| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Parturition Research Group (A.D., L.P., R.M.T.), Maternal and Fetal Research Unit, Department of Womens Health, Guys, Kings and St. Thomas School of Medicine, St. Thomas Hospital Campus, London, SE1 7EH, United Kingdom; and Biochemical Research Institute (D.M.S.), The University of Warwick, Coventry, CV4 7AL, United Kingdom
Address all correspondence and requests for reprints to: Dr. Rachel M. Tribe, Parturition Research Group, Maternal and Fetal Research Unit, Department of Womens Health, 10th Floor, North Wing, Guys, Kings and St. Thomas School of Medicine, Kings College London, St. Thomas Hospital Campus, Lambeth Palace Road, London, SE1 7EH, United Kingdom. E-mail: rachel.tribe{at}kcl.ac.uk.
| Abstract |
|---|
|
|
|---|
0.01) and TrpC6 (P
0.01) and TrpC7 (P
0.05) in TAL samples. TrpC3 and TrpC4 mRNA expression was unaffected. Western blot demonstrated significant up-regulation of TrpC1 in TAL and TNL (P
0.05) and TrpC3 (P
0.01), TrpC4 (P
0.05), and TrpC6 (P
0.01) in TAL samples. IL1ß did not alter TrpC1, 3, 4, 6, or 7 mRNA expression; but IL1ß exclusively up-regulated TrpC3 protein expression (P
0.05). TrpC3 up-regulation was unaffected by cyclooxygenase blockade. These data demonstrate physiological regulation of TrpC mRNA and protein and suggest an important role for TrpC proteins in human myometrium during labor. | Introduction |
|---|
|
|
|---|
SOCE and non-SOCE (which are closely related to receptor-operated calcium entry) have been described in numerous excitable and nonexcitable cells and provide alternative pathways by which agonists can augment and maintain calcium entry (17, 18, 19). SOCE is activated by depletion of the inositol triphosphate-sensitive sarcoplasmic reticulum (SR) calcium stores. Depletion of the SR calcium stores, and hence SOCE, can be initiated by endogenous agonists binding to G protein-coupled receptors or pharmacologically by agents (cyclopiazonic acid and thapsigargin) that inhibit the SR calcium ATPases (SERCA). Non-SOCE is activated by intermediate signaling molecules (e.g. arachidonic acid and diacylglycerol) of the phospholipase C signaling cascade (17, 18). SOCE/non-SOCE pathways have been described in immortalized pregnant human myometrial cells (16) and in primary cultured human myometrial smooth muscle (HMSM) cells (10, 15). The contribution of SOCE/non-SOCE to human myometrial contractility remains to be fully characterized; however, we have shown that cyclopiazonic acid (which activates SOCE) evokes contractions in term pregnant human myometrium in vitro and that this response is substantially exaggerated in myometrial tissue from women in labor (10). Preliminary evidence from our laboratory has demonstrated that myometrial contractions can be induced after SR calcium store depletion in the presence of a L-type calcium channel inhibitor (14), indicating that other calcium entry pathways exist. We have also reported that the proinflammatory cytokine IL-1ß, which is implicated in the initiation of preterm and term labor (20, 21), induces calcium oscillations and SOCE in primary cultured HMSM cells (15).
The proteins forming SOCE/non-SOCE channels in human myometrium have yet to be identified, but transient receptor potential canonical (TrpC)17 proteins, which are associated with SOCE/non-SOCE in other cells types (22, 23, 24, 25, 26, 27, 28, 29), are potential candidates. TrpC proteins are subdivided into two subgroups on the basis of sequence homology. One subgroup includes TrpC1, TrpC4, and TrpC5; and TrpC3, TrpC6, and TrpC7 form the other. Recent coimmunoprecipitation studies have demonstrated that TrpC proteins form homo- or heteromeric channels in vivo and that functional channels are subgroup specific (27). There is also emerging evidence for an involvement of TrpC proteins in the generation of calcium oscillations and pacemaker activity in smooth muscle (29, 30, 31, 32).
Recent studies have demonstrated that TrpC1, TrpC3, TrpC4, TrpC6, and TrpC7 mRNA and also TrpC1, TrpC3, TrpC4, and TrpC6 proteins are expressed by term human myometrial tissue (33, 34) and primary cultured HMSM cells (33), and overexpression of TrpC3 in human myometrial cells is linked with enhanced SOCE/non-SOCE (35). We hypothesize that if TrpC proteins contribute to SOCE/non-SOCE and contractile activity in HMSM, then TrpC isoforms will show evidence of regulation during pregnancy and labor. Similarly, we would predict the up-regulation of one or more TrpC isoforms in IL-1ß-treated HMSM cells in parallel with the induction of calcium oscillations and non-SOCE/SOCE.
| Subjects and Methods |
|---|
|
|
|---|
Human myometrial biopsies were obtained at cesarean section, with informed written consent and institutional Ethics Committee approval (Walsgrave Hospital Trust, Coventry, UK and Guys and St. Thomas Hospital Trusts, London, UK) in accordance with the principles set out in the Declaration of Helsinki. Biopsies were collected for RNA isolation (Walsgrave Hospital Trust) from women without underlying disease at term not in labor (TNL, n = 7, 3740 wk; indications: maternal request, breech presentation, previous section, or placental praevia) and term in active labor [TAL, n = 5, 3941 wk; indications: failure to progress (without syntocin or prostaglandin administration), fetal distress, or previous section]. Biopsies were also collected for protein isolation (Guys and St. Thomas Hospital Trusts) from women without underlying disease at TNL (n = 5, 3841 wk; indications: breech presentation or previous section) and TAL [n = 5, 3942 wk; indications: failure to progress (without syntocin or prostaglandin administration), fetal distress, or undiagnosed breech]. Myometrium was collected (Guys and St. Thomas Hospital Trusts) from premenopausal nonpregnant (NP) women at the time of hysterectomy for dysmenorrhea and used for RNA (n = 3) and protein isolation (n = 3). After collection, samples were snap frozen. TNL myometrial biopsies (n = 13, 3840 wk, indications: previous section, breech presentation, perforated bowel, or maternal request) were also collected for primary cell culture (Guys and St. Thomas Hospital Trusts).
Cell isolation and primary culture of HMSM cells
HMSM cells were isolated as described previously from TNL myometrial biopsies (10, 33). In initial experiments, confluent primary HMSM cell cultures (from n = 10 women, n = 3 for RNA, and n = 7 for protein isolation) were serum deprived for 24 h [DMEM (Sigma, Poole, UK) plus 0.5% fetal calf serum (FCS; Invitrogen, Paisley, UK)] and then incubated (DMEM, 0.5% FCS, 24 h) with 10 ng/ml IL1ß (stock prepared in DMEM, 0.5% FCS; R&D Systems, Oxon, UK) or DMEM plus 0.5% FCS (control). A second group of experiments were performed to determine the potential influence of cytokine-induced prostaglandin production on TrpC protein expression because IL-1ß also induces cyclooxygenase (COX)-2 and prostaglandin production in HMSM cells (36). Primary HMSM cell cultures (from n = 3 women) were serum deprived (DMEM, 0.5% FCS, 24 h) and then incubated (DMEM, 0.5% FCS, 24 h) either without (controls) or with 10 ng/ml IL1ß or 10 ng/ml IL1ß plus 10 µM nimesulide (COX-2 inhibitor, Sigma) or 10 µM nimesulide alone. The IL1ß concentration used was within the range reported for cervicovaginal secretions of women in term and also preterm labor (20, 21).
RT-PCR
Total RNA was isolated from myometrial tissue using the SV Total RNA Isolation System (Promega, Southampton, UK) as recommended by the manufacturer. RNA was isolated from IL-1ß-treated and control primary HMSM cell cultures using Trizol reagent (Invitrogen Life Technologies). Reverse transcription was carried out using random hexanucleotide primers (0.2 µg) and total RNA (100 ng), which was first denatured at 70 C for 5 min followed by reverse transcription with Superscript II (Invitrogen Life Technologies) at 37 C for 60 min. The resultant cDNA was used as template for PCR with 1.25 U AmpliTaq (conditions as recommended by Applied Bioscience, Cheshire, UK) and 125 ng of 5' and 3' with TrpC gene-specific primers (33). PCR primers (5'-3') were: TrpC1 (sense) ACAGCAAAGCAATGATACCT, (antisense) AAGTCCGAAAGCCAAGTAAA; TrpC3 (sense) GTTGTGGAATGTGCTTGACT, (antisense) TGAAAGGTGGAGGTAATGTT; TrpC4 (sense) CCTGGACATTTTGAAGTTTC, (antisense) CTGCATGGTCAGCAATCAGT; TrpC6 (sense) AGGATGACGCTGATGTGGAG, (antisense) TCCTTCAGTTCCCCTTCGTT; and TrpC7 (sense) ATGCCTTTGGCGACATCGTCTTCA, (antisense) TCCTCATCCAGTATGTACT (33). PCR products were 620 (TrpC1), 722 (TrpC3), 356 (TrpC4), 454 (TrpC6), and 432 (TrpC7) bp (Fig. 1
). Cycling parameters used were: cycles of denaturing at 94 C for 30 sec; annealing at 48 C (TrpC7), 51 C (TrpC4), 54 C (TrpC1), or 57 C (TrpC3 and TrpC6) for 30 sec; extension at 72 C for 30 sec; followed by a final extension of 5 min at 72 C. After amplification, PCR products were analyzed using ethidium bromide-stained agarose gels, subcloned into the pGEM-T Easy vector (Promega) and sequence verified.
|
Western blotting
Human myometrial biopsies were homogenized using an Ultra Turrax T50 homogenizer in 20 µl of homogenization buffer per milligram of tissue [10 mmol/liter HEPES-KOH, pH 7; 1 mmol/liter dithiothreitol; 1% (vol/vol) nonidet-P40 (Sigma) and protease inhibitor cocktail (COMPLETE tablets; Roche Molecular Biochemicals, Lewes, UK)]. Confluent primary cultured HMSM cells were detached from 3-cm culture dishes using 100 µl homogenization buffer (as above). Proteins were separated from cell debris by centrifugation (13,000 x g, 10 min, 4 C) and the protein concentration in all samples determined using BSA as a standard and the DC protein assay kit (Bio-Rad Laboratories Ltd, Herts, UK).
Myometrial tissue proteins (10 µg) and primary cultured HMSM cellular proteins (10 µg) were denatured at 95 C for 10 min in Laemmli sample buffer (Sigma), size separated using Novex 10% Tris-Glycine gels (Invitrogen), and then transferred to polyvinylidene difluoride membrane (Amersham Pharmacia Biotech Ltd, Buckinghamshire, UK). The transfer efficiency and equal loading of protein samples was assessed by incubating membranes with Ponceau red solution (Sigma). After transfer, membranes were washed with PBS-T (PBS, 0.1% Tween-20, Sigma) and incubated (overnight, 4 C) in blocking buffer (PBS-T, 5% goat serum; Chemicon, Harrow, UK) and subsequently incubated (2 h, room temperature) with the desired rabbit polyclonal primary antibody. Primary antibodies used were TrpC1 (25, 1:1000), TrpC3, TrpC4, or TrpC6 (Alomone Labs, Jerusalem, Israel, 1:200), which were diluted in blocking buffer. For the negative controls, membranes were incubated with a 1:1000 dilution of rabbit preimmune serum (TrpC1) or incubated with primary antibodies that were preabsorbed (1 h, room temperature) with the respective peptides (TrpC3, TrpC4, or TrpC6, Alomone Labs, as recommended by the supplier). After incubation with the primary antibody or negative control, membranes were incubated (1 h, room temperature) with a horseradish peroxidase conjugated goat antirabbit secondary antibody (Bio-Rad, diluted 1: 2500 in blocking buffer). Thereafter, membranes were washed in PBS-T (4 x 15 min) and protein bands visualized with ECL (Amersham Pharmacia Biotech Ltd). Hyperfilms were developed before the saturation of TAL samples. TrpC7 protein expression was not investigated because a commercial TrpC7 antibody is currently unavailable.
Statistical analysis
PCR products were quantified using TotalLab software, and Western blotting hyperfilms were analyzed using the Bio-Rad Multi-Analyst, version 1.1 (Bio-Rad, Hemel Hempstead, UK). Both software packages allow calculation of the density of each band and corresponding background values. Final intensity values (arbitrary units) were background subtracted. PCR and Western blotting data were analyzed using ANOVA with Tukey-Kramer multiple-comparison test or Students t test. A value of P
0.05 was considered significant. Data are expressed as mean ± SEM. N refers to numbers of individual myometrial samples or primary cell cultures used and correspond directly to patient number.
| Results |
|---|
|
|
|---|
PCR amplified TrpC1 (620 bp), TrpC3 (722 bp), TrpC4 (356 bp), TrpC6 (454 bp), and TrpC7 (432 bp) products (Fig. 1
) in human myometrial tissue (NP, n = 3; TAL, n = 5; TNL, n = 67). Products were of the expected size and consistent with our previous observations (33). No bands were amplified in reverse-transcribed or PCR-negative controls (data not shown).
Semiquantification demonstrated that TrpC1 mRNA was significantly up-regulated in TAL and TNL myometrium when compared with NP samples (Figs. 1
and 2A
; NP, 0.108 ± 0.015; TAL, 0.164 ± 0.010; TNL, 0.166 ± 0.005; P
0.01). There was no significant difference in TrpC1 mRNA expression between TNL and TAL myometrial samples. The expression level of TrpC3 and TrpC4 mRNA was not significantly different in NP, TAL, and TNL samples [TrpC3 (Figs. 1
and 2B
): NP, 0.051 ± 0.005; TAL, 0.144 ± 0.041; TNL, 0.077 ± 0.010; not significant (N.S.); TrpC4 (Figs. 1
and 2C
): NP, 0.082 ± 0.037; TAL, 0.127 ± 0.022; TNL, 0.190 ± 0.024; N.S.]. TrpC6 was significantly up-regulated in TAL samples when compared with NP samples (P
0.01); there was no significant difference in TrpC6 mRNA expression between NP and TNL and also TAL and TNL myometrial samples (Figs. 1
and 2D
; NP, 0.114 ± 0.004; TAL, 0.319 ± 0.044; TNL, 0.218 ± 0.024). TrpC7 was also significantly up-regulated in TAL samples when compared with NP samples (P
0.05); there was no significant difference in TrpC7 mRNA expression between NP and TNL and also TAL and TNL myometrial samples (Figs. 1
and 2E
; NP, 0.024 ± 0.006; TAL, 0.146 ± 0.032; TNL, 0.121 ± 0.017).
|
Western blotting detected TrpC1 [90 relative molecular mass (Mr x 10-3)], TrpC3 (90 Mr x 10-3), TrpC4 (100 Mr x 10-3), and TrpC6 (100 Mr x 10-3) proteins in pregnant human myometrial tissue (Fig. 3
) as previously reported (33). No bands were observed when the primary antibody was omitted or when primary antibodies were preabsorbed with the appropriate peptide (data not shown).
|
0.05). There was no significant difference in TrpC1 protein expression between TNL and TAL myometrial samples. TrpC3 protein expression was minimal in the NP and TNL myometrium; however, expression was significantly increased in TAL when compared with NP and TNL myometrial samples (Figs. 3
0.01). TrpC4 protein expression was not detected in the NP myometrium, was minimally expressed in TNL myometrium, and was significantly increased in TAL myometrial samples (Figs. 3
0.05). Similarly, TrpC6 protein expression was not detected in the NP myometrium, was minimally expressed in TNL myometrium, but was significantly increased (P
0.01, NP compared with TAL; P
0.05, TAL compared with TNL) in TAL myometrial samples (Figs. 3
|
PCR amplified TrpC1 (620 bp), TrpC3 (722 bp), TrpC4 (356 bp), and TrpC6 (454 bp) products in control and IL1ß-treated primary HMSM cell cultures (n = 3, Fig. 5
). TrpC7 (432 bp) was not expressed in all primary myometrial cell cultures (Fig. 5
), which is consistent with our previous studies (33). IL1ß treatment did not alter TrpC1 (IL-1ß vs. control, 0.052 ± 0.003 vs. 0.076 ± 0.007, N.S.), TrpC3 (IL-1ß vs. control, 0.079 ± 0.009 vs. 0.088 ± 0.014, N.S.), TrpC4 (IL-1ß vs. control, 0.081 ± 0.022 vs. 0.098 ± 0.014, N.S.), TrpC6 (IL-1ß vs. control, 0.129 ± 0.016 vs. 0.158 ± 0.021, N.S.), or TrpC7 (IL-1ß vs. control, 0.036 ± 0.016 vs. 0.053 ± 0.029, N.S.) mRNA expression (Fig. 6
AE, respectively).
|
|
TrpC1, TrpC3, TrpC4, and TrpC6 proteins expressed in primary HMSM cell cultures (Fig. 7
) were of an identical size to that of proteins expressed by human tissue and observed previously in HMSM cells (33). No bands were observed when the primary antibody was omitted or when primary antibodies were preabsorbed with the appropriate peptide (data not shown). IL1ß treatment differentially regulated TrpC isoform protein expression in TNL primary HMSM cell cultures isolated from n = 7 myometrial biopsies. IL1ß significantly up-regulated TrpC3 protein expression compared with control cells (Figs. 7
and 8B
; IL-1ß vs. control, 0.11 ± 0.04 vs. 0.03 ± 0.04, P
0.05) but did not alter TrpC1 (IL-1ß vs. control, 0.09 ± 0.06 vs. 0.07 ± 0.05, N.S.), TrpC4 (IL-1ß vs. control, 0.12 ± 0.04 vs. 0.11 ± 0.03, N.S.), or TrpC6 (IL-1ß vs. control, 0.07 ± 0.01 vs. 0.06 ± 0.02, N.S.) protein expression (Figs. 7
and 8
, A, C, and D). It was also noted that TrpC1 protein expression was absent in a number of HMSM primary cell cultures (three out of seven). This may be due to the fact that the cells were serum deprived; in other cell types, FCS regulates TrpC1 gene expression (39). TrpC3 was observed to be a doublet; in other cell types, the upper band corresponds to the glycosylated form of the protein (40). TrpC4 protein doublets were also detected, and possibly correspond to TrpC4-
and TrpC4-ß splice variants (41), previously shown (33).
|
|
To determine whether IL-1ß-induced TrpC3 expression is mediated via COX-2-driven prostaglandin production, primary HMSM cell cultures (n = 3) were incubated with IL-1ß in the presence and absence of the COX-2 inhibitor nimesulide (Fig. 9
, A and B). TrpC3 protein bands were not detected in untreated control cells, but IL-1ß significantly up-regulated TrpC3 protein expression (IL-1ß vs. control, 0.29 ± 0.05 vs. 0.00 ± 0.00, P
0.01). However, this up-regulation was not inhibited by nimesulide (IL-1ß plus nimesulide vs. control, 0.37 ± 0.07 vs. 0.00 ± 0.00, P
0.01). There was no significant difference in the level of TrpC3 protein expression between IL-1ß- and IL-1ß-plus-nimesulide-treated cells (IL-1ß vs. IL-1ß + nimesulide, 0.29 ± 0.05 vs. 0.37 ± 0.07, N.S.). Western blotting was also performed for TrpC1, TrpC4, and TrpC6; proteins were expressed at a similar level in control, IL-1ß-, and IL-1ß-plus-nimesulide- and nimesulide-treated cells (data not shown).
|
| Discussion |
|---|
|
|
|---|
Gestational changes in TrpC mRNA and protein expression
Overall, the data imply that all the TrpC proteins investigated, putative components of SOCE and non-SOCE channels, are up-regulated in human myometrium during pregnancy and labor when compared with the NP state. Thus our study substantiates, and considerably expands on, an earlier report from our group that demonstrated the presence of TrpC proteins in term nonlaboring myometrium. The changing role of the pregnant uterus encompasses growth and coordinated contractile activity. Whatever the role of the individual TrpC proteins, the general increase of TrpC expression in pregnancy is strongly indicative of a role for these proteins in one or more of these functional adaptations of the uterus to pregnancy.
Of the TrpC isoforms studied, only TrpC6 and TrpC1 mRNA were translated to corresponding increases in protein expression. TrpC1 protein expression increased before labor and was maintained at a similar level during labor. TrpC6 protein expression was higher in labor than NP samples but, in contrast to the mRNA data, was also greater than in nonlaboring myometrium. TrpC3 and TrpC4 proteins were also substantially increased in labor compared with NP and nonlaboring groups, but this was not reflected by an increase in mRNA expression. Interestingly, TrpC1 mRNA and protein was the only isoform to be strongly expressed before labor, suggesting that it may be differentially regulated to other isoforms and perform different functions in myometrium. The simultaneous increase in several TrpC isoforms may have functional importance through de novo SOCE and non-SOCE channel formation because expression levels of individual TrpC proteins are known to influence the composition of heterotetrameric channels and thereby modulate ion permeability and activation properties (18, 23, 42).
The differences between mRNA and protein expression of individual TrpC isoforms require comment because there are a number of potential explanations. For most of the isoforms (TrpC1, 3, and 6), the mRNA expression pattern mirrored protein expression but did not attain significance. This may be due to lack of statistical power, but the sample number was limited by the gel size, and cross gel analysis is not recommended in studies of this kind. Also, a closer association with mRNA and protein may have been observed if the assays had been performed on paired samples. More likely, however, the alterations in gene expression may have occurred in anticipation of delivery, as suggested by Challis (43), and would therefore be undetectable in nonlaboring and laboring samples from women at term. Although mRNA and protein generally showed a similar profile, TrpC4 mRNA expression was distinctly different from protein expression in labor that is indicative of posttranslational modulation. Similarly, TrpC1, 3, 4, and 6 mRNA was detected in NP myometrium, but protein expression is very low, which may again indicate posttranscriptional and/or posttranslational events.
Some of the difference between TrpC protein expression in pregnant and NP myometrium could theoretically be accounted for by differences in cell size (44), which would influence protein content. The magnitude of the difference was, however, far greater than possibly explicable on this basis. Also this cannot provide an explanation for the marked increase in protein expression associated with labor because term tissue will have similar cell size and water content.
The functional impact of altered TrpC protein expression in labor is unknown, because a direct link between TrpC proteins and myometrial contraction has yet to be demonstrated. However, endogenous TrpC1, TrpC3, TrpC4, and TrpC6 proteins have been found to form SOCE and non-SOCE channels in other cell systems (24, 25, 29, 30, 45, 46, 47, 48). Importantly, the up-regulation of TrpC proteins at term and during labor parallels an increase in myometrial SERCA expression (10). Inhibition of SERCA by cyclopiazonic acid induces SOCE, and previous functional studies from our laboratory have shown that cyclopiazonic acid-induced contractions are substantially enhanced in myometrial tissue from women in labor (10). This synchrony of events strongly supports the hypothesis that TrpC proteins form SOCE/non-SOCE channels in human myometrium.
Stimuli for increased TrpC protein expression
The regulation of TrpC protein expression is poorly understood. A few in vitro studies in other cell types have demonstrated up-regulation of TrpC1 and TrpC6 mRNA by serum and growth factors (39, 49, 50, 51), TrpC3 mRNA by ß-estradiol, and progesterone and down-regulation of TrpC4 mRNA by ß-estradiol (52). In pregnancy the most likely candidates are placental steroids, uterine stretch, and inflammatory cytokines. Cytokines (IL-1ß, IL-6, and IL-8) are highly expressed in human myometrial tissue from women in labor (53, 54, 55), and IL-1ß initiates uterine contractions in the primate (56, 57). In the present study, prolonged IL-1ß exposure significantly up-regulated TrpC3 protein expression in primary cultured HMSM cells without altering TrpC3 mRNA expression, indicative of posttranscriptional/translational regulation or alternatively transient changes in mRNA expression before protein evaluation at 24 h. Indeed, other studies have shown a temporal dissociation between IL-1ß-induced COX-2 mRNA and protein expression (36, 58).
The IL-1ß-induced increase in TrpC3 protein expression parallels the up-regulation of SERCA 2b protein expression and enhanced calcium oscillations in primary cultured HMSM cells by the same cytokine, which we have previously reported (15). Up-regulation of basal calcium entry (non-SOCE) and SOCE have been reported in a human embryonic kidney and myometrial cell lines in which TrpC3 is overexpressed (35, 59, 60). Similarly, the increase in TrpC3 protein expression in IL-1ß-treated HMSM cells is associated with a predominant non-SOCE pathway that seems to underlie the initiation of calcium oscillations (15). The link between TrpC3 proteins and calcium oscillations is also supported by a recent antisense study that clearly demonstrated that endogenous TrpC3 proteins facilitate 1-oleoyl-2-acetyl-sn-glycerol (a stable analog of diacyl-glycerol)-induced calcium oscillations in rat embryonic astrocytes (29). Further studies, will determine conclusively whether IL-1ß, and other relevant cytokines, influence TrpC3 expression and contractility in human myometrial biopsies as well as HMSM cells and whether TrpC expression is altered in myometrium from preterm deliveries associated with infection and chorioamnionitis.
The mechanism by which IL-1ß increases TrpC3 protein expression requires elucidation. There is evidence that IL-1ß induces COX-2 expression in HMSM cells (36) and that IL-1ß induced contractions are inhibited by the nonselective COX inhibitor indomethacin (61). We addressed this in the present study by addition of the COX-2 inhibitor nimesulide. The lack of effect of nimesulide on TrpC3 protein expression suggests that IL-1ß-induced TrpC3 expression and, by inference, HMSM cell excitability (15) are COX-2 independent. However, in vivo, TrpC3 proteins could facilitate myometrial activation before, or in tandem with, prostaglandin synthesis, so contributing to the cassette of contraction-associated proteins (43).
In summary, we have shown, for the first time, that TrpC1, TrpC6, and TrpC7 mRNA and TrpC1, TrpC3, TrpC4, and TrpC6 proteins are gestationally regulated in the human myometrium and that IL-1ß exclusively regulates TrpC3 protein expression in primary cultured HMSM cells. Although the functional role remains to be elucidated, this study provides novel molecular evidence for TrpC calcium entry channels in human myometrium.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: COX, Cyclooxygenase; FCS, fetal calf serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HMSM, human myometrial smooth muscle; Mr, relative molecular mass; NP, nonpregnant; N.S., not significant; SERCA, SR calcium ATPases; SOCE, store-operated calcium entry; SR, sarcoplasmic reticulum; TAL, term active labor; TNL, term not in labor; TrpC, transient receptor potential canonical.
Received August 14, 2003.
Accepted December 1, 2003.
| References |
|---|
|
|
|---|
-(1)-adenoceptor-activated Ca2+ permeable cation channel. Circ Res 88:325332
, prostaglandin production, and preterm contractions in pregnant rhesus monkeys. J Soc Gynecol Invest 3:121126[CrossRef][Medline]
This article has been cited by other articles:
![]() |
N. Alessandri-Haber, O. A. Dina, X. Chen, and J. D. Levine TRPC1 and TRPC6 Channels Cooperate with TRPV4 to Mediate Mechanical Hyperalgesia and Nociceptor Sensitization J. Neurosci., May 13, 2009; 29(19): 6217 - 6228. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Abramowitz and L. Birnbaumer Physiology and pathophysiology of canonical transient receptor potential channels FASEB J, February 1, 2009; 23(2): 297 - 328. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Liu, D. Yang, H. He, X. Chen, T. Cao, X. Feng, L. Ma, Z. Luo, L. Wang, Z. Yan, et al. Increased Transient Receptor Potential Canonical Type 3 Channels in Vasculature From Hypertensive Rats Hypertension, January 1, 2009; 53(1): 70 - 76. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Liu, A. Maier, A. Scholze, U. Rauch, U. Boltzen, Z. Zhao, Z. Zhu, and M. Tepel High Glucose Enhances Transient Receptor Potential Channel Canonical Type 6-Dependent Calcium Influx in Human Platelets via Phosphatidylinositol 3-Kinase-Dependent Pathway Arterioscler. Thromb. Vasc. Biol., April 1, 2008; 28(4): 746 - 751. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dalrymple, K. Mahn, L. Poston, E. Songu-Mize, and R.M. Tribe Mechanical stretch regulates TRPC expression and calcium entry in human myometrial smooth muscle cells Mol. Hum. Reprod., March 1, 2007; 13(3): 171 - 179*. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Morales, A. Diez, A. Puyet, P. J. Camello, C. Camello-Almaraz, J. M. Bautista, and M. J. Pozo Calcium controls smooth muscle TRPC gene transcription via the CaMK/calcineurin-dependent pathways Am J Physiol Cell Physiol, January 1, 2007; 292(1): C553 - C563. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Y. Ku, L. Babich, R. A. Word, M. Zhong, A. Ulloa, M. Monga, and B. M. Sanborn Expression of Transient Receptor Channel Proteins in Human Fundal Myometrium in Pregnancy Reproductive Sciences, April 1, 2006; 13(3): 217 - 225. [Abstract] [PDF] |
||||
![]() |
K. Noble, J. Zhang, and S. Wray Lipid rafts, the sarcoplasmic reticulum and uterine calcium signalling: an integrated approach J. Physiol., January 1, 2006; 570(1): 29 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Sanborn, C.-Y. Ku, S. Shlykov, and L. Babich Molecular Signaling Through G-Protein-Coupled Receptors and the Control of Intracellular Calcium in Myometrium Reproductive Sciences, October 1, 2005; 12(7): 479 - 487. [Abstract] [PDF] |
||||
![]() |
S. A. Reading, S. Earley, B. J. Waldron, D. G. Welsh, and J. E. Brayden TRPC3 mediates pyrimidine receptor-induced depolarization of cerebral arteries Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2055 - H2061. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Havelock, P. Keller, N. Muleba, B. A. Mayhew, B. M. Casey, W. E. Rainey, and R. A. Word Human Myometrial Gene Expression Before and During Parturition Biol Reprod, March 1, 2005; 72(3): 707 - 719. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |