medline]
  5. Berg AH, Combs TP, Du X, Brownlee M, Scherer PE 2001 The adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat Med 7:947–953[CrossRef][Medline]
  6. Kubota N, Terauchi Y, Yamauchi T, Kubota T, Moroi M, Matsui J, Eto K, Yamashita T, Kamon J, Satoh H, Yano W, Froguel P, Nagai R, Kimura S, Kadowaki T, Noda T 2002 Disruption of adiponectin causes insulin resistance and neointimal formation. J Biol Chem 277:25863–25866[Abstract/Free Full Text]
  7. Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M, Murakami K, Ohteki T, Uchida S, Takekawa S, Waki H, Tsuno NH, Shibata Y, Terauchi Y, Froguel P, Tobe K, Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, Kadowaki T 2003 Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423:762–769[CrossRef][Medline]
  8. Arita Y, Kihara S, Ouchi N, Takahashi M, Maeda K, Miyagawa J, Hotta K, Shimomura I, Nakamura T, Miyaoka K, Kuriyama H, Nishida M, Yamashita S, Okubo K, Matsubara K, Muraguchi M, Ohmoto Y, Funahashi T, Matsuzawa Y 1999 Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun 257:79–83[CrossRef][Medline]
  9. Orio Jr F, Palomba S, Cascella T, Milan G, Mioni R, Pagano C, Zullo F, Colao A, Lombardi G, Vettor R 2003 Adiponectin levels in women with polycystic ovary syndrome. J Clin Endocrinol Metab 88:2619–2623[Abstract/Free Full Text]
  10. Hotta K, Funahashi T, Arita Y, Takahashi M, Matsuda M, Okamoto Y, Iwahashi H, Kuriyama H, Ouchi N, Maeda K, Nishida M, Kihara S, Sakai N, Nakajima T, Hasegawa K, Muraguchi M, Ohmoto Y, Nakamura T, Yamashita S, Hanafusa T, Matsuzawa Y 2000 Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb Vasc Biol 20:1595–1599[Abstract/Free Full Text]
  11. Staiger H, Tschritter O, Machann J, Thamer C, Fritsche A, Maerker E, Schick F, Haring HU, Stumvoll M 2003 Relationship of serum adiponectin and leptin concentrations with body fat distribution in humans. Obes Res 11:368–372[Medline]
  12. Pellme F, Smith U, Funahashi T, Matsuzawa Y, Brekke H, Wiklund O, Taskinen MR, Jansson PA 2003 Circulating adiponectin levels are reduced in nonobese but insulin-resistant first-degree relatives of type 2 diabetic patients. Diabetes 52:1182–1186[Abstract/Free Full Text]
  13. Cnop M, Havel PJ, Utzschneider KM 2003 Relationship of adiponectin to body fat distribution, insulin sensitivity and plasma lipoproteins: evidence for independent roles of age and sex. Diabetologia 46:459–469[Medline]
  14. Weyer C, Funahashi T, Tanaka S, Hotta K, Matsuzawa Y, Pratley RE, Tataranni PA 2001 Hypoadiponectinemia in obesity and type 2 diabetes: close association with insulin resistance and hyperinsulinemia. J Clin Endocrinol Metab 86:1930–1935[Abstract/Free Full Text]
  15. Kern PA, Di Gregorio GB, Lu T, Rassouli N, Ranganathan G 2003 Adiponectin expression from human adipose tissue: relation to obesity, insulin resistance, and tumor necrosis factor-{alpha} expression. Diabetes 52:1779–1785[Abstract/Free Full Text]
  16. Motoshima H, Wu X, Sinha MK, Hardy VE, Rosato EL, Barbot DJ, Rosato FE, Goldstein BJ 2002 Differential regulation of adiponectin secretion from cultured human omental and subcutaneous adipocytes: effects of insulin and rosiglitazone. J Clin Endocrinol Metab 87:5662–5667[Abstract/Free Full Text]
  17. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC 1985 Homeostasis model assessment: insulin resistance and ß-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28:412–419[CrossRef][Medline]
  18. Arner P, Östman J 1974 Mono-acid diacylglycerols in human adipose tissue. Biochim Biophys Acta 369:209–221[Medline]
  19. Klein S, Coppack SW, Mohamed-Ali V, Landt M 1996 Adipose tissue leptin production and plasma leptin kinetics in humans. Diabetes 45:984–987[Abstract]
  20. Hu E, Liang P, Spiegelman BM 1996 AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem 271:10697–10703[Abstract/Free Full Text]
  21. Statnick MA, Beavers LS, Conner LJ 2000 Decreased expression of apM1 in omental and subcutaneous adipose tissue of humans with type 2 diabetes. Int J Exp Diabetes Res 1:81–88[Medline]
  22. Bennett HP, McMartin C 1978 Peptide hormones and their analogues: distribution, clearance from the circulation, and inactivation in vivo. Pharmacol Rev 30:247–292[Medline]
  23. Gavrila A, Peng CK, Chan JL, Mietus JE, Goldberger AL, Mantzoros CS 2003 Diurnal and ultradian dynamics of serum adiponectin in healthy men: comparison with leptin, circulating soluble leptin receptor, and cortisol patterns. J Clin Endocrinol Metab 88:2838–2843[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
Z. Kovacova, M. Vitkova, M. Kovacikova, E. Klimcakova, M. Bajzova, Z. Hnevkovska, L. Rossmeislova, V. Stich, D. Langin, and J. Polak
Secretion of adiponectin multimeric complexes from adipose tissue explants is not modified by very low calorie diet
Eur. J. Endocrinol., April 1, 2009; 160(4): 585 - 592.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. P. Plaisance, M. Lukasova, S. Offermanns, Y. Zhang, G. Cao, and R. L. Judd
Niacin stimulates adiponectin secretion through the GPR109A receptor
Am J Physiol Endocrinol Metab, March 1, 2009; 296(3): E549 - E558.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Arner, B. M. Stenson, E. Dungner, E. Naslund, J. Hoffstedt, M. Ryden, and I. Dahlman
Expression of Six Transmembrane Protein of Prostate 2 in Human Adipose Tissue Associates with Adiposity and Insulin Resistance
J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2249 - 2254.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. Sir-Petermann, M. Maliqueo, E. Codner, B. Echiburu, N. Crisosto, V. Perez, F. Perez-Bravo, and F. Cassorla
Early Metabolic Derangements in Daughters of Women with Polycystic Ovary Syndrome
J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4637 - 4642.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
D. Barb, C. J Williams, A. K Neuwirth, and C. S Mantzoros
Adiponectin in relation to malignancies: a review of existing basic research and clinical evidence
Am. J. Clinical Nutrition, September 1, 2007; 86(3): 858S - 866S.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. del Mar Grasa, M. Serrano, J. A. Fernandez-Lopez, and M. Alemany
Corticosterone Inhibits the Lipid-Mobilizing Effects of Oleoyl-Estrone in Adrenalectomized Rats
Endocrinology, August 1, 2007; 148(8): 4056 - 4063.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. T. Lely, J. A. Krikken, S. J. L. Bakker, F. Boomsma, R. P. F. Dullaart, B. H. R. Wolffenbuttel, and G. Navis
Low Dietary Sodium and Exogenous Angiotensin II Infusion Decrease Plasma Adiponectin Concentrations in Healthy Men
J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1821 - 1826.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. Skurk, C. Alberti-Huber, C. Herder, and H. Hauner
Relationship between Adipocyte Size and Adipokine Expression and Secretion
J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 1023 - 1033.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Dimitriadis, P. Mitrou, V. Lambadiari, E. Boutati, E. Maratou, D. B. Panagiotakos, E. Koukkou, M. Tzanela, N. Thalassinos, and S. A. Raptis
Insulin Action in Adipose Tissue and Muscle in Hypothyroidism
J. Clin. Endocrinol. Metab., December 1, 2006; 91(12): 4930 - 4937.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
G. Mazzali, V. Di Francesco, E. Zoico, F. Fantin, G. Zamboni, C. Benati, V. Bambara, M. Negri, O. Bosello, and M. Zamboni
Interrelations between fat distribution, muscle lipid content, adipocytokines, and insulin resistance: effect of moderate weight loss in older women.
Am. J. Clinical Nutrition, November 1, 2006; 84(5): 1193 - 1199.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Dimitriadis, P. Mitrou, V. Lambadiari, E. Boutati, E. Maratou, E. Koukkou, M. Tzanela, N. Thalassinos, and S. A. Raptis
Glucose and Lipid Fluxes in the Adipose Tissue after Meal Ingestion in Hyperthyroidism
J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 1112 - 1118.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
M. Sumiyoshi, M. Sakanaka, and Y. Kimura
Chronic Intake of High-Fat and High-Sucrose Diets Differentially Affects Glucose Intolerance in Mice
J. Nutr., March 1, 2006; 136(3): 582 - 587.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. F. Butte, A. G. Comuzzie, G. Cai, S. A. Cole, N. R. Mehta, and C. A. Bacino
Genetic and Environmental Factors Influencing Fasting Serum Adiponectin in Hispanic Children
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4170 - 4176.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
E. A. Nordstrom, M. Ryden, E. C. Backlund, I. Dahlman, M. Kaaman, L. Blomqvist, B. Cannon, J. Nedergaard, and P. Arner
A Human-Specific Role of Cell Death-Inducing DFFA (DNA Fragmentation Factor-{alpha})-Like Effector A (CIDEA) in Adipocyte Lipolysis and Obesity
Diabetes, June 1, 2005; 54(6): 1726 - 1734.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
J.-M. Fernandez-Real, J. Vendrell, and W. Ricart
Circulating Adiponectin and Plasma Fatty Acid Profile
Clin. Chem., March 1, 2005; 51(3): 603 - 609.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hoffstedt, J.
Right arrow Articles by Arner, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoffstedt, J.
Right arrow Articles by Arner, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals