| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Clinical Sciences (North) (A.M., M.M., I.R.W., R.J.M.R.), University of Sheffield, Sheffield S5 7AU, United Kingdom; Department of Endocrinology (L.M., C.C.-H., M.O.S., A.J.L.C.), Barts & the London, Queen Mary University of London, London EC1A 7BE, United Kingdom; Hospital Sant Pau (M.J.B., S.M.W.), Autonomous University of Barcelona, Spain; and Department of Medicine (C.M.B.), Ludwig-Maximilians University, Munich 80336, Germany
Address all correspondence and requests for reprints to: Professor Richard J. M. Ross, Clinical Sciences, Northern General Hospital, Sheffield, S5 7AU, United Kingdom. E-mail: r.j.ross{at}sheffield.ac.uk.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The mature wild-type human GHR (GHRwt) is 620 amino acids long, possessing 246 extracellular amino acids, a 24-amino-acid transmembrane spanning region, and 350 cytoplasmic amino acids (3) (Fig. 1B
). The GHR lacks intrinsic kinase activity and relies on the regulation and activation of cytosolic Janus kinase 2 (Jak2). Jak2 is constitutively associated with the receptor at the proline-rich Box1 site (amino acids 276287), and it is thought that ligand binding may stabilize the preformed receptor-Jak2 complex (4, 5). Box2 (amino acids 325338) of the GHR is thought to be required for full activation of Jak2 by GH (5, 6). GH binding results in a conformational change in the receptor dimer and transphosphorylation of associated Jak2 (4). After GH stimulation, phosphorylated Jak2 has been reported to activate the signal transducer and activator of transcription proteins (Stat)1, Stat3, Stat5 (7, 8, 9), and the MAPK pathway including Erk1/2, p38, and Jnk (10, 11, 12). Stat5 requires anchorage to tyrosines 469 and/or 516 of the GHR for activation (13); whereas Stat1, Stat3, and MAPK are activated via Jak2, independent of any direct association with the GHR.
|
We have identified an adult female patient and her brother with GHIS due to a homozygous mutation in the GHR, resulting in a GHR truncated after Box1. We present clinical and in vitro data from studies of this novel mutation in the GHR.
| Patients and Methods |
|---|
|
|
|---|
Hormone assays
Serum C-peptide, GH, and insulin were measured by automated immunoassays (Immulite 2000, Diagnostic Products Corp, Los Angeles, CA). Plasma IGF-1 concentration was determined by an enzymatically amplified two-step sandwich immunoassay (Active IGF-1 ELISA, Diagnostic Systems Labs, Inc., Webster, TX). GHBP was measured by both charcoal precipitation (20) and the ligand immunoflurometric assay method (21).
Genetic analysis
To amplify each exon of the GHR gene (in both patients), PCR was performed using primers directed to intronic sequences in a total vol of 50 µl (primer sequences available on request). The reaction mixture contained 100 ng DNA template, 1x PCR buffer (Sigma Genosys, Poole, UK), 200 µM each deoxynucleotide triphosphate, 200 nM each primer, and 1 U Taq DNA polymerase (Sigma Genosys). After an initial denaturation step of 5 min at 95 C, PCR cycling was performed for 30 cycles of 95 C for 30 sec, 55 C for 30 sec, and 72 C for 1 min, followed by a final extension step at 72 C for 5 min. All amplified fragments were purified by spin columns (Qiagen, Crawley, Sussex, UK) and sequenced using the ABI Prism Big Dye Sequencing kit and an ABI 377 automated DNA sequencer (Applied Biosystems, Foster City, CA) as per the manufacturers instructions.
Messenger RNA was extracted from skin fibroblasts of the female patient by the RNAzol B method according to the manufacturers instructions (Tel Test, Friendswood, TX). cDNA was generated in a reaction mixture containing 5 µg mRNA, 1x M-MLV reverse transcriptase buffer (Promega, Southampton, UK), 200 µM deoxynucleotide triphosphates, 250 ng random hexamers, and 1 U M-MLV reverse transcriptase (Promega). PCR amplification was achieved using primers within exons 9 and 10.
Plasmids
The full-length GHRwt subcloned into pcDNA1/amp (Invitrogen, Paisley, UK) was previously described (22). The truncated GHR1449 expression plasmid was derived from the reverse transcription of messenger RNA (mRNA) from the female patients skin fibroblasts, amplified by PCR using primers in exons 9 and 10 of the GHR transcript [primers: GHRS1ECOR1 (AAACCCGAATTCCACAGTGATG) and GHRASSMA1 (TTTTGGCCCGGGGAAAGGACC)] and both the product and vector (pcDNA1) digested with the enzymes EcoR1 and Sma1 before ligation. The construct was sequenced using the automatic sequencing process and matched 100% to the mRNA isolated from the patient (data not shown). The reporter plasmids, Stat5/Stat3 responsive luciferase reporter vector containing the lactogenic hormone response element LHRE-TK-luc, the internal control of transfection IEP-ß galactosidase-CMV, and the expression plasmid for Stat3 have been described previously (23).
Cell culture and transfection
Human embryonic kidney (HEK293) cells and Chinese hamster ovary (CHO) cells were routinely grown, respectively, in DMEM Nut F12 medium and Nutrient mixture F12 (Hams) supplemented with 10% fetal calf serum, 100 IU penicillin, and 100 µg/ml Streptomycin, 2 mg/ml fungizone, 2 mM L-glutamine, and buffered with HEPES (all GIBCO BRL, Paisley, UK), and routinely grown at 37 C in a 95% humidified atmosphere of 5% CO2. Transfection of HEK293 cells was performed using a calcium phosphate transfection kit (GIBCO BRL) and transfection of CHO cells using the LT1 transfection kit (Mirus, Madison, WI), according to the manufacturers instructions.
Reporter assays
GHRhi, a stable clone of HEK293 cells expressing high levels of the GHRwt, described previously (24), was used to examine the effect of GHR1449 on GHRwt signaling. GHRhi cells were transfected with 5 µg GHR1449 or empty vector, 1.5 µg lactogenic hormone response element/TK-Luc, and 0.25 µg of a ß-galactosidase expression vector per plate. Sixteen hours later, the cells were stimulated with GH in the presence of 0.5 µM dexamethasone (dexamethasone augments the response through an action on Stat5). The cells were harvested and assayed for luciferase and ß-galactosidase activities using Promega kits (Promega). Luciferase activity was normalized using ß-galactosidase activities to adjust for transfection efficiency between samples. The data are presented as fold induction (mean + SEM).
GH binding
HEK293 cells were transfected with 3 µg GHR expression plasmids and cells incubated in serum free medium 12 h before binding. Cells were then washed with PBS containing 1% BSA, and incubated with I125-labeled GH (105 cpm/well) (Novo Nordisk, Bagsvaerd, Denmark) for 3 h at room temperature in the absence (total binding) or presence (nonspecific binding) of excess unlabeled human GH (hGH) (2 µg) (Genotropin, Pharmacia and Upjohn, Milton Keynes, UK). The cells were washed in the same buffer and solubilized in 1 mol/liter NaOH for counting radiation on a
-counter.
FACS
HEK293 cells (4 x 105 cells) were transfected with 3 µg GHR expression plasmid. After preincubation in FCS free DMEM Nut F-12 (GIBCO BRL) for 2 h, cells were dislodged from the culture dish using cell dissociation solution (Sigma Genosys). HEK293 cells were suspended in 600 µl PBS 1% BSA (washing buffer). Cells (100 µl) were incubated with 5 µg of an anti-GHR Ab (2C8) or isotype-matched negative control Ab (R&D Systems, Abingdon, UK) for 30 min on ice. Primary antibody binding was detected by incubation with biotinylated goat antimouse IgG polyclonal Ab (1 µg; Calbiochem, Nottingham, UK), followed by incubation with Streptavidin-R.Phycoerythrin 3 conjugate (10 µl; Serotec, Oxford, UK) for 30 min on ice. Flow cytometry was performed using a FACScan flow cytometer (BD Biosciences, Oxford, UK) and CellQuest data acquisition and analysis software.
Immunofluorescence
Immunofluorescence was performed on fixed cells to determine the cellular distribution of GHR. Labeling was carried out on CHO cells expressing either GHRwt or the mutated receptor GHR1449. Cells were fixed in 2% paraformaldehyde for 15 min and permeabilized or not with Triton X-100 (0.1% in 2% paraformaldehyde) for 2 min. After blocking in PBS 5% goat serum plus 0.1% saponin, the cells were incubated with the anti-GHR extracellular domain 2C8 monoclonal antibody (10 µg/ml) in antibody buffer (PBS 1% goat serum, 0.1% BSA, 0.1% saponin). After washing, cells were incubated with biotinylated Fab fragment of goat antimouse antibody and streptavidin alexa 488 (both Molecular Probes) (Eugene, OR) and slides mounted in vectashield mounting medium (Vector Laboratories UK, Peterborough, UK). Fluorescence was detected using a Molecular Dynamics CLSM2010 confocal fluorescent microscope (Amersham Pharmacia Biotech, Little Chalfont, UK). Cells were excited at 488 nm, and detection was through a 530-nm band pass filter.
Western blotting
CHO cells transfected with GHR expression plasmids were starved overnight in FCS free nutrient mixture F12 (Hams) and stimulated at 37 C with GH (500 ng/ml). Cells were harvested at 2 min (Jak2), 10 min (Erk1/2), 15 min (Stat3), or 30 min (Stat5, in the presence of 0.5 µM dexamethasone). Cells were washed in 5 ml PBS, 1 mM sodium orthovanadate and lysed. For Jak2 and Stat5, lysates were immunoprecipitated with 15 µl anti-Jak2 (Santa Cruz Biotechnology, Santa Cruz, CA) or 10 µl anti-Stat5 (Santa Cruz Biotechnology) and 20 µl protein A Sepharose 4B fast flow beads (Sigma Genosys). Proteins were separated on a 7.5% SDS-PAGE gel and blotted onto polyvinylidene difluoride membrane. For visualization, membranes were probed with a species-specific secondary antibody conjugated to horseradish peroxidase, and detection of binding was performed by chemiluminescent detection (enhanced chemiluminescence) according to the manufacturers instructions (Amersham Pharmacia Biotech). Phosphorylation of Jak2 and Stat5 was detected with an antiphosphotyrosine antibody (4G10) (1;2500) (UBI, Lake Placid, NY). Stat3, and Erk1/2 blots were performed on crude lysate, with antiphospho Stat3(Tyr705) (Cell Signaling Technology, Beverley, MA), or antiphospho Erk1/2 (UBI). All blots were reprobed for total Jak2, Stat5, Stat3, or Erk1/2. Blots shown are representative of at least three individual experiments.
| Results |
|---|
|
|
|---|
The index case was a 53-yr-old woman initially seen at age 47 with a toxic thyroid nodule, when she was noted to be of short stature. She was treated with I-131; she has remained euthyroid since. She had regular menstrual cycles until menopause at age 51 (FSH value, 80 mIU/liter). The patient had a 57-yr-old brother whose height was 140 cm [SD score (SDS), -6], presenting with a similar phenotype, and a 60-yr-old sister who was phenotypically normal, with a height of 152 cm (SDS, -2.1). Both patients were single, without offspring, and of normal intelligence. The brother had a normal puberty and normal gonadal development. Their parents, deceased, were phenotypically normal. The family came from a remote region of the Spanish province of Teruel (Tronchón). Although no consanguinity was reported, both grandmothers had the same surname.
The index patient had a height of 114 cm (SDS, -8.7), weight of 40.25 kg, central obesity, BMI of 30.7 kg/m2 (normal < 25), a waist/hip ratio of 1.13 (normal < 0.8), and a high-pitched voice. Dual-energy x-ray absorptiometry scanning confirmed high body fat (51.3% of total body composition, normal 29.7 ± 5.6%); lean plus bone mineral content was low (48%, normal 72.7 ± 5.0), demonstrating low absolute lean body mass, because bone mineral density and content were within the age-matched normal range (0.907 g/cm2 and 948.36 g; Z-score, -1.4 SD; T-score, -2.2 SD). Total cholesterol was initially elevated (8.6 mmol/liter), as was low-density lipoprotein cholesterol (5.74 mmol/liter), with normal triglycerides (1.1 mmol/liter), high-density pipoprotein cholesterol (1.81 mmol/liter), and very-low-density lipoprotein cholesterol (0.49 mmol/liter). Treatment with simvastatin (10 mg/d) induced a decrease of cholesterol to 6.4 mmol/liter. Circulating blood glucose was 4.9 mmol/liter (normal < 6.4); immunoreactive insulin, 53 pmol/liter [normal range (N) < 216]; and C-peptide, 656 pmol/liter (N = 300600), with a normal oral glucose tolerance test. HbA1C was 6.1%. The homeostasis assessment model index (insulin x glucose/22.5) was 11.54, i.e. higher than that in an age-matched normal subject, 3.0210.86 (25, 26), suggestive of insulin resistance compatible with her central obesity. She had an exaggerated response of GH to insulin hypoglycemia (GH peak, 45 µg/liter). Both the index patient and her brother had very low IGF-l (8.0 and 38.8; N 54389 and 54290 µg/liter, respectively) and IGFBP-3 (16 and 30; N 61254 and 61196 nmol/liter, respectively) levels. GHBP in the index patient was 6.8% (normal >10%) by charcoal precipitation and less than 100 pM, (<1st centile) by ligand immunoflurometric assay.
Genetic analysis
Sequencing of the nine GHR coding exons (exons 210) revealed a homozygous 22-bp deletion in exon 10. The predicted consequence of this is a frameshift introducing novel codons from position 424449 and a premature termination codon at 450 (Fig. 1C
). The protein resulting from this would be truncated and lack a large portion of the intracellular domain. In the truncated protein, the membrane proximal region containing Box1 and Box2, critical for JAK2 and STAT3 activation, is intact; but GHR1449 lacks the C-terminal portion, including tyrosine residues essential for STAT5 activation (Fig. 1B
).
To investigate the possibility that non-sense mRNA degradation was the cause of GHIS in these patients, RT-PCR using primers directed to exons 9 and 10 was performed on mRNA from fibroblasts of the female patient. This demonstrated an amplification product of the predicted size and sequence, indicating that the defect does not lie at the mRNA level (data not shown).
GHR expression
GHR1449 binds GH at the cell surface at levels similar to that of GHRwt.
GHR1449 and GHRwt were transfected into HEK293 cells, and binding at the cell surface was detected using iodinated hGH-I125 (Fig. 2
). GHR1449 consistently showed a similar level of binding to GHRwt.
|
|
|
GHR1449 is able to signal through Jak2.
CHO cells were transfected with plasmids expressing GHR1449 or GHRwt and stimulated with 500 ng/ml GH (this dose of GH provides a maximal response, data not shown). Pilot studies showed that maximal Jak2 phosphorylation occurred at 2 min (data not shown). GH induced Jak2 phosphorylation in cells expressing both GHRwt and GHR1449 (Fig. 5
).
|
GHR1449 activates Stat3.
The capacity of GHR1449 to signal through Stat3 was analyzed by transfecting CHO cells with either GHR1449 or GHRwt and stimulating with 500 ng/ml GH for 15 min. A Stat3 expression plasmid was also cotransfected, because the level of endogenous Stat3 phosphorylation was seen to be minimal in earlier experiments (data not shown). Immunoblotting of lysate with an antiphospho Stat3 antibody showed greater fold activation of Stat3 for GHR1449 compared with GHRwt (Fig. 5
), although the cells transfected with GHRwt consistently showed a greater background activation of Stat3.
GHR1449 has reduced lactogenic hormone response element activation through the Stat5/Stat3 response element.
To further explore the relationship between GHR1449 and GHRwt on Stat5 and Stat3 signaling, GHR1449 was transfected into HEK293 cells, stably expressing a high level of GHRwt (GHRhi). The Stat5/Stat3 responsive reporter LHRE/TK-luc was used as an indicator of signaling. In the absence of mutated receptor expression, a 6-h exposure to GH induces a dose-dependent increase in luciferase activity compared with unstimulated cells. The transfection of GHR1449 into cells already expressing the GHRwt demonstrated reduced luciferase induction throughout the dose-response curve, with a maximum reduction of 2.5-fold at 500 ng/ml (P < 0.05) (Fig. 6
).
|
| Discussion |
|---|
|
|
|---|
Despite low exposure to IGF-1, bone mineral density in this perimenopausal patient with GHIS was within normal limits. This is compatible with previous reports of patients with GHIS who have a normal apparent bone mineral density (27). Fat mass was 2-fold higher and lean body mass markedly lower than normal in our patient. Furthermore, her body fat distribution was central, with a high waist/hip ratio; together with unfavorable serum lipid profile in both the patient and her brother (who was also a smoker and required coronary bypass surgery in his fifties), this suggests an increased cardiovascular risk as previously described (28); glucose tolerance was normal but her homeostasis assessment model index (an index of insulin resistance) was above that found in normal subjects (26), although this would be compatible with her central obesity.
The only other example of an exon 10 mutation is a deletion of a single base that gives rise to 20 novel amino acids after Box1 (at codon 310) and premature termination at codon 330 (16). The patient in this case was a compound heterozygote for the exon 10 mutation and E224X exon 7 mutation in the extracellular domain. No detectable GHBP was found in that case; and in studies on the father, a heterozygote for the exon 10 mutation, only wild-type mRNA was produced. Hence, it was concluded that the exon 10 mutated mRNA is unstable. Some mutations in the GHR result in a defect in expression level (29), but this is not the case with GHR1449. RT-PCR from the patients fibroblasts confirmed that the mutant GHR mRNA was expressed. Furthermore, our experiments showed levels of GHR1449 binding similar to those of the GHRwt, demonstrating that the 22-bp deletion in GHR1449 does not affect either receptor expression, or trafficking to the cell surface. In addition, immunocytochemistry showed GHR1449 and GHRwt to possess similar intracellular and cell surface localization and distribution to GHRwt. GHR1449 was associated with a low, but detectable, serum GHBP in the index patient. The significance of this is not clear, because generally levels of GHBP have been related to level of GHR expression. It might be predicted that our patient would have normal levels of GHBP, because GHR1449 is expressed at the cell surface. However, GHR proteolysis can be inhibited by GH, because the dimerized receptor is resistant to cleavage (30). Our patient had high GH levels, and the GHR would be expected to dimerize; thus this may reduce GHBP levels in patients with the GHR1449 mutation. Additionally obese postmenopausal women have lower GHBP levels; although in this situation, there are low GH levels in contrast to GHI (31).
The signaling capacity for GHR1449 could be predicted from the mutation. Box1 on the GHR is the binding site for Jak2 and is retained in GHR1449. Jak2 is a key mediator in GH-induced signaling and is phosphorylated upon GH binding and dimerization of GHR, inducing a phosphorylation cascade leading to the activation of a number of different signaling pathways (7, 8, 9, 10, 11, 12). As predicted, Western blotting confirmed that GHR1449 could phosphorylate Jak2.
Two forms of Stat5, Stat5a and Stat5b, have been shown to exist in a variety of cell types, encoded by two different genes possessing greater than 90% homology in the coding sequences (32, 33, 34, 35). Generation of Stat5a/b knockout mice has been shown to result in mice significantly reduced in size, in both sexes, and correlated with reduced levels of IGF-1 (36), and the Stat5b knockout suggests that Stat5b mediates the sexually dimorphic effects of GH pulses in the rat (37). Before Stat5 can be phosphorylated by GH, it must first bind via its SH2 domain to specific phospho-tyrosyl residues in the cytoplasmic domain of the GHR. Mutating the conserved arginine in the floor of the SH2 pocket to a glycine has been shown to abort the capacity of Stat5 to bind to the GHR. Tyrosines 469 and/or 516 have been implicated in the rabbit GHR, sites which are homologous to tyrosines 469 and 516 of the human GHR (13). Knowing that the tyrosine sites 469 and 516 were not available on GHR1449, due to premature termination of the GHR, we wished to verify that no Stat5 activity would be generated by this receptor. In transfected CHO cells, GHRwt activated Stat5, but no activation was seen in cells transfected with GHR1449.
In contrast to Stat5, Stat3 does not require phosphorylated tyrosine residues in the carboxyl terminal domain of the GHR to be activated by JAK2, and only requires the membrane proximal region of the GHR necessary for binding and transphosphorylation of Jak2 (13, 38). Jak2 is known to contain two Stat3 association motifs (YXXQ), obviating the need for a direct GHR/Stat3 association for Stat3 phosphorylation to occur. Using truncated GHRs, Stat3 activation has been shown to remain high, provided Box1 is still present (13). Generation of GHR possessing Box1 mutations results in abolition of Stat3 activity (38). In our experiments, GHR1449, possessing Box1 and Jak2 activity was shown to induce a higher fold induction of Stat3 compared with GHRwt, although GHRwt had a higher background activation of Stat3. The reason for the greater background activation of Stat3 by GHRwt is not clear, although it is possible that the unliganded GHRwt, which is in a preformed dimer, can partially activate Stat3.
To confirm that GHR1449 could not signal through Stat5, we cotransfected GHR1449 and the Stat5/Stat3 reporter LHRE/TK-luc into HEK293 cells, stably expressing a high level of GHRwt (GHRhi). Inhibition of luciferase induction was seen throughout the dose-response curve, with a maximum inhibition of 2.5-fold at 500 ng/ml. We suggest that the partial activation of LHRE observed for GHR1449 may be due to the ability of GHR1449 to signal through Stat3, while signaling through Stat5 is abolished.
Activation of the MAPK Erk1/2 pathway is known to occur through a well-established pathway involving SHC, Grb2, SOS, Ras, Raf, and MAP/Erk kinase (39, 40). It is now known that upon GH stimulation SHC interacts with phosphorylated Jak2, leading to the initiation of this pathway. In addition, the coexpression of dominant negative forms of H-Ras and Raf-1 inhibit Erk2 activation in HEK293 cells (41). Our experiments demonstrated that GHR1449 retained the ability to signal through the Erk2 pathway in a manner similar to that of GHRwt.
In conclusion, GHR1449 was seen to show cell surface expression at levels similar to that of GHRwt, suggesting that this mutation does not affect receptor expression, trafficking to the cell surface, or its ability to bind circulating GH. For GHR1449, Western blotting for Jak2 showed that Jak2 could still be activated through Box1 and was able to phosphorylate Erk2 and Stat3. GHR1449 provides further evidence that the carboxyl terminal domain of the GHR is not required for either Erk2 or Stat3 phosphorylation to occur. Most important to note, however, is the fact that possessing no Stat5 binding site, GHR1449 was unable to signal through Stat5, and it seems reasonable to presume that it is this defect that is the reason for GHIS in these patients. This would be compatible with the recent description of GHIS in a patient with a Stat5b mutation (42).
| Acknowledgments |
|---|
| Footnotes |
|---|
A.M. and L.M. contributed equally to this work.
Abbreviations: CHO, Chinese hamster ovary; GHBP, GH binding protein; GHIS, GH insensitivity syndrome; GHR, GH receptor; GHRwt, wild-type GHR; hGH, human GH; IGFBP, IGF binding protein; Jak, Janus kinase; N, normal range; SDS, SD score; Stat, signal transducer and activator of transcription.
Received August 19, 2003.
Accepted November 13, 2003.
| References |
|---|
|
|
|---|
n L-A 1995 Mediation of growth hormone-dependent transcriptional activation by mammary gland factor/Stat 5. J Biol Chem 270:94489453This article has been cited by other articles:
![]() |
J. E. Rowland, L. M. Kerr, M. White, P. G. Noakes, and M. J. Waters Heterozygote Effects in Mice with Partial Truncations in the Growth Hormone Receptor Cytoplasmic Domain: Assessment of Growth Parameters and Phenotype Endocrinology, December 1, 2005; 146(12): 5278 - 5286. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Hwa, B. Little, P. Adiyaman, E. M. Kofoed, K. L. Pratt, G. Ocal, M. Berberoglu, and R. G. Rosenfeld Severe Growth Hormone Insensitivity Resulting from Total Absence of Signal Transducer and Activator of Transcription 5b J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4260 - 4266. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Rowland, A. M. Lichanska, L. M. Kerr, M. White, E. M. d'Aniello, S. L. Maher, R. Brown, R. D. Teasdale, P. G. Noakes, and M. J. Waters In Vivo Analysis of Growth Hormone Receptor Signaling Domains and Their Associated Transcripts Mol. Cell. Biol., January 1, 2005; 25(1): 66 - 77. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |