help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dalrymple, A.
Right arrow Articles by Tribe, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dalrymple, A.
Right arrow Articles by Tribe, R. M.
The Journal of Clinical Endocrinology & Metabolism Vol. 89, No. 3 1291-1300
Copyright © 2004 by The Endocrine Society

Physiological Induction of Transient Receptor Potential Canonical Proteins, Calcium Entry Channels, in Human Myometrium: Influence of Pregnancy, Labor, and Interleukin-1ß

A. Dalrymple, D. M. Slater, L. Poston and R. M. Tribe

Parturition Research Group (A.D., L.P., R.M.T.), Maternal and Fetal Research Unit, Department of Women’s Health, Guy’s, King’s and St. Thomas’ School of Medicine, St. Thomas’ Hospital Campus, London, SE1 7EH, United Kingdom; and Biochemical Research Institute (D.M.S.), The University of Warwick, Coventry, CV4 7AL, United Kingdom

Address all correspondence and requests for reprints to: Dr. Rachel M. Tribe, Parturition Research Group, Maternal and Fetal Research Unit, Department of Women’s Health, 10th Floor, North Wing, Guy’s, King’s and St. Thomas’ School of Medicine, King’s College London, St. Thomas’ Hospital Campus, Lambeth Palace Road, London, SE1 7EH, United Kingdom. E-mail: rachel.tribe{at}kcl.ac.uk.


   Abstract
Top
 Abstract
Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
This study investigated gestational regulation of transient receptor potential canonical (TrpC) proteins, putative calcium entry channels in human myometrium, and the potential modulation of TrpC expression by IL–1ß, a cytokine implicated in labor. Total RNA and proteins were isolated from myometrial biopsies obtained from NP women, pregnant women at term not in labor (TNL), or term active labor (TAL) and from primary cultured human myometrial smooth muscle cells incubated with IL–1ß or IL–1ß with or without nimesulide. Semiquantitative RT-PCR demonstrated significant up-regulation of TrpC1 in TAL and TNL (P <= 0.01) and TrpC6 (P <= 0.01) and TrpC7 (P <= 0.05) in TAL samples. TrpC3 and TrpC4 mRNA expression was unaffected. Western blot demonstrated significant up-regulation of TrpC1 in TAL and TNL (P <= 0.05) and TrpC3 (P <= 0.01), TrpC4 (P <= 0.05), and TrpC6 (P <= 0.01) in TAL samples. IL–1ß did not alter TrpC1, 3, 4, 6, or 7 mRNA expression; but IL–1ß exclusively up-regulated TrpC3 protein expression (P <= 0.05). TrpC3 up-regulation was unaffected by cyclooxygenase blockade. These data demonstrate physiological regulation of TrpC mRNA and protein and suggest an important role for TrpC proteins in human myometrium during labor.


   Introduction
Top
 Abstract
 Introduction
Subjects and Methods
 Results
 Discussion
 References
 
THE PRECISE MECHANISMS underlying the initiation of human labor are unknown, but increasing evidence suggests that myometrial smooth muscle calcium dynamics are modulated toward the end of gestation to facilitate uterine contractility (1, 2, 3, 4, 5, 6, 7, 8, 9, 10). In human myometrium, the development of force is predominantly dependent on calcium entry from the extracellular milieu (11). The major route of calcium entry is via voltage-gated calcium channels (12, 13), and considerable evidence suggests that L-type channels are up-regulated during labor (2, 9). Other nonvoltage calcium entry pathways [e.g. store-operated calcium entry (SOCE) and non-SOCE] have been implicated in human myometrium (14, 15, 16), but the relative contribution of these to the initiation and development of rhythmic myometrial contractile activity during labor has yet to be established.

SOCE and non-SOCE (which are closely related to receptor-operated calcium entry) have been described in numerous excitable and nonexcitable cells and provide alternative pathways by which agonists can augment and maintain calcium entry (17, 18, 19). SOCE is activated by depletion of the inositol triphosphate-sensitive sarcoplasmic reticulum (SR) calcium stores. Depletion of the SR calcium stores, and hence SOCE, can be initiated by endogenous agonists binding to G protein-coupled receptors or pharmacologically by agents (cyclopiazonic acid and thapsigargin) that inhibit the SR calcium ATPases (SERCA). Non-SOCE is activated by intermediate signaling molecules (e.g. arachidonic acid and diacylglycerol) of the phospholipase C signaling cascade (17, 18). SOCE/non-SOCE pathways have been described in immortalized pregnant human myometrial cells (16) and in primary cultured human myometrial smooth muscle (HMSM) cells (10, 15). The contribution of SOCE/non-SOCE to human myometrial contractility remains to be fully characterized; however, we have shown that cyclopiazonic acid (which activates SOCE) evokes contractions in term pregnant human myometrium in vitro and that this response is substantially exaggerated in myometrial tissue from women in labor (10). Preliminary evidence from our laboratory has demonstrated that myometrial contractions can be induced after SR calcium store depletion in the presence of a L-type calcium channel inhibitor (14), indicating that other calcium entry pathways exist. We have also reported that the proinflammatory cytokine IL-1ß, which is implicated in the initiation of preterm and term labor (20, 21), induces calcium oscillations and SOCE in primary cultured HMSM cells (15).

The proteins forming SOCE/non-SOCE channels in human myometrium have yet to be identified, but transient receptor potential canonical (TrpC)1–7 proteins, which are associated with SOCE/non-SOCE in other cells types (22, 23, 24, 25, 26, 27, 28, 29), are potential candidates. TrpC proteins are subdivided into two subgroups on the basis of sequence homology. One subgroup includes TrpC1, TrpC4, and TrpC5; and TrpC3, TrpC6, and TrpC7 form the other. Recent coimmunoprecipitation studies have demonstrated that TrpC proteins form homo- or heteromeric channels in vivo and that functional channels are subgroup specific (27). There is also emerging evidence for an involvement of TrpC proteins in the generation of calcium oscillations and pacemaker activity in smooth muscle (29, 30, 31, 32).

Recent studies have demonstrated that TrpC1, TrpC3, TrpC4, TrpC6, and TrpC7 mRNA and also TrpC1, TrpC3, TrpC4, and TrpC6 proteins are expressed by term human myometrial tissue (33, 34) and primary cultured HMSM cells (33), and overexpression of TrpC3 in human myometrial cells is linked with enhanced SOCE/non-SOCE (35). We hypothesize that if TrpC proteins contribute to SOCE/non-SOCE and contractile activity in HMSM, then TrpC isoforms will show evidence of regulation during pregnancy and labor. Similarly, we would predict the up-regulation of one or more TrpC isoforms in IL-1ß-treated HMSM cells in parallel with the induction of calcium oscillations and non-SOCE/SOCE.


   Subjects and Methods
Top
 Abstract
 Introduction
 Subjects and Methods
Results
 Discussion
 References
 
Subjects

Human myometrial biopsies were obtained at cesarean section, with informed written consent and institutional Ethics Committee approval (Walsgrave Hospital Trust, Coventry, UK and Guy’s and St. Thomas’ Hospital Trusts, London, UK) in accordance with the principles set out in the Declaration of Helsinki. Biopsies were collected for RNA isolation (Walsgrave Hospital Trust) from women without underlying disease at term not in labor (TNL, n = 7, 37–40 wk; indications: maternal request, breech presentation, previous section, or placental praevia) and term in active labor [TAL, n = 5, 39–41 wk; indications: failure to progress (without syntocin or prostaglandin administration), fetal distress, or previous section]. Biopsies were also collected for protein isolation (Guy’s and St. Thomas’ Hospital Trusts) from women without underlying disease at TNL (n = 5, 38–41 wk; indications: breech presentation or previous section) and TAL [n = 5, 39–42 wk; indications: failure to progress (without syntocin or prostaglandin administration), fetal distress, or undiagnosed breech]. Myometrium was collected (Guy’s and St. Thomas’ Hospital Trusts) from premenopausal nonpregnant (NP) women at the time of hysterectomy for dysmenorrhea and used for RNA (n = 3) and protein isolation (n = 3). After collection, samples were snap frozen. TNL myometrial biopsies (n = 13, 38–40 wk, indications: previous section, breech presentation, perforated bowel, or maternal request) were also collected for primary cell culture (Guy’s and St. Thomas’ Hospital Trusts).

Cell isolation and primary culture of HMSM cells

HMSM cells were isolated as described previously from TNL myometrial biopsies (10, 33). In initial experiments, confluent primary HMSM cell cultures (from n = 10 women, n = 3 for RNA, and n = 7 for protein isolation) were serum deprived for 24 h [DMEM (Sigma, Poole, UK) plus 0.5% fetal calf serum (FCS; Invitrogen, Paisley, UK)] and then incubated (DMEM, 0.5% FCS, 24 h) with 10 ng/ml IL–1ß (stock prepared in DMEM, 0.5% FCS; R&D Systems, Oxon, UK) or DMEM plus 0.5% FCS (control). A second group of experiments were performed to determine the potential influence of cytokine-induced prostaglandin production on TrpC protein expression because IL-1ß also induces cyclooxygenase (COX)-2 and prostaglandin production in HMSM cells (36). Primary HMSM cell cultures (from n = 3 women) were serum deprived (DMEM, 0.5% FCS, 24 h) and then incubated (DMEM, 0.5% FCS, 24 h) either without (controls) or with 10 ng/ml IL–1ß or 10 ng/ml IL–1ß plus 10 µM nimesulide (COX-2 inhibitor, Sigma) or 10 µM nimesulide alone. The IL–1ß concentration used was within the range reported for cervicovaginal secretions of women in term and also preterm labor (20, 21).

RT-PCR

Total RNA was isolated from myometrial tissue using the SV Total RNA Isolation System (Promega, Southampton, UK) as recommended by the manufacturer. RNA was isolated from IL-1ß-treated and control primary HMSM cell cultures using Trizol reagent (Invitrogen Life Technologies). Reverse transcription was carried out using random hexanucleotide primers (0.2 µg) and total RNA (100 ng), which was first denatured at 70 C for 5 min followed by reverse transcription with Superscript II (Invitrogen Life Technologies) at 37 C for 60 min. The resultant cDNA was used as template for PCR with 1.25 U AmpliTaq (conditions as recommended by Applied Bioscience, Cheshire, UK) and 125 ng of 5' and 3' with TrpC gene-specific primers (33). PCR primers (5'-3') were: TrpC1 (sense) ACAGCAAAGCAATGATACCT, (antisense) AAGTCCGAAAGCCAAGTAAA; TrpC3 (sense) GTTGTGGAATGTGCTTGACT, (antisense) TGAAAGGTGGAGGTAATGTT; TrpC4 (sense) CCTGGACATTTTGAAGTTTC, (antisense) CTGCATGGTCAGCAATCAGT; TrpC6 (sense) AGGATGACGCTGATGTGGAG, (antisense) TCCTTCAGTTCCCCTTCGTT; and TrpC7 (sense) ATGCCTTTGGCGACATCGTCTTCA, (antisense) TCCTCATCCAGTATGTACT (33). PCR products were 620 (TrpC1), 722 (TrpC3), 356 (TrpC4), 454 (TrpC6), and 432 (TrpC7) bp (Fig. 1Go). Cycling parameters used were: cycles of denaturing at 94 C for 30 sec; annealing at 48 C (TrpC7), 51 C (TrpC4), 54 C (TrpC1), or 57 C (TrpC3 and TrpC6) for 30 sec; extension at 72 C for 30 sec; followed by a final extension of 5 min at 72 C. After amplification, PCR products were analyzed using ethidium bromide-stained agarose gels, subcloned into the pGEM-T Easy vector (Promega) and sequence verified.



View larger version (63K):
[in this window]
[in a new window]
  		FIG. 1. TrpC1 (620 bp), TrpC3 (722 bp), TrpC4 (356 bp), TrpC6 (454 bp), and TrpC7 (432 bp) PCR products in NP (n = 3); TAL (n = 5) and term nonlabor (n = 7 for TrpC1, 4, 6, and 7; n = 6 for TrpC3) myometrial samples. PCR products were loaded onto the gels in an identical order to enable TrpC expression profiles to be determined for each patient.

 
For each target gene investigated, a cycle profile was performed on pooled myometrial tissue or HMSM cell cDNA to determine the exponential phase of amplification. PCR was performed using each pooled cDNA sample and TrpC primers. Samples were amplified for 20–42 PCR cycles at two cycle intervals, analyzed using ethidium bromide-stained agarose gels, and the exponential phase of amplification determined. The exponential phase cycle number (33 for TrpC1 and 36 for TrpC3, TrpC4, TrpC6, and TrpC7) was used for gene expression analysis. Subsequent PCR experiments were analyzed by agarose gel electrophoresis and quantified using TotalLab software (Newcastle upon Tyne, UK). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression (primers 5'-3', sense-CCA CCC ATG GCA AAT TCC ATG GCA, antisense-TCT AGA CGG CAG GTC AGG TCC ACC; annealing temperature, 58 C; 587-bp product) was also determined in all samples. GAPDH expression was variable (mean ± SE GAPDH mRNA expression arbitrary units; NP, 0.030 ± 0.005, n = 3; TAL, 0.067 ± 0.002, n = 5; TNL, 0.049 ± 0.003, n = 7; NL vs. AL P < 0.001, NP vs. TNL P < 0.01; TAL vs. TNL P < 0.01) as has been reported in pregnancy for this gene and other house-keeping genes (37, 38). Calponin mRNA expression was equally as variable; and therefore, uncorrected TrpC mRNA expression data are presented.

Western blotting

Human myometrial biopsies were homogenized using an Ultra Turrax T50 homogenizer in 20 µl of homogenization buffer per milligram of tissue [10 mmol/liter HEPES-KOH, pH 7; 1 mmol/liter dithiothreitol; 1% (vol/vol) nonidet-P40 (Sigma) and protease inhibitor cocktail (COMPLETE tablets; Roche Molecular Biochemicals, Lewes, UK)]. Confluent primary cultured HMSM cells were detached from 3-cm culture dishes using 100 µl homogenization buffer (as above). Proteins were separated from cell debris by centrifugation (13,000 x g, 10 min, 4 C) and the protein concentration in all samples determined using BSA as a standard and the DC protein assay kit (Bio-Rad Laboratories Ltd, Herts, UK).

Myometrial tissue proteins (10 µg) and primary cultured HMSM cellular proteins (10 µg) were denatured at 95 C for 10 min in Laemmli sample buffer (Sigma), size separated using Novex 10% Tris-Glycine gels (Invitrogen), and then transferred to polyvinylidene difluoride membrane (Amersham Pharmacia Biotech Ltd, Buckinghamshire, UK). The transfer efficiency and equal loading of protein samples was assessed by incubating membranes with Ponceau red solution (Sigma). After transfer, membranes were washed with PBS-T (PBS, 0.1% Tween-20, Sigma) and incubated (overnight, 4 C) in blocking buffer (PBS-T, 5% goat serum; Chemicon, Harrow, UK) and subsequently incubated (2 h, room temperature) with the desired rabbit polyclonal primary antibody. Primary antibodies used were TrpC1 (25, 1:1000), TrpC3, TrpC4, or TrpC6 (Alomone Labs, Jerusalem, Israel, 1:200), which were diluted in blocking buffer. For the negative controls, membranes were incubated with a 1:1000 dilution of rabbit preimmune serum (TrpC1) or incubated with primary antibodies that were preabsorbed (1 h, room temperature) with the respective peptides (TrpC3, TrpC4, or TrpC6, Alomone Labs, as recommended by the supplier). After incubation with the primary antibody or negative control, membranes were incubated (1 h, room temperature) with a horseradish peroxidase conjugated goat antirabbit secondary antibody (Bio-Rad, diluted 1: 2500 in blocking buffer). Thereafter, membranes were washed in PBS-T (4 x 15 min) and protein bands visualized with ECL (Amersham Pharmacia Biotech Ltd). Hyperfilms were developed before the saturation of TAL samples. TrpC7 protein expression was not investigated because a commercial TrpC7 antibody is currently unavailable.

Statistical analysis

PCR products were quantified using TotalLab software, and Western blotting hyperfilms were analyzed using the Bio-Rad Multi-Analyst, version 1.1 (Bio-Rad, Hemel Hempstead, UK). Both software packages allow calculation of the density of each band and corresponding background values. Final intensity values (arbitrary units) were background subtracted. PCR and Western blotting data were analyzed using ANOVA with Tukey-Kramer multiple-comparison test or Student’s t test. A value of P <= 0.05 was considered significant. Data are expressed as mean ± SEM. N refers to numbers of individual myometrial samples or primary cell cultures used and correspond directly to patient number.


   Results
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
Discussion
 References
 
Gestational regulation of TrpC mRNA in human myometrial tissue

PCR amplified TrpC1 (620 bp), TrpC3 (722 bp), TrpC4 (356 bp), TrpC6 (454 bp), and TrpC7 (432 bp) products (Fig. 1Go) in human myometrial tissue (NP, n = 3; TAL, n = 5; TNL, n = 6–7). Products were of the expected size and consistent with our previous observations (33). No bands were amplified in reverse-transcribed or PCR-negative controls (data not shown).

Semiquantification demonstrated that TrpC1 mRNA was significantly up-regulated in TAL and TNL myometrium when compared with NP samples (Figs. 1Go and 2AGo; NP, 0.108 ± 0.015; TAL, 0.164 ± 0.010; TNL, 0.166 ± 0.005; P <= 0.01). There was no significant difference in TrpC1 mRNA expression between TNL and TAL myometrial samples. The expression level of TrpC3 and TrpC4 mRNA was not significantly different in NP, TAL, and TNL samples [TrpC3 (Figs. 1Go and 2BGo): NP, 0.051 ± 0.005; TAL, 0.144 ± 0.041; TNL, 0.077 ± 0.010; not significant (N.S.); TrpC4 (Figs. 1Go and 2CGo): NP, 0.082 ± 0.037; TAL, 0.127 ± 0.022; TNL, 0.190 ± 0.024; N.S.]. TrpC6 was significantly up-regulated in TAL samples when compared with NP samples (P <= 0.01); there was no significant difference in TrpC6 mRNA expression between NP and TNL and also TAL and TNL myometrial samples (Figs. 1Go and 2DGo; NP, 0.114 ± 0.004; TAL, 0.319 ± 0.044; TNL, 0.218 ± 0.024). TrpC7 was also significantly up-regulated in TAL samples when compared with NP samples (P <= 0.05); there was no significant difference in TrpC7 mRNA expression between NP and TNL and also TAL and TNL myometrial samples (Figs. 1Go and 2EGo; NP, 0.024 ± 0.006; TAL, 0.146 ± 0.032; TNL, 0.121 ± 0.017).



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 2. Graphs depicting mean ± SEM of TrpC isoform PCR densitometry analysis. A, TrpC1 mRNA was significantly increased in TAL and TNL when compared with NP myometrial samples. TAL and TNL samples expressed TrpC1 mRNA at a similar level. B, TrpC3 mRNA expression was similar in NP, TAL, and TNL myometrial samples. C, TrpC4 mRNA expression was similar in NP, TAL, and TNL myometrial samples. D, TrpC6 mRNA was significantly increased in the TAL when compared with TNL and NP myometrial samples. E, TrpC7 was significantly increased in TAL samples when compared with NP and TNL samples. *, P <= 0.05; **, P <= 0.01. NP n = 3, TAL n = 5, and TNL n = 7 for TrpC1, 4, 6, and 7; n = 6 for TrpC3.

 
Gestational regulation of TrpC proteins in human myometrial tissue

Western blotting detected TrpC1 [90 relative molecular mass (Mr x 10-3)], TrpC3 (90 Mr x 10-3), TrpC4 (100 Mr x 10-3), and TrpC6 (100 Mr x 10-3) proteins in pregnant human myometrial tissue (Fig. 3Go) as previously reported (33). No bands were observed when the primary antibody was omitted or when primary antibodies were preabsorbed with the appropriate peptide (data not shown).



View larger version (85K):
[in this window]
[in a new window]
  		FIG. 3. Representative Western blots of TrpC1, TrpC3, TrpC4, and TrpC6 protein expression in NP (n = 3), TAL (n = 5), and term nonlabor (n = 5) myometrial samples. Protein samples were loaded onto the gels in an identical order to enable TrpC expression profiles to be determined for each patient. Western blotting detected 90 Mr x 10-3 TrpC1 and TrpC3 proteins and 100 Mr x 10-3 TrpC4 and TrpC6 proteins.

 
TrpC1 protein expression was not detected in NP myometrium but was significantly increased in TAL and TNL when compared with NP samples (Figs. 3Go and 4AGo; NP, 0.000 ± 0.000; TAL, 0.076 ± 0.020; TNL, 0.074 ± 0.014; P <= 0.05). There was no significant difference in TrpC1 protein expression between TNL and TAL myometrial samples. TrpC3 protein expression was minimal in the NP and TNL myometrium; however, expression was significantly increased in TAL when compared with NP and TNL myometrial samples (Figs. 3Go and 4BGo; NP, 0.003 ± 0.003; TAL, 0.062 ± 0.009; TNL, 0.022 ± 0.007; P <= 0.01). TrpC4 protein expression was not detected in the NP myometrium, was minimally expressed in TNL myometrium, and was significantly increased in TAL myometrial samples (Figs. 3Go and 4CGo; NP, 0.000 ± 0.000; TAL, 0.118 ± 0.039; TNL, 0.018 ± 0.007; P <= 0.05). Similarly, TrpC6 protein expression was not detected in the NP myometrium, was minimally expressed in TNL myometrium, but was significantly increased (P <= 0.01, NP compared with TAL; P <= 0.05, TAL compared with TNL) in TAL myometrial samples (Figs. 3Go and 4DGo; NP, 0.000 ± 0.000; TAL, 0.072 ± 0.012; TNL, 0.036 ± 0.007). We previously reported TrpC1, TrpC3, TrpC4, and TrpC6 expression in membrane-enriched TNL protein samples (33), whereas total cellular proteins were used in this study, which possibly accounts for the relatively lower level of expression in TNL samples. In addition, hyperfilms were developed before saturation of TAL samples to enable quantification.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 4. Graphs depicting mean ± SEM of TrpC isoform Western blot densitometry analysis in NP (n = 3), TAL (n = 5), and TNL (n = 5) myometrial samples. A, TrpC1 was significantly increased in TAL and TNL when compared with NP myometrial samples. TAL and TNL samples expressed TrpC1 at a similar level. B, TrpC3 protein was significantly increased in the TAL when compared with TNL and NP myometrial samples. C, TrpC4 protein was significantly increased in the TAL when compared with TNL and NP myometrial samples. D, TrpC6 protein was significantly increased in the TAL when compared with TNL and NP myometrial samples. *, P <= 0.05; **, P <= 0.01.

 
Regulated expression of TrpC mRNA by IL–1ß

PCR amplified TrpC1 (620 bp), TrpC3 (722 bp), TrpC4 (356 bp), and TrpC6 (454 bp) products in control and IL–1ß-treated primary HMSM cell cultures (n = 3, Fig. 5Go). TrpC7 (432 bp) was not expressed in all primary myometrial cell cultures (Fig. 5Go), which is consistent with our previous studies (33). IL–1ß treatment did not alter TrpC1 (IL-1ß vs. control, 0.052 ± 0.003 vs. 0.076 ± 0.007, N.S.), TrpC3 (IL-1ß vs. control, 0.079 ± 0.009 vs. 0.088 ± 0.014, N.S.), TrpC4 (IL-1ß vs. control, 0.081 ± 0.022 vs. 0.098 ± 0.014, N.S.), TrpC6 (IL-1ß vs. control, 0.129 ± 0.016 vs. 0.158 ± 0.021, N.S.), or TrpC7 (IL-1ß vs. control, 0.036 ± 0.016 vs. 0.053 ± 0.029, N.S.) mRNA expression (Fig. 6GoA–E, respectively).



View larger version (105K):
[in this window]
[in a new window]
  		FIG. 5. Representative figure demonstrating TrpC1 (620 bp), TrpC3 (722 bp), TrpC4 (356 bp), TrpC6 (454 bp), and TrpC7 (432 bp) PCR products in serum-starved (0.5% FCS) HMSM cell cultures (n = 3), which were incubated without (control, C) or with IL–1ß (IL, 10 ng/ml) for 24 h. TrpC7 was not expressed in all primary myometrial cell cultures.

 


View larger version (11K):
[in this window]
[in a new window]
  		FIG. 6. Graphs depicting mean ± SEM of TrpC isoform PCR densitometry analysis. IL–1ß treatment did not alter TrpC1, TrpC3, TrpC4, TrpC6, or TrpC7 (A–E) mRNA expression (n = 3).

 
Regulated expression of TrpC proteins by IL–1ß

TrpC1, TrpC3, TrpC4, and TrpC6 proteins expressed in primary HMSM cell cultures (Fig. 7Go) were of an identical size to that of proteins expressed by human tissue and observed previously in HMSM cells (33). No bands were observed when the primary antibody was omitted or when primary antibodies were preabsorbed with the appropriate peptide (data not shown). IL–1ß treatment differentially regulated TrpC isoform protein expression in TNL primary HMSM cell cultures isolated from n = 7 myometrial biopsies. IL–1ß significantly up-regulated TrpC3 protein expression compared with control cells (Figs. 7Go and 8BGo; IL-1ß vs. control, 0.11 ± 0.04 vs. 0.03 ± 0.04, P <= 0.05) but did not alter TrpC1 (IL-1ß vs. control, 0.09 ± 0.06 vs. 0.07 ± 0.05, N.S.), TrpC4 (IL-1ß vs. control, 0.12 ± 0.04 vs. 0.11 ± 0.03, N.S.), or TrpC6 (IL-1ß vs. control, 0.07 ± 0.01 vs. 0.06 ± 0.02, N.S.) protein expression (Figs. 7Go and 8Go, A, C, and D). It was also noted that TrpC1 protein expression was absent in a number of HMSM primary cell cultures (three out of seven). This may be due to the fact that the cells were serum deprived; in other cell types, FCS regulates TrpC1 gene expression (39). TrpC3 was observed to be a doublet; in other cell types, the upper band corresponds to the glycosylated form of the protein (40). TrpC4 protein doublets were also detected, and possibly correspond to TrpC4-{alpha} and TrpC4-ß splice variants (41), previously shown (33).



View larger version (97K):
[in this window]
[in a new window]
  		FIG. 7. Representative Western blots of TrpC1, TrpC3, TrpC4, and TrpC6 protein expression in primary cultured HMSM cells from n = 4 patients. Protein samples were loaded onto the gels in an identical order to enable TrpC expression profiles to be determined. Serum-starved (0.5% FCS) primary HMSM cell cultures were incubated without (control, C) or with IL–1ß (IL) for 24 h. Western blotting detected 90 Mr x 10-3 TrpC1 and TrpC3 proteins and 100 Mr x 10-3 TrpC4 and TrpC6 proteins in HMSM cells. TrpC1, TrpC4, and TrpC6 protein expression was similar between control and IL–1ß-treated cells, whereas TrpC3 protein expression was significantly up-regulated in IL–1ß-treated HMSM cells. TrpC3 and TrpC4 antibodies detected protein doublets.

 


View larger version (13K):
[in this window]
[in a new window]
  		FIG. 8. Graphs depicting mean ± SEM of TrpC isoform Western blot densitometry analysis (n = 7). A, TrpC1 was expressed at a similar level in IL-1ß-treated and control cells. B, TrpC3 protein expression was significantly up-regulated in IL–1ß-treated cells. C, TrpC4 was expressed at a similar level in IL-1ß-treated and control cells. D, TrpC6 was expressed at a similar level in IL-1ß-treated and control cells. *, P <= 0.05.

 
Does IL-1ß regulate TrpC3 protein via COX-2 induction?

To determine whether IL-1ß-induced TrpC3 expression is mediated via COX-2-driven prostaglandin production, primary HMSM cell cultures (n = 3) were incubated with IL-1ß in the presence and absence of the COX-2 inhibitor nimesulide (Fig. 9Go, A and B). TrpC3 protein bands were not detected in untreated control cells, but IL-1ß significantly up-regulated TrpC3 protein expression (IL-1ß vs. control, 0.29 ± 0.05 vs. 0.00 ± 0.00, P <= 0.01). However, this up-regulation was not inhibited by nimesulide (IL-1ß plus nimesulide vs. control, 0.37 ± 0.07 vs. 0.00 ± 0.00, P <= 0.01). There was no significant difference in the level of TrpC3 protein expression between IL-1ß- and IL-1ß-plus-nimesulide-treated cells (IL-1ß vs. IL-1ß + nimesulide, 0.29 ± 0.05 vs. 0.37 ± 0.07, N.S.). Western blotting was also performed for TrpC1, TrpC4, and TrpC6; proteins were expressed at a similar level in control, IL-1ß-, and IL-1ß-plus-nimesulide- and nimesulide-treated cells (data not shown).



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 9. A, Graph depicting mean ± SEM of Western blot densitometry analysis (n = 3). TrpC3 protein expression was significantly up-regulated in IL–1ß-treated cells and cells treated with IL–1ß plus nimesulide (Nim); **, P <= 0.01. B, Representative Western blot of TrpC3 protein expression in primary cultured HMSM cells. Serum-starved (0.5% FCS) primary HMSM cell cultures (n = 3) were incubated without or with IL–1ß, IL–1ß plus nimesulide, or control plus nimesulide for 24 h. Western blotting detected 90 Mr x 10-3 TrpC3 protein in IL–1ß- and also IL–1ß-plus-nimesulide-treated cells; no bands were observed in control or control-plus-nimesulide-treated cells.

 

   Discussion
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
References
 
To our knowledge, this is the first direct demonstration to suggest that TrpC mRNA and protein are modulated by a normal physiological process, because this study has shown a substantial pregnancy related increase in myometrial TrpC isoform expression. We also propose that IL-1ß may play a mechanistic role, because this cytokine induced TrpC3 protein expression in primary cultured HMSM cells.

Gestational changes in TrpC mRNA and protein expression

Overall, the data imply that all the TrpC proteins investigated, putative components of SOCE and non-SOCE channels, are up-regulated in human myometrium during pregnancy and labor when compared with the NP state. Thus our study substantiates, and considerably expands on, an earlier report from our group that demonstrated the presence of TrpC proteins in term nonlaboring myometrium. The changing role of the pregnant uterus encompasses growth and coordinated contractile activity. Whatever the role of the individual TrpC proteins, the general increase of TrpC expression in pregnancy is strongly indicative of a role for these proteins in one or more of these functional adaptations of the uterus to pregnancy.

Of the TrpC isoforms studied, only TrpC6 and TrpC1 mRNA were translated to corresponding increases in protein expression. TrpC1 protein expression increased before labor and was maintained at a similar level during labor. TrpC6 protein expression was higher in labor than NP samples but, in contrast to the mRNA data, was also greater than in nonlaboring myometrium. TrpC3 and TrpC4 proteins were also substantially increased in labor compared with NP and nonlaboring groups, but this was not reflected by an increase in mRNA expression. Interestingly, TrpC1 mRNA and protein was the only isoform to be strongly expressed before labor, suggesting that it may be differentially regulated to other isoforms and perform different functions in myometrium. The simultaneous increase in several TrpC isoforms may have functional importance through de novo SOCE and non-SOCE channel formation because expression levels of individual TrpC proteins are known to influence the composition of heterotetrameric channels and thereby modulate ion permeability and activation properties (18, 23, 42).

The differences between mRNA and protein expression of individual TrpC isoforms require comment because there are a number of potential explanations. For most of the isoforms (TrpC1, 3, and 6), the mRNA expression pattern mirrored protein expression but did not attain significance. This may be due to lack of statistical power, but the sample number was limited by the gel size, and cross gel analysis is not recommended in studies of this kind. Also, a closer association with mRNA and protein may have been observed if the assays had been performed on paired samples. More likely, however, the alterations in gene expression may have occurred in anticipation of delivery, as suggested by Challis (43), and would therefore be undetectable in nonlaboring and laboring samples from women at term. Although mRNA and protein generally showed a similar profile, TrpC4 mRNA expression was distinctly different from protein expression in labor that is indicative of posttranslational modulation. Similarly, TrpC1, 3, 4, and 6 mRNA was detected in NP myometrium, but protein expression is very low, which may again indicate posttranscriptional and/or posttranslational events.

Some of the difference between TrpC protein expression in pregnant and NP myometrium could theoretically be accounted for by differences in cell size (44), which would influence protein content. The magnitude of the difference was, however, far greater than possibly explicable on this basis. Also this cannot provide an explanation for the marked increase in protein expression associated with labor because term tissue will have similar cell size and water content.

The functional impact of altered TrpC protein expression in labor is unknown, because a direct link between TrpC proteins and myometrial contraction has yet to be demonstrated. However, endogenous TrpC1, TrpC3, TrpC4, and TrpC6 proteins have been found to form SOCE and non-SOCE channels in other cell systems (24, 25, 29, 30, 45, 46, 47, 48). Importantly, the up-regulation of TrpC proteins at term and during labor parallels an increase in myometrial SERCA expression (10). Inhibition of SERCA by cyclopiazonic acid induces SOCE, and previous functional studies from our laboratory have shown that cyclopiazonic acid-induced contractions are substantially enhanced in myometrial tissue from women in labor (10). This synchrony of events strongly supports the hypothesis that TrpC proteins form SOCE/non-SOCE channels in human myometrium.

Stimuli for increased TrpC protein expression

The regulation of TrpC protein expression is poorly understood. A few in vitro studies in other cell types have demonstrated up-regulation of TrpC1 and TrpC6 mRNA by serum and growth factors (39, 49, 50, 51), TrpC3 mRNA by ß-estradiol, and progesterone and down-regulation of TrpC4 mRNA by ß-estradiol (52). In pregnancy the most likely candidates are placental steroids, uterine stretch, and inflammatory cytokines. Cytokines (IL-1ß, IL-6, and IL-8) are highly expressed in human myometrial tissue from women in labor (53, 54, 55), and IL-1ß initiates uterine contractions in the primate (56, 57). In the present study, prolonged IL-1ß exposure significantly up-regulated TrpC3 protein expression in primary cultured HMSM cells without altering TrpC3 mRNA expression, indicative of posttranscriptional/translational regulation or alternatively transient changes in mRNA expression before protein evaluation at 24 h. Indeed, other studies have shown a temporal dissociation between IL-1ß-induced COX-2 mRNA and protein expression (36, 58).

The IL-1ß-induced increase in TrpC3 protein expression parallels the up-regulation of SERCA 2b protein expression and enhanced calcium oscillations in primary cultured HMSM cells by the same cytokine, which we have previously reported (15). Up-regulation of basal calcium entry (non-SOCE) and SOCE have been reported in a human embryonic kidney and myometrial cell lines in which TrpC3 is overexpressed (35, 59, 60). Similarly, the increase in TrpC3 protein expression in IL-1ß-treated HMSM cells is associated with a predominant non-SOCE pathway that seems to underlie the initiation of calcium oscillations (15). The link between TrpC3 proteins and calcium oscillations is also supported by a recent antisense study that clearly demonstrated that endogenous TrpC3 proteins facilitate 1-oleoyl-2-acetyl-sn-glycerol (a stable analog of diacyl-glycerol)-induced calcium oscillations in rat embryonic astrocytes (29). Further studies, will determine conclusively whether IL-1ß, and other relevant cytokines, influence TrpC3 expression and contractility in human myometrial biopsies as well as HMSM cells and whether TrpC expression is altered in myometrium from preterm deliveries associated with infection and chorioamnionitis.

The mechanism by which IL-1ß increases TrpC3 protein expression requires elucidation. There is evidence that IL-1ß induces COX-2 expression in HMSM cells (36) and that IL-1ß induced contractions are inhibited by the nonselective COX inhibitor indomethacin (61). We addressed this in the present study by addition of the COX-2 inhibitor nimesulide. The lack of effect of nimesulide on TrpC3 protein expression suggests that IL-1ß-induced TrpC3 expression and, by inference, HMSM cell excitability (15) are COX-2 independent. However, in vivo, TrpC3 proteins could facilitate myometrial activation before, or in tandem with, prostaglandin synthesis, so contributing to the cassette of contraction-associated proteins (43).

In summary, we have shown, for the first time, that TrpC1, TrpC6, and TrpC7 mRNA and TrpC1, TrpC3, TrpC4, and TrpC6 proteins are gestationally regulated in the human myometrium and that IL-1ß exclusively regulates TrpC3 protein expression in primary cultured HMSM cells. Although the functional role remains to be elucidated, this study provides novel molecular evidence for TrpC calcium entry channels in human myometrium.


   Acknowledgments
 
We thank all the women who kindly participated in this study, Ruth Brucker, Julie Adams, Maternal and Fetal Research Unit Myometrial collection team, Guy’s and St. Thomas’ Hospital Trusts, Prof. Steve Thornton, and Walsgrave Hospital Trust labor ward staff. We also thank Jeanette Judah for technical assistance in preparing HMSM cells, Dr. Shirley Astle for RNA isolation, and Prof. David Beech (University of Leeds) for kindly supplying the TIE3 antibody.


   Footnotes
 
This work was funded by the Wellcome Trust (Grant no. 061138) and Tommys’, the baby charity (Reg. Charity no. 1060508).

Abbreviations: COX, Cyclooxygenase; FCS, fetal calf serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HMSM, human myometrial smooth muscle; Mr, relative molecular mass; NP, nonpregnant; N.S., not significant; SERCA, SR calcium ATPases; SOCE, store-operated calcium entry; SR, sarcoplasmic reticulum; TAL, term active labor; TNL, term not in labor; TrpC, transient receptor potential canonical.

Received August 14, 2003.

Accepted December 1, 2003.


   References
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Khan I, Tabb TN, Garfield RE, Grover AK 1993 Expression of the internal calcium pump in pregnant rat uterus. Cell Calcium 14:111–117[CrossRef][Medline]
  2. Mershon JL, Mikala G, Schwartz A 1994 Changes in the expression of the L-type voltage-dependent calcium channel during pregnancy and parturition in the rat. Biol Reprod 51:993–999[Abstract]
  3. Tezuka N, Ali M, Chwalisz K, Garfield RE 1995 Changes in transcripts encoding calcium channel subunits of rat myometrium during pregnancy. Am J Physiol 269:C1008–C1017
  4. Awad SS, Lamb HK, Morgan JM, Dunlop W, Gillespie JI 1997 Differential expression of ryanodine receptor RyR2 mRNA in the nonpregnant and pregnant human myometrium. Biochem J 322:777–783[Medline]
  5. Khan RN, Smith SK, Morrison JJ, Ashford MLJ 1997 Ca2+ dependence and pharmacology of large-conductance K+ channels in nonlabor and labor human uterine myocytes. Am J Physiol 273:C1721–C1731
  6. Taggart MJ, Wray S 1997 Agonist mobilization of sarcoplasmic reticular calcium in smooth muscle: functional coupling to the plasmalemmal Na+/Ca2+. Cell Calcium 22:333–341[CrossRef][Medline]
  7. Taggart MJ, Wray S 1998 Contribution of sarcoplasmic reticular calcium to smooth muscle contractile activation: gestational dependence in isolated rat uterus. J Physiol 511:133–144[Abstract/Free Full Text]
  8. Martin C, Chapman KE, Thornton S, Ashley RH 1999 Changes in the expression of myometrial ryanodine receptor mRNAs during human pregnancy. Biochim Biophys Acta 1451:343–352[Medline]
  9. Collins PL, Moore JJ, Lundgren DW, Choobineh E, Chang SM, Chang AS 2000 Gestational changes in uterine L-type calcium channel function and expression in guinea pig. Biol Reprod 63:1262–1270[Abstract/Free Full Text]
  10. Tribe RM, Moriarty P, Poston L 2000 Calcium homeostatic pathways change with gestation in human myometrium. Biol Reprod 63:748–755[Abstract/Free Full Text]
  11. Kawarabayashi T, Kishikawa T, Sugimori H 1989 Effects of external calcium, magnesium, and temperature on spontaneous contractions of pregnant human myometrium. Biol Reprod 40:942–948[Abstract]
  12. Maigaard S, Forman A, Brogaard-Hansen KP, Andersson KE 1986 Inhibitory effects of nitredipine on myometrial and vascular smooth muscle in human pregnant uterus and placenta. Acta Pharmacol Toxicol (Copenh) 59:1–10[Medline]
  13. Parkington HC, Tonta MA, Brennecke SP, Coleman HA 1999 Contractile activity, membrane potential, and cytoplasmic calcium in human uterine smooth muscle in the third trimester of pregnancy and during labor. Am J Obstet Gynecol 181:1145–1151
  14. Tribe RM 2001 Regulation of human myometrial contractility during pregnancy and labour: are calcium homeostatic pathways important? Exp Physiol 86:247–254[Abstract]
  15. Tribe RM, Moriarty P, Dalrymple A, Hassoni AA, Poston L 2003 Interleukin-1ß induces calcium transients and enhances basal and store operated calcium entry in human myometrial smooth muscle. Biol Reprod 68:1842–1849[Abstract/Free Full Text]
  16. Monga M, Campbell DF, Sanborn BM 1999 Oxytocin-stimulated capacitative calcium entry in human myometrial cells. Am J Obstet Gynecol 181:424–429[CrossRef][Medline]
  17. Parekh AB, Penner R 1997 Store depletion and calcium influx. Physiol Rev 77:901–930[Abstract/Free Full Text]
  18. Minke B, Cook B 2002 TRP channel proteins and signal transduction. Physiol Rev 82:429–472[Abstract/Free Full Text]
  19. McFadzean I, Gibson A 2002 The developing relationship between receptor-operated and store-operated calcium channels in smooth muscle. Br J Pharmacol 135:1–13[CrossRef][Medline]
  20. Steinborn A, Kuhnert M, Halberstadt E 1996 Immunomodulating cytokines induce term and preterm parturition. J Perinat Med 24:381–390[Medline]
  21. Tanaka Y, Narahara H, Takai N, Yoshimatsu J, Anai T, Miyakawa I 1998 Interleukin-1ß and interleukin-8 in cervicovaginal fluid during pregnancy. Am J Obstet Gynecol 179:644–649[CrossRef][Medline]
  22. Groschner K, Hingel S, Lintschinger B, Balzer M, Romanin C, Zhu X, Schreibmayer W 1998 Trp proteins form store-operated cation channels in human vascular endothelial cells. FEBS Lett 437:101–106[CrossRef][Medline]
  23. Nilius B, Droogmans G 2001 Ion channels and their functional role in vascular endothelium. Physiol Rev 81:1415–1459[Abstract/Free Full Text]
  24. Xu S-Z, Beech DJ 2001 TrpC1 is a membrane-spanning subunit of store-operated Ca2+ channels in native vascular smooth muscle cells. Circ Res 88:84–87[Abstract/Free Full Text]
  25. Freichel M, Suh SH, Pfeifer A, Schweig U, Trost C, Weissgerber P, Biel M, Philipp S, Freise D, Droogmans G, Hofmann F, Flockerzi V, Nilius B 2001 Lack of endothelial store-operated Ca2+ current impairs agonist-dependent vasorelaxation in TRP4-/-mice. Nat Cell Biol 3:121–127[CrossRef][Medline]
  26. Inoue R, Okada T, Onoue H, Hara Y, Shimizu S, Naitoh S, Ito Y, Mori Y 2001 The transient receptor potential protein homologue TRP6 is the essential component of vascular {alpha}-(1)-adenoceptor-activated Ca2+ permeable cation channel. Circ Res 88:325–332[Abstract/Free Full Text]
  27. Goel M, Sinkins WG, Schilling WP 2002 Selective association of TRPC channel subunits in rat brain synaptosomes. J Biol Chem 277:48303–48310[Abstract/Free Full Text]
  28. Philipp S, Strauss B, Hirnet D, Wissenbach U, Mery L, Flockerzi V, Hoth M 2003 TRPC3 mediates T-cell receptor-dependent calcium entry in human T-lymphocytes. J Biol Chem 278:26629–26638[Abstract/Free Full Text]
  29. Grimaldi M, Maratos M, Verma A 2003 Transient receptor potential channel activation causes a novel form of [Ca 2+]i oscillations and is not involved in capacitative Ca2+ entry in glial cells. J Neurosci 23:4737–4745[Abstract/Free Full Text]
  30. Wu X, Babnigg G, Zagranichnaya T, Villereal ML 2002 The role of endogenous human Trp4 in regulating carbachol-induced calcium oscillations in HEK-293 cells. J Biol Chem 277:13597–13608[Abstract/Free Full Text]
  31. Torihashi S, Fujimoto T, Trost C, Nakayama S 2002 Calcium oscillation linked to pacemaking of interstitial cells of Cajal: requirement of calcium influx and localization of TRP4 in caveolae. J Biol Chem 277:19191–19197[Abstract/Free Full Text]
  32. Walker RL, Koh SD, Sergeant GP, Sanders KM, Horowitz B 2002 TRPC4 currents have properties similar to the pacemaker current in interstitial cells of Cajal. Am J Physiol Cell Physiol 283:C1637–C1645
  33. Dalrymple A, Slater DM, Beech D, Poston L, Tribe RM 2002 Molecular identification and localization of Trp homologues, putative calcium channels, in pregnant human uterus. Mol Hum Reprod 8:946–951[Abstract/Free Full Text]
  34. Yang M, Gupta A, Shlykov SG, Corrigan R, Tsujimoto S, Sanborn BM 2002 Multiple Trp isoforms implicated in capacitative calcium entry are expressed in human pregnant myometrium and myometrial cells. Biol Reprod 67:988–994[Abstract/Free Full Text]
  35. Shlykov SG, Yang M, Alcorn JL, Sanborn BM 2003 Capacitative cation entry in human myometrial cells and augmentation by hTrpC3 overexpression. Biol Reprod 69:647–655[Abstract/Free Full Text]
  36. Bartlett SR, Sawdy R, Mann GE 1999 Induction of cyclooxygenase-2 expression in human myometrial smooth muscle cells by interleukin-1ß: involvement of p38 mitogen-activated protein kinase. J Physiol 520:399–406[Abstract/Free Full Text]
  37. Kelly BA, Bond BC, Poston L 2003 Gestational profile of matrix metalloproteinases in rat uterine artery. Mol Hum Reprod 9:351–358[Abstract/Free Full Text]
  38. Chan EC, Fraser S, Yin S, Yeo G, Kwek K, Fairclough RJ, Smith R 2002 Human myometrial genes are differentially expressed in labor: a suppression subtractive hybridization study. J Clin Endocrinol Metab 87:2435–2441[Abstract/Free Full Text]
  39. Golovina VA, Platoshyn O, Bailey CL, Wang J, Limsuwan A, Sweeney M, Rubin LJ, Yuan JX 2001 Up-regulated TRP and enhanced capacitative Ca2+ entry in human pulmonary artery myocytes during proliferation. Am J Physiol Heart Circ Physiol 280:H746–H755
  40. Birnbaumer L, Zhu X, Jiang M, Boulay G, Peyton M, Vannier B, Brown D, Platano D, Sadeghi H, Stefani E, Birnbaumer M 1996 On the molecular basis and regulation of cellular capacitative calcium entry: roles for Trp proteins. Proc Natl Acad Sci USA 93:15195–15202[Abstract/Free Full Text]
  41. Mery L, Magnino F, Schmidt K, Krause KH, Dufour JF 2001 Alternative splice variants of hTrp4 differentially interact with the C-terminal portion of the inositol 1, 4, 5-trisphosphate receptors. FEBS Lett 487:377–383[CrossRef][Medline]
  42. Vazquez G, Wedel BJ, Trebak M, John Bird G, Putney Jr JW 2003 Expression level of the canonical transient receptor potential 3 (TRPC3) channel determines its mechanism of activation. J Biol Chem 278:21649–21654[Abstract/Free Full Text]
  43. Challis JRG, Lye SJ 1994 Parturition. In: Knobil E, Neill JD, eds. The physiology of reproduction. New York: Raven Press; 985–1031
  44. Ramsey EM 1994 Anatomy of the human uterus. In: Chard T, Grudzinskas JG, eds. The uterus. Cambridge: Cambridge University Press; 18–40
  45. Rosado JA, Brownlow SL, Sage SO 2002 Endogenously expressed Trp1 is involved in store-mediated Ca2+ entry by conformational coupling in human platelets. J Biol Chem 277:42157–42163[Abstract/Free Full Text]
  46. Liu X, Wang W, Singh BB, Lockwich T, Jadlowiec J, O’Connell B, Wellner R, Zhu MX, Ambudkar IS 2000 Trp1, a candidate protein for the store-operated Ca2+ influx mechanism in salivary gland cells. J Biol Chem 275:3403–3411[Abstract/Free Full Text]
  47. Antoniotti S, Lovisolo D, Fiorio Pla A, Munaron L 2002 Expression and functional role of bTRPC1 channels in native endothelial cells. FEBS Lett 510:189–195[CrossRef][Medline]
  48. Philipp S, Trost C, Warnat J, Rautmann J, Himmerkus N, Schroth G, Kretz O, Nastainczyk W, Cavalie A, Hoth M, Flockerzi V 2000 TRP4 (CCE1) protein is part of native calcium release-activated Ca2+ like channels in adrenal cells. J Biol Chem 275:23965–23972[Abstract/Free Full Text]
  49. Sweeney M, McDaniel SS, Platoshyn O, Zhang S, Yu Y, Lapp BR, Zhao Y, Thistlethwaite PA, Yuan JX 2002 Role of capacitative Ca2+ entry in bronchial contraction and remodeling. J Appl Physiol 92:1594–1602[Abstract/Free Full Text]
  50. Yu Y, Sweeney M, Zhang S, Platoshyn O, Landsberg J, Rothman A, Yuan JX 2003 PDGF stimulates pulmonary vascular smooth muscle cell proliferation by up-regulating TRPC6 expression. Am J Physiol Cell Physiol 284:C316–C330
  51. Tesfai Y, Brereton HM, Barritt GJ 2001 A diacylglycerol-activated Ca2+ channel in PC12 cells (an adrenal chromaffin cell line) correlates with expression of the TRP-6 (transient receptor potential) protein. Biochem J 358:717–726[CrossRef][Medline]
  52. Chang AS, Chang SM, Garcia RL, Schilling WP 1997 Concomitant and hormonally regulated expression of trp genes in bovine aortic endothelial cells. FEBS Lett 415:335–340[CrossRef][Medline]
  53. Elliott CL, Slater DM, Dennes W, Poston L, Bennett PR 2000 Interleukin 8 expression in human myometrium: changes in relation to labor onset and with gestational age. Am J Reprod Immunol 43:272–277[CrossRef][Medline]
  54. Young A, Thomson AJ, Ledingham M, Jordan F, Greer IA, Norman JE 2002 Immunolocalization of proinflammatory cytokines in myometrium, cervix, and fetal membranes during human parturition at term. Biol Reprod 66:445–449[Abstract/Free Full Text]
  55. Osman I, Young A, Ledingham MA, Thomson AJ, Jordan F, Greer IA, Norman JE 2003 Leukocyte density and pro-inflammatory cytokine expression in human fetal membranes, decidua, cervix and myometrium before and during labor at term. Mol Hum Reprod 9:41–45[Abstract/Free Full Text]
  56. Baggia S, Gravett MG, Witkin SS, Haluska GJ, Novy MJ 1996 Interleukin-1ß intra-amniotic infusion induces tumor necrosis factor-{alpha}, prostaglandin production, and preterm contractions in pregnant rhesus monkeys. J Soc Gynecol Invest 3:121–126[CrossRef][Medline]
  57. Sadowsky DW, Gravett MG, Witkin SS, Haluska GJ, Cook MJ, Novy MJ 1999 Does interleukin-10 (IL-10) block interleukin 1b (IL-1b) induced preterm labor in rhesus monkeys? J Soc Gynecol Invest 6:45A
  58. Belt AR, Baldassare JJ, Molnar M, Romero R, Hertelendy F 1999. Am J Obstet Gynecol 181:359–366
  59. Zhu X, Jiang M, Birnbaumer L 1998 Receptor activated Ca2+ influx via human trp3 stably expressed in human embryonic kidney (HEK) 293 cells. J Biol Chem 273:133–142[Abstract/Free Full Text]
  60. Hurst RS, Zhu X, Boulay G, Birnbaumer L, Stefani E 1998 Ionic currents underlying HTRP3 mediated agonist-dependent Ca2+ influx in stably transfected HEK293 cells. FEBS Lett 422:333–338[CrossRef][Medline]
  61. Sadowsky DW, Haluska GJ, Gravett MG, Witkin SS, Novy MJ 2000 Indomethacin blocks interleukin 1ß-induced myometrial contractions in pregnant rhesus monkeys. Am J Obstet Gynecol 83:173–80[CrossRef]



This article has been cited by other articles:


Home page
 J. Neurosci.Home page
N. Alessandri-Haber, O. A. Dina, X. Chen, and J. D. Levine
TRPC1 and TRPC6 Channels Cooperate with TRPV4 to Mediate Mechanical Hyperalgesia and Nociceptor Sensitization
J. Neurosci., May 13, 2009; 29(19): 6217 - 6228.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
J. Abramowitz and L. Birnbaumer
Physiology and pathophysiology of canonical transient receptor potential channels
FASEB J, February 1, 2009; 23(2): 297 - 328.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
D. Liu, D. Yang, H. He, X. Chen, T. Cao, X. Feng, L. Ma, Z. Luo, L. Wang, Z. Yan, et al.
Increased Transient Receptor Potential Canonical Type 3 Channels in Vasculature From Hypertensive Rats
Hypertension, January 1, 2009; 53(1): 70 - 76.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
D. Liu, A. Maier, A. Scholze, U. Rauch, U. Boltzen, Z. Zhao, Z. Zhu, and M. Tepel
High Glucose Enhances Transient Receptor Potential Channel Canonical Type 6-Dependent Calcium Influx in Human Platelets via Phosphatidylinositol 3-Kinase-Dependent Pathway
Arterioscler Thromb Vasc Biol, April 1, 2008; 28(4): 746 - 751.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
A. Dalrymple, K. Mahn, L. Poston, E. Songu-Mize, and R.M. Tribe
Mechanical stretch regulates TRPC expression and calcium entry in human myometrial smooth muscle cells
Mol. Hum. Reprod., March 1, 2007; 13(3): 171 - 179*.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
S. Morales, A. Diez, A. Puyet, P. J. Camello, C. Camello-Almaraz, J. M. Bautista, and M. J. Pozo
Calcium controls smooth muscle TRPC gene transcription via the CaMK/calcineurin-dependent pathways
Am J Physiol Cell Physiol, January 1, 2007; 292(1): C553 - C563.
[Abstract] [Full Text] [PDF]

Home page
 Reproductive SciencesHome page
C. Y. Ku, L. Babich, R. A. Word, M. Zhong, A. Ulloa, M. Monga, and B. M. Sanborn
Expression of Transient Receptor Channel Proteins in Human Fundal Myometrium in Pregnancy
Reproductive Sciences, April 1, 2006; 13(3): 217 - 225.
[Abstract] [PDF]

Home page
 J. Physiol.Home page
K. Noble, J. Zhang, and S. Wray
Lipid rafts, the sarcoplasmic reticulum and uterine calcium signalling: an integrated approach
J. Physiol., January 1, 2006; 570(1): 29 - 35.
[Abstract] [Full Text] [PDF]

Home page
 Reproductive SciencesHome page
B. M. Sanborn, C.-Y. Ku, S. Shlykov, and L. Babich
Molecular Signaling Through G-Protein-Coupled Receptors and the Control of Intracellular Calcium in Myometrium
Reproductive Sciences, October 1, 2005; 12(7): 479 - 487.
[Abstract] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
S. A. Reading, S. Earley, B. J. Waldron, D. G. Welsh, and J. E. Brayden
TRPC3 mediates pyrimidine receptor-induced depolarization of cerebral arteries
Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2055 - H2061.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
J. C. Havelock, P. Keller, N. Muleba, B. A. Mayhew, B. M. Casey, W. E. Rainey, and R. A. Word
Human Myometrial Gene Expression Before and During Parturition
Biol Reprod, March 1, 2005; 72(3): 707 - 719.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dalrymple, A.
Right arrow Articles by Tribe, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dalrymple, A.
Right arrow Articles by Tribe, R. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals