This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Xing, M. Articles by Sidransky, D. Search for Related Content PubMed PubMed Citation Articles by Xing, M. Articles by Sidransky, D.

BRAF T1796A Transversion Mutation in Various Thyroid Neoplasms

Division of Endocrinology and Metabolism, Departments of Medicine (M.X., P.W.L.) and Otolaryngology-Head and Neck Surgery (G.W., D.S.), the Johns Hopkins University School of Medicine, Baltimore, Maryland 21205; Hospital for Endocrine Surgery (A.L.), Kiev, 252000 Ukraine; Departments of Pathology (G.T.) and Surgery (R.U.), Yale University School of Medicine, New Haven, Connecticut 06520; Washington Hospital Center and Medstar Research Institute (V.V., M.D.R.), Washington, DC 20010; and Division of Endocrinology and Metabolism, The Ohio State University (M.D.R.), Columbus, Ohio 43235

Address all correspondence and requests for reprints to: Mingzhao Xing, M.D., Ph.D., Division of Endocrinology and Metabolism, Johns Hopkins University School of Medicine, 1830 East Monument Street, Suite 333, Baltimore, Maryland 21287. E-mail: mxing1{at}jhmi.edu.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
A high prevalence of activating mutation of the B type Raf kinase (BRAF) gene was recently reported in papillary thyroid cancer (PTC). However, the frequency of this mutation in several other types of thyroid neoplasms was not thoroughly investigated. In the present study, in addition to PTC, we evaluated various thyroid tumor types for the most common BRAF T1796A mutation by direct genomic DNA sequencing. We found a high and similar frequency (45%) of the BRAF T1796A mutation in two geographically distinct PTC patient populations: one composed of sporadic cases from North America, and the other from Kiev, Ukraine, that included individuals who were exposed to the Chernobyl nuclear accident. In contrast, we found BRAF mutation in only 20% of anaplastic thyroid cancers and no mutation in medullary thyroid cancers and benign thyroid hyperplasia. We also confirmed previous reports that the BRAF T1796A mutation did not occur in benign thyroid adenomas and follicular thyroid cancers. Specific analysis of the Ukraine patients with confirmed history of radiation exposure failed to show a higher incidence of BRAF mutation. Our results suggest that frequent occurrence of BRAF mutation is inherently associated with PTC, irrespective of geographic origin, and is apparently not a radiation-susceptible mutation. The lack or low prevalence of BRAF mutation in other thyroid neoplasms is consistent with the notion that other previously defined genetic alterations on the same signaling pathway are sufficient to cause tumorigenesis in most thyroid neoplasms.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
THYROID TUMORS REPRESENT the most common benign and malignant endocrine neoplasms. Thyroid carcinomas are histologically classified as papillary thyroid cancer (PTC), follicular thyroid cancer (FTC), anaplastic thyroid cancer (ATC), and medullary thyroid cancer (MTC), accounting for approximately 80, 15, 2, and 4% of all thyroid malignancies, respectively (1). PTC, FTC, and ATC are derived from follicular thyroid epithelial cells, whereas MTC is derived from calcitonin-secreting parafollicullar C cells.

Abnormal genetic alterations have been shown to play an important role in thyroid tumorigenesis. Over the past two decades, several genetic alterations have been identified in various thyroid neoplasms. RET/PTC rearrangement was among the earliest discovered oncogenic alterations, primarily associated with PTC (2, 3), with the highest incidence in ionizing radiation-induced PTC, such as those that occurred in victims of the Chernobyl nuclear accident (4, 5, 6). Ras mutation occurred frequently in FTC and follicular adenomas and less frequently in PTC (7, 8, 9, 10). The PAX8-PPAR fusion oncogene was initially described in FTC (11) and recently was also found in follicular thyroid adenomas (10). Mutations of the tumor suppressor gene p53 were found mainly in ATC and are believed to be an important mechanism for the aggressiveness of this rare type of thyroid cancer (12, 13). RET mutation is primarily responsible for familial MTC (14) and some of the sporadic MTC (15).

Activating mutation in the BRAF gene has recently been added to these previously described genetic alterations in PTC (16, 17, 18, 19). Raf kinase is a key component of the Ras Raf MEK MAP/ERK signaling pathway involved in cell growth and proliferation and, when altered, in tumorigenesis (20). Among the several characterized mammalian Raf kinases, the B type Raf, or BRAF, is the strongest activator of this signaling pathway (21). Its gene is located on chromosome 7 (22). BRAF mutations were found in various types of cancers, with the highest prevalence in melanoma (66%) (23). One recent study reported an even higher prevalence of this mutation in benign premelanoma nevi lesions (24). There are two "hot spots," in exons 11 and 15, respectively, that harbor almost all the BRAF mutations identified so far. The most frequent mutation is a T1796A transversion point mutation in exon 15, accounting for 92% of the BRAF mutations in melanomas (23). This mutation causes a V599E amino acid missense mutation, resulting in constitutive and oncogenic activation of the BRAF kinase (23). A high prevalence of T1979A mutation was also recently found in PTC, present in 69% of PTC in one series (17) and 36–45% in other series (16, 18, 19). No mutations have been found in exon 11 in PTC (17). The T1979A mutation is not present in FTC and benign thyroid adenomas (16, 17, 18, 19) and is apparently an alternative genetic event to RET/PTC rearrangements in PTC (16, 18). However, it is not known whether BRAF mutation also plays a role in the tumorigenesis of other types of thyroid neoplasms, such as ATC, benign hyperplasia, and MTC. It is also not known whether BRAF mutations, like RET-PTC rearrangements (4, 5, 6), also occur more often with radiation exposure. In the current study, unlike PTC, we found a lower prevalence of this mutation in ATC and absence of mutation in MTC and benign hyperplasia. Furthermore, a comparably high prevalence of BRAF mutation was found in two geographically distinct PTC patient populations, including one that includes individuals with a history of radiation exposure.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Human thyroid tissues and cell lines

Human thyroid tissues were obtained from fresh surgical samples or paraffin-embedded blocks as described previously (25). This study was approved by the Joint Committee on Clinical Investigation at the Johns Hopkins School of Medicine. Human surgical thyroid tissues were provided by Dr. G. Tallini (Yale University, New Haven, CT) and Dr. M. Ringel (Washington Hospital Center, Washington, DC); the tumor samples provided by Dr. V. Vasko (Hospital for Endocrine Surgery, Kiev, Ukraine) were approved by the local institutional review boards or ethics committees. The pathological diagnoses of all the tumors, including the BRAF mutation-positive tumors, were all made on the basis of classical features of the tumor based on standard criteria. Patients in the second series were from the Kiev area in Ukraine, including individuals who were exposed during the Chernobyl nuclear accident. Specifically, of the 49 samples from Ukraine, 20 individuals were exposed to radiation; 15 were adults, and five were children at the time of exposure. The age range of the children was 5–13 yr at the time of the nuclear accident (mean, 8.6 yr), and all of these children had PTC. The mean latency period between the Chernobyl accident and surgery was 13 yr for the children. Of the 15 adults with radiation exposure, the ages at the time of the incident ranged from 21–50 yr (mean, 33.4 yr). The mean latency period between the Chernobyl accident and the surgery was 13.9 yr for these adults. Of these 15 patients, five had PTC, one had FTC, and the remaining nine patients had follicular adenomas.

The source and culture of human ATC cell lines ARO-82-1, DRO-90-1, and C643 were described previously (25).

Genomic DNA isolation from thyroid tissues and cell lines

Thyroid tissues were microdissected as described previously (25). Microdissected specimens from paraffin-embedded blocks were additionally subjected to treatment with xylene for 8 h at 48 C to remove the paraffin. All the samples were subjected to digestion with 1% sodium dodecyl sulfate and 0.5 mg/ml proteinase K at 48 C for 48 h, with a midinterval addition of a spiking dose of concentrated proteinase K. DNA was subsequently isolated from the digested tissues by phenol-chloroform extraction and ethanol precipitation as described previously (25). Cell line DNA was similarly isolated by digestion with sodium dodecyl sulfate-proteinase K, followed by phenol-chloroform extraction and ethanol precipitation.

Amplification of genomic DNA and detection of BRAF mutation

BRAF gene mutation was detected by direct genomic DNA sequencing analysis. Because the T1796A mutation in exon 15 of BRAF gene is the BRAF mutation present in PTC and no mutations have been found in exon 11 in PTC in previous studies (16, 17), we searched for this mutation in other types of thyroid neoplasms in this study. To this end, a 212-bp fragment from exon 15 containing the site where T1796A mutation occurs was amplified by PCR. The primers used were as described previously (23): TCATAATGCTTGCTCTGATAGGA (forward) and GGCCAAAAATTTAATCAGTGGA (reverse). The amplification PCR was performed with deoxynucleotides using a step-down protocol: 95 C for 5 min for one cycle; 95 C for 1 min, 60 C for 1 min, and 72 C for 1 min for two cycles; 95 C for 1 min, 58 C for 1 min, and 72 C for 1 min for two cycles; and 95 C for 1 min, 56 C for 1 min, and 72 C for 1 min for 40 cycles with a final extension at 72 C for 5 min. The reaction mixture contained about 60 ng genomic DNA, 5% dimethylsulfoxide, 16.6 mM ammonium sulfate, 67 mM Tris (pH 8.8), 6.7 mM MgCl₂, 10 mM 2-mercaptoethanol, 1.5 mM each deoxynucleotide triphosphate, 1.67 µM of each primer (forward and reverse), and 0.5 U of platinum DNA Taq polymerase (Life Technologies, Inc., Rockville, MD) in a 30-µl final volume. After confirmation of the efficiency and quality of the amplification PCR by running the PCR products on a 1.5% agarose gel, the PCR products were subjected to direct sequencing PCR using the above-described forward primer and Big Dye terminator V 3.0 cycle sequencing reagents (Applied Biosystems, Foster City, CA) with the following cycles: 95 C for 30 sec for one cycle; and 95 C for 15 sec, 50 C for 15 sec, and 60 C for 4 min for 35 cycles. The samples were subsequently analyzed on an ABI PRISM 3700 DNA Analyser (Applied Biosystems) at the Synthesis and Sequencing Facility of the Johns Hopkins University. The T1796A mutation was identified by comparing the samples with controls (known negative and positive mutants).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Direct DNA sequencing of the PCR-amplified exon 15 of the BRAF gene identified T1796A mutation in 44% (8 of 18) of the PTC series from North America and in 45% (9 of 20) of the PTC series from Kiev, Ukraine. We found this mutation in only 20% (2 of 10) of ATC, 0% (0 of 14) of MTC, and 0% (0 of 11) of benign thyroid hyperplasia. In the sporadic tumor series from North America, we found T1796A mutation in 0% (0 of 5) of FTC and 0% (0 of 23) of benign thyroid adenomas. Similarly, in the Ukrainian series, we found BRAF mutation in 0% (0 of 9) of FTC and 0% (0 of 20) of benign thyroid adenoma. When the Chernobyl victims from the Ukrainian series of PTC were specifically analyzed, BRAF mutation was found in one of five PTC children with exposure to radiation, and in two of five adult PTC individuals with radiation exposure. Statistical analysis comparing the prevalence of BRAF mutation in the entire radiated and nonradiated Ukraine cohorts was performed using ² analysis, and there was no statistically significant difference between the groups, although the number of patients is relatively small.

The ATC-derived ARO-81-1 and DRO-90-1 cell lines were positive for T1796A mutation, whereas another ATC-derived cell line, C643, was negative for this mutation. Figure 1 shows examples of the sequencing results for each type of the thyroid neoplasms. Table 1 summarizes the data from all of the samples examined.

View larger version (57K): [in this window] [in a new window]   FIG. 1. BRAF T1796A transversion mutation in various thyroid neoplasms. Genomic DNA was isolated, and BRAF exon 15 was amplified and sequenced as described in Materials and Methods. Shown are examples from each type of thyroid neoplasm of a sequence (TACAGTGAAATCT) containing the site (indicated by the arrow) where T17 96A mutation may occur. As indicated by a plus or minus sign for each sample, plus indicates mutation (seen as the transversion of number 1796 nucleotide T to A) and minus indicates wild type (seen as no transversion of number 1796 nucleotide T). DRO, Human anaplastic thyroid cancer cell line.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

We only found BRAF T1796A mutation in a minority (20%) of the ATC. This result is consistent with the unique identification of the tumor suppressor gene p53 mutations in ATC in contrast to all other thyroid cancers (12, 13). ATC thus segregates itself from other thyroid cancers at the molecular level, which in turn reflects its aggressive clinical course. The high prevalence of BRAF mutation in PTC and lower prevalence in ATC is consistent with the hypothesis that not all ATC arise from preexisting PTC (27).

We did not find BRAF T1796A mutation in benign thyroid hyperplasia. It is interesting that, in addition to melanomas, this mutation also occurs in the vast majority of benign nevi (24), which are thought to be precancerous lesions in the development of melanoma. Unlike benign nevi, however, we did not find BRAF mutation in benign thyroid hyperplasia, a result consistent with the general belief that thyroid hyperplasia is indeed a benign condition that probably does not convert to cancer.

We found no BRAF mutation in MTC, suggesting that this mutation is not involved in the tumorigenesis of this type of thyroid cancer. The origin of MTC from neuroendocrine parafollicular C cells is, of course, fundamentally different from PTC, which arises from follicular epithelial thyroid cells. Alternative genetic alterations, particularly activating RET mutations, are known to be an integral part of MTC development. RET is a receptor tyrosine kinase and, like activation of BRAF kinase, activation of RET through mutation in MTC or through RET/PTC rearrangement in PTC triggers intracellular signaling that is also at least partially mediated by the Ras Raf MEK MAP/ERK signaling pathway (28, 29), leading to cell growth, proliferation, and transformation.

In summary, we have examined the BRAF T1796A transversion mutation in various thyroid neoplasms and in unique populations with diverse exposure and geographic characteristics. These results, together with previous genetic studies on thyroid neoplasms, are consistent with the concept that PTC inherently harbors BRAF mutation with a high frequency, which, together with mutations in Ras, RET, as well as RET/PTC rearrangements in various thyroid neoplasms, are all implicated in the Ras Raf MEK MAP/ERK signaling pathway, demonstrating a common bond between all the thyroid neoplasms.

	Footnotes

 
This work was supported in part by National Institutes of Health Grants UO1 CA 98-028 and RO1 DE13561-01 (to D.S.) and by American Cancer Society Grant RSG CNE-103291 (to M.D.R.).

M.X. is the recipient of a Johns Hopkins Clinician Scientist Award.

Present address for V.V. and M.D.R.: Divisions of Endocrinology and Oncology, The Ohio State University College of Medicine, 455D McCampbell Hall, 1581 Dodd Drive, Columbus, Ohio 43210.

Present address for G.T.: Anatomia Patologica, Ospedale Bellaria, Via Altura 3, 40139 Bologna, Italy.

Abbreviations: ATC, Anaplastic thyroid cancer; FTC, follicular thyroid cancer; MTC, medullary thyroid cancer; PTC, papillary thyroid cancer.

Received August 27, 2003.

Accepted November 18, 2003.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Hundahl SA, Fleming ID, Fremgen AM, Menck HR 1998 A National Cancer Data Base report on 53,856 cases of thyroid carcinoma treated in the U. S., 1985–1995. Cancer 83:2638–2648[CrossRef][Medline]
2. Santoro M, Carlomagno F, Hay ID, Herrmann MA, Grieco M, Melillo R, Pierotti MA, Bongarzone I, Della Porta G, Berger N, Peix JL, Paulin C, Fabien N, Vecchio G, Jenkins RB, Fusco A 1992 Ret oncogene activation in human thyroid neoplasms is restricted to the papillary cancer subtype. J Clin Invest 89:1517–1522[Medline]
3. Jhiang SM, Caruso DR, Gilmore E, Ishizaka Y, Tahira T, Nagao M, Chiu IM, Mazzaferri EL 1992 Detection of the PTC/retTPC oncogene in human thyroid cancers. Oncogene 7:1331–1337[Medline]
4. Fugazzola L, Pilotti S, Pinchera A, Vorontsova TV, Mondellini P, Bongarzone I, Greco A, Astakhova L, Butti MG, Demidchik EP 1995 Oncogenic rearrangements of the RET proto-oncogene in papillary thyroid carcinomas from children exposed to the Chernobyl nuclear accident. Cancer Res 55:5617–5620[Abstract/Free Full Text]
5. Nikiforov YE, Rowland JM, Bove KE, Monforte-Munoz H, Fagin JA 1997 Distinct pattern of ret oncogene rearrangements in morphological variants of radiation-induced and sporadic thyroid papillary carcinomas in children. Cancer Res 57:1690–1694[Abstract/Free Full Text]
6. Bounacer A, Wicker R, Caillou B, Cailleux AF, Sarasin A, Schlumberger M, Suarez HG 1997 High prevalence of activating ret proto-oncogene rearrangements, in thyroid tumors from patients who had received external radiation. Oncogene 15:1263–1273[CrossRef][Medline]
7. Lemoine NR, Mayall ES, Wyllie FS, Farr CJ, Hughes D, Padua RA, Thurston V, Williams ED, Wynford-Thomas D 1988 Activated ras oncogenes in human thyroid cancers. Cancer Res 48:4459–4463[Abstract/Free Full Text]
8. Pierotti MA, Bongarzone I, Borello MG, Greco A, Pilotti S, Sozzi G 1996 Cytogenetics and molecular genetics of carcinomas arising from thyroid epithelial follicular cells. Genes Chromosomes Cancer 16:1–14[CrossRef][Medline]
9. Vasko V, Ferrand M, Di Cristofaro J, Carayon P, Henry JF, de Micco C 2003 Specific pattern of RAS oncogene mutations in follicular thyroid tumors. J Clin Endocrinol Metab 88:2745–2752[Abstract/Free Full Text]
10. Nikiforova MN, Lynch RA, Biddinger PW, Alexander EK, Dorn 2nd GW, Tallini G, Kroll TG, Nikiforov YE 2003 RAS point mutations and PAX8-PPAR rearrangement in thyroid tumors: evidence for distinct molecular pathways in thyroid follicular carcinoma. J Clin Endocrinol Metab 88:2318–2326[Abstract/Free Full Text]
11. Kroll TG, Sarraf P, Pecciarini L, Chen CJ, Mueller E, Spiegelman BM, Fletcher JA 2000 PAX8-PPAR1 fusion oncogene in human thyroid carcinoma. Science 289:1357–1360[Abstract/Free Full Text]
12. Fagin JA, Matsuo K, Karmakar A, Chen DL, Tang SH, Koeffler HP 1993 High prevalence of mutations of the p53 gene in poorly differentiated human thyroid carcinomas. J Clin Invest 91:179–184[Medline]
13. Satta MA, Nanni S, Della Casa S, Pontecorvi A 2000 Molecular biology of thyroid neoplasms. Rays 25:151–161[Medline]
14. Clayman GL, El-Baradie TS 2003 Medullary thyroid cancer. Otolaryngol Clin North Am 36:91–105[CrossRef][Medline]
15. Neumann HP, Bausch B, McWhinney SR, Bender BU, Gimm O, Franke G, Schipper J, Klisch J, Altehoefer C, Zerres K, Januszewicz A, Eng C, Smith WM, Munk R, Manz T, Glaesker S, Apel TW, Treier M, Reineke M, Walz MK, Hoang-Vu C, Brauckhoff M, Klein-Franke A, Klose P, Schmidt H, Maier-Woelfle M, Peczkowska M, Szmigielski C, Eng C, Freiburg-Warsaw-Columbus Pheochromocytoma Study Group 2002 Germ-line mutations in nonsyndromic pheochromocytoma. N Engl J Med 346:1459–1466[Abstract/Free Full Text]
16. Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE, Fagin JA 2003 High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res 63:1454–1457[Abstract/Free Full Text]
17. Cohen Y, Xing M, Mambo E, Guo Z, Wu G, Trink B, Beller U, Westra WH, Ladenson PW, Sidransky D 2003 BRAF mutation in papillary thyroid carcinoma. J Natl Cancer Inst 95:625–627[Abstract/Free Full Text]
18. Soares P, Trovisco V, Rocha AS, Lima J, Castro P, Preto A, Maximo V, Botelho T, Seruca R, Sobrinho-Simoes M 2003 BRAF mutations and RET/PTC rearrangements are alternative events in the etiopathogenesis of PTC. Oncogene 22:4578–4580[CrossRef][Medline]
19. Xu X, Quiros RM, Gattuso P, Ain KB, Prinz RA 2003 High prevalence of BRAF gene mutation in papillary thyroid carcinomas and thyroid tumor cell lines. Cancer Res 63:4561–4567[Abstract/Free Full Text]
20. Hilger RA, Scheulen ME, Strumberg D 2002 The Ras-Raf-MEK-ERK pathway in the treatment of cancer. Onkologie 25:511–518[CrossRef][Medline]
21. Mercer KE, Pritchard CA 2003 Raf proteins and cancer: B-Raf is identified as a mutational target. Biochim Biophys Acta 1653:25–40[Medline]
22. Sithanandam G, Druck T, Cannizzaro LA, Leuzzi G, Huebner K, Rapp UR 1992 B-raf and a B-raf pseudogene are located on 7q in man. Oncogene 7:795–799[Medline]
23. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W, Davis N, Dicks E, Ewing R, Floyd Y, Gray K, Hall S, Hawes R, Hughes J, Kosmidou V, Menzies A, Mould C, Parker A, Stevens C, Watt S, Hooper S, Wilson R, Jayatilake H, Gusterson BA, Cooper C, Shipley J, Hargrave D, Pritchard-Jones K, Maitland N, Chenevix-Trench G, Riggins GJ, Bigner DD, Palmieri G, Cossu A, Flanagan A, Nicholson A, Ho JW, Leung SY, Yuen ST, Weber BL, Seigler HF, Darrow TL, Paterson H, Marais R, Marshall CJ, Wooster R, Stratton MR, Futreal PA 2002 Mutations of the BRAF gene in human cancer. Nature 417:949–954[CrossRef][Medline]
24. Pollock PM, Harper UL, Hansen KS, Yudt LM, Stark M, Robbins CM, Moses TY, Hostetter G, Wagner U, Kakareka J, Salem G, Pohida T, Heenan P, Duray P, Kallioniemi O, Hayward NK, Trent JM, Meltzer PS 2003 High frequency of BRAF mutations in nevi. Nat Genet 33:19–20[CrossRef][Medline]
25. Xing M, Usadel H, Cohen Y, Tokumaru Y, Guo Z, Westra WB, Tong BC, Tallini G, Udelsman R, Califano JA, Ladenson PW, Sidransky D 2003 Methylation of the thyroid-stimulating hormone receptor gene in epithelial thyroid tumors: a marker of malignancy and a cause of gene silencing. Cancer Res 63:2316–2321[Abstract/Free Full Text]
26. Santoro M, Thomas GA, Vecchio G, Williams GH, Fusco A, Chiappetta G, Pozcharskaya V, Bogdanova TI, Demidchik EP, Cherstvoy ED, Voscoboinik L, Tronko ND, Carss A, Bunnell H, Tonnachera M, Parma J, Dumont JE, Keller G, Hofler H, Williams ED 2000 Gene rearrangement and Chernobyl related thyroid cancers. Br J Cancer 82:315–322[CrossRef][Medline]
27. Meier CA 2000 Thyroid nodules: pathogenesis, diagnosis and treatment. Baillieres Best Pract Res Clin Endocrinol Metab 14:559–575[CrossRef][Medline]
28. van Weering DH, Medema JP, van Puijenbroek A, Burgering BM, Baas PD, Bos JL 1995 Ret receptor tyrosine kinase activates extracellular signal-regulated kinase 2 in SK-N-MC cells. Oncogene 11:2207–2214[Medline]
29. van Puijenbroek AA, van Weering DH, van den Brink CE, Bos JL, van der Saag PT, de Laat SW, den Hertog J 1997 Cell scattering of SK-N-MC neuroepithelioma cells in response to Ret and FGF receptor tyrosine kinase activation is correlated with sustained ERK2 activation. Oncogene 14:1147–1157[CrossRef][Medline]

This article has been cited by other articles:

				J. A Woyach and M. H Shah New therapeutic advances in the management of progressive thyroid cancer Endocr. Relat. Cancer, September 1, 2009; 16(3): 715 - 731. [Abstract] [Full Text] [PDF]

				J P. Couto, H Prazeres, P Castro, J Lima, V Maximo, P Soares, and M Sobrinho-Simoes How molecular pathology is changing and will change the therapeutics of patients with follicular cell-derived thyroid cancer J. Clin. Pathol., May 1, 2009; 62(5): 414 - 421. [Abstract] [Full Text] [PDF]

				G. Riesco-Eizaguirre and P. Santisteban New insights in thyroid follicular cell biology and its impact in thyroid cancer therapy Endocr. Relat. Cancer, December 1, 2007; 14(4): 957 - 977. [Abstract] [Full Text] [PDF]

				L. R Rowe, B. G Bentz, and J. S Bentz Detection of BRAF V600E activating mutation in papillary thyroid carcinoma using PCR with allele-specific fluorescent probe melting curve analysis J. Clin. Pathol., November 1, 2007; 60(11): 1211 - 1215. [Abstract] [Full Text] [PDF]

				D. Liu, Z. Liu, S. Condouris, and M. Xing BRAF V600E Maintains Proliferation, Transformation, and Tumorigenicity of BRAF-Mutant Papillary Thyroid Cancer Cells J. Clin. Endocrinol. Metab., June 1, 2007; 92(6): 2264 - 2271. [Abstract] [Full Text] [PDF]

				C. S. Mitsiades, J. Negri, C. McMullan, D. W. McMillin, E. Sozopoulos, G. Fanourakis, G. Voutsinas, S. Tseleni-Balafouta, V. Poulaki, D. Batt, et al. Targeting BRAFV600E in thyroid carcinoma: therapeutic implications Mol. Cancer Ther., March 1, 2007; 6(3): 1070 - 1078. [Abstract] [Full Text] [PDF]

				V. Vasko, A. V. Espinosa, W. Scouten, H. He, H. Auer, S. Liyanarachchi, A. Larin, V. Savchenko, G. L. Francis, A. de la Chapelle, et al. Gene expression and functional evidence of epithelial-to-mesenchymal transition in papillary thyroid carcinoma invasion PNAS, February 20, 2007; 104(8): 2803 - 2808. [Abstract] [Full Text] [PDF]

				I. Palona, H. Namba, N. Mitsutake, D. Starenki, A. Podtcheko, I. Sedliarou, A. Ohtsuru, V. Saenko, Y. Nagayama, K. Umezawa, et al. BRAFV600E Promotes Invasiveness of Thyroid Cancer Cells through Nuclear Factor {kappa}B Activation Endocrinology, December 1, 2006; 147(12): 5699 - 5707. [Abstract] [Full Text] [PDF]

				E. A. Mittendorf, A. Khiyami, and C. R. McHenry When Fine-Needle Aspiration Biopsy Cannot Exclude Papillary Thyroid Cancer: A Therapeutic Dilemma Arch Surg, October 1, 2006; 141(10): 961 - 966. [Abstract] [Full Text] [PDF]

				L Fugazzola, E Puxeddu, N Avenia, C Romei, V Cirello, A Cavaliere, P Faviana, D Mannavola, S Moretti, S Rossi, et al. Correlation between B-RAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: data from a multicentric Italian study and review of the literature. Endocr. Relat. Cancer, June 1, 2006; 13(2): 455 - 464. [Abstract] [Full Text] [PDF]

				J Di Cristofaro, M Silvy, A Lanteaume, M Marcy, P Carayon, and C De Micco Expression of tpo mRNA in thyroid tumors: quantitiative PCR analysis and correlation with alterations of ret, Braf , ras and pax8 genes. Endocr. Relat. Cancer, June 1, 2006; 13(2): 485 - 495. [Abstract] [Full Text] [PDF]

				G. Salvatore, V. De Falco, P. Salerno, T. C. Nappi, S. Pepe, G. Troncone, F. Carlomagno, R. M. Melillo, S. M. Wilhelm, and M. Santoro BRAF Is a Therapeutic Target in Aggressive Thyroid Carcinoma Clin. Cancer Res., March 1, 2006; 12(5): 1623 - 1629. [Abstract] [Full Text] [PDF]

				M. R. Sapio, D. Posca, G. Troncone, G. Pettinato, L. Palombini, G. Rossi, G. Fenzi, and M. Vitale Detection of BRAF mutation in thyroid papillary carcinomas by mutant allele-specific PCR amplification (MASA) Eur. J. Endocrinol., February 1, 2006; 154(2): 341 - 348. [Abstract] [Full Text] [PDF]

				M. Xing, W. H. Westra, R. P. Tufano, Y. Cohen, E. Rosenbaum, K. J. Rhoden, K. A. Carson, V. Vasko, A. Larin, G. Tallini, et al. BRAF Mutation Predicts a Poorer Clinical Prognosis for Papillary Thyroid Cancer J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6373 - 6379. [Abstract] [Full Text] [PDF]

				V. Guarino, P. Faviana, G. Salvatore, M. D. Castellone, A. M. Cirafici, V. De Falco, A. Celetti, R. Giannini, F. Basolo, R. M. Melillo, et al. Osteopontin Is Overexpressed in Human Papillary Thyroid Carcinomas and Enhances Thyroid Carcinoma Cell Invasiveness J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5270 - 5278. [Abstract] [Full Text] [PDF]

				V. Vasko, S. Hu, G. Wu, J. C. Xing, A. Larin, V. Savchenko, B. Trink, and M. Xing High Prevalence and Possible de Novo Formation of BRAF Mutation in Metastasized Papillary Thyroid Cancer in Lymph Nodes J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5265 - 5269. [Abstract] [Full Text] [PDF]

				G. Wu, E. Mambo, Z. Guo, S. Hu, X. Huang, S. M. Gollin, B. Trink, P. W. Ladenson, D. Sidransky, and M. Xing Uncommon Mutation, but Common Amplifications, of the PIK3CA Gene in Thyroid Tumors J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4688 - 4693. [Abstract] [Full Text] [PDF]

				M. O. Hoque, E. Rosenbaum, W. H. Westra, M. Xing, P. Ladenson, M. A. Zeiger, D. Sidransky, and C. B. Umbricht Quantitative Assessment of Promoter Methylation Profiles in Thyroid Neoplasms J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4011 - 4018. [Abstract] [Full Text] [PDF]

				L. Lacroix, V. Lazar, S. Michiels, H. Ripoche, P. Dessen, M. Talbot, B. Caillou, J.-P. Levillain, M. Schlumberger, and J.-M. Bidart Follicular Thyroid Tumors with the PAX8-PPAR{gamma}1 Rearrangement Display Characteristic Genetic Alterations Am. J. Pathol., July 1, 2005; 167(1): 223 - 231. [Abstract] [Full Text] [PDF]

				M Xing BRAF mutation in thyroid cancer Endocr. Relat. Cancer, June 1, 2005; 12(2): 245 - 262. [Abstract] [Full Text] [PDF]

				K. Krohn, D. Fuhrer, Y. Bayer, M. Eszlinger, V. Brauer, S. Neumann, and R. Paschke Molecular Pathogenesis of Euthyroid and Toxic Multinodular Goiter Endocr. Rev., June 1, 2005; 26(4): 504 - 524. [Abstract] [Full Text] [PDF]

				V. Porra, C. Ferraro-Peyret, C. Durand, S. Selmi-Ruby, H. Giroud, N. Berger-Dutrieux, M. Decaussin, J.-L. Peix, C. Bournaud, J. Orgiazzi, et al. Silencing of the Tumor Suppressor Gene SLC5A8 Is Associated with BRAF Mutations in Classical Papillary Thyroid Carcinomas J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3028 - 3035. [Abstract] [Full Text] [PDF]

				P. Smyth, S. Finn, S. Cahill, E. O'Regan, R. Flavin, J. J. O'Leary, and O. Sheils ret/PTC and BRAF Act as Distinct Molecular, Time-Dependant Triggers in a Sporadic Irish Cohort of Papillary Thyroid Carcinoma International Journal of Surgical Pathology, January 1, 2005; 13(1): 1 - 8. [Abstract] [PDF]

				A Perren, S Schmid, T Locher, P Saremaslani, C Bonvin, P U Heitz, and P Komminoth BRAF and endocrine tumors: mutations are frequent in papillary thyroid carcinomas, rare in endocrine tumors of the gastrointestinal tract and not detected in other endocrine tumors Endocr. Relat. Cancer, December 1, 2004; 11(4): 855 - 860. [Abstract] [Full Text] [PDF]

				G. Salvatore, R. Giannini, P. Faviana, A. Caleo, I. Migliaccio, J. A. Fagin, Y. E. Nikiforov, G. Troncone, L. Palombini, F. Basolo, et al. Analysis of BRAF Point Mutation and RET/PTC Rearrangement Refines the Fine-Needle Aspiration Diagnosis of Papillary Thyroid Carcinoma J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5175 - 5180. [Abstract] [Full Text] [PDF]

				J. Lima, V. Trovisco, P. Soares, V. Maximo, J. Magalhaes, G. Salvatore, M. Santoro, T. Bogdanova, M. Tronko, A. Abrosimov, et al. BRAF Mutations Are Not a Major Event in Post-Chernobyl Childhood Thyroid Carcinomas J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4267 - 4271. [Abstract] [Full Text] [PDF]

				M. Xing, R. P. Tufano, A. P. Tufaro, S. Basaria, M. Ewertz, E. Rosenbaum, P. J. Byrne, J. Wang, D. Sidransky, and P. W. Ladenson Detection of BRAF Mutation on Fine Needle Aspiration Biopsy Specimens: A New Diagnostic Tool for Papillary Thyroid Cancer J. Clin. Endocrinol. Metab., June 1, 2004; 89(6): 2867 - 2872. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Xing, M. Articles by Sidransky, D. Search for Related Content PubMed PubMed Citation Articles by Xing, M. Articles by Sidransky, D.