help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Milward, A.
Right arrow Articles by Webb, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Milward, A.
Right arrow Articles by Webb, S. M.
The Journal of Clinical Endocrinology & Metabolism Vol. 89, No. 3 1259-1266
Copyright © 2004 by The Endocrine Society

Growth Hormone (GH) Insensitivity Syndrome due to a GH Receptor Truncated after Box1, Resulting in Isolated Failure of STAT 5 Signal Transduction

A. Milward, L. Metherell, M. Maamra, M. J. Barahona, I. R. Wilkinson, C. Camacho-Hübner, M. O. Savage, C. M. Bidlingmaier, A. J. L. Clark, R. J. M. Ross and S. M. Webb

Division of Clinical Sciences (North) (A.M., M.M., I.R.W., R.J.M.R.), University of Sheffield, Sheffield S5 7AU, United Kingdom; Department of Endocrinology (L.M., C.C.-H., M.O.S., A.J.L.C.), Barts & the London, Queen Mary University of London, London EC1A 7BE, United Kingdom; Hospital Sant Pau (M.J.B., S.M.W.), Autonomous University of Barcelona, Spain; and Department of Medicine (C.M.B.), Ludwig-Maximilians University, Munich 80336, Germany

Address all correspondence and requests for reprints to: Professor Richard J. M. Ross, Clinical Sciences, Northern General Hospital, Sheffield, S5 7AU, United Kingdom. E-mail: r.j.ross{at}sheffield.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Congenital GH insensitivity syndrome (GHIS) is usually the result of a mutation in the extracellular domain of the GH receptor (GHR). We report one of only a small number of mutations so far identified within the intracellular domain of the GHR. The probands are a 53-yr-old woman, height 114 cm (SD score, -8.7), peak GH 45 µg/liter during hypoglycemia, IGF-I 8.0 µg/liter [normal range (N) N 54–389], IGF binding protein-3 16 nmol/liter (N 61–254), GHBP 6.8% (N > 10); and her 57-yr-old brother, height 140 cm (SD score, -6), IGF-I 38.8 µg/liter (N 54–290), IGF binding protein-3 30 nmol/liter (N 61–196). Both patients were homozygous for a 22-bp deletion in the DNA encoding the cytoplasmic domain of the GHR, resulting in a frameshift and premature stop codon. The resultant GHR is truncated at amino acid 449 (GHR1–449) after Box1, the Janus kinase 2 binding domain of the receptor. Functional studies in HEK293 and Chinese hamster ovary cells show GHR1–449 to have a cellular distribution similar to that of the wild-type GHR, judged by binding of iodinated GH, FACS analysis, and immunocytochemistry. Western blot analysis showed GH-induced phosphorylation of Janus kinase 2, signal transducer and activator of transcription (Stat)3, and Erk2 for both GHR1–449 and wild-type GHR. However, no Stat5 activity was detected in cells expressing GHR1–449, consistent with the fact that GHR1–449 contains no Stat5 binding site. In conclusion, we report two adult siblings with GHIS due to a mutation in the intracellular domain of GHR resulting in a selective loss of Stat5 signaling. Results are consistent with the hypothesis that the loss of signaling through the Stat5 pathway results in GHIS.


    Introduction
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
GH INSENSITIVITY SYNDROME (GHIS), Laron syndrome, is a rare autosomal recessive condition associated with postnatal growth failure leading to extreme short stature, midfacial hypoplasia, truncal obesity, and hypoglycemia. Patients have raised GH levels, associated with deficiency of IGF-I and IGF binding protein-3 (IGFBP-3) (1, 2). These features commonly result from GH receptor (GHR) dysfunction and consequent failure of signal transduction pathways.

The mature wild-type human GHR (GHRwt) is 620 amino acids long, possessing 246 extracellular amino acids, a 24-amino-acid transmembrane spanning region, and 350 cytoplasmic amino acids (3) (Fig. 1BGo). The GHR lacks intrinsic kinase activity and relies on the regulation and activation of cytosolic Janus kinase 2 (Jak2). Jak2 is constitutively associated with the receptor at the proline-rich Box1 site (amino acids 276–287), and it is thought that ligand binding may stabilize the preformed receptor-Jak2 complex (4, 5). Box2 (amino acids 325–338) of the GHR is thought to be required for full activation of Jak2 by GH (5, 6). GH binding results in a conformational change in the receptor dimer and transphosphorylation of associated Jak2 (4). After GH stimulation, phosphorylated Jak2 has been reported to activate the signal transducer and activator of transcription proteins (Stat)1, Stat3, Stat5 (7, 8, 9), and the MAPK pathway including Erk1/2, p38, and Jnk (10, 11, 12). Stat5 requires anchorage to tyrosines 469 and/or 516 of the GHR for activation (13); whereas Stat1, Stat3, and MAPK are activated via Jak2, independent of any direct association with the GHR.



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 1. A, The three siblings in their fifties with unaffected sons and daughter of the elder sister. The index patient is shown (front row, left), as are her brother (front row, middle), and unaffected sister (front row, right). B, Schematic outline of GHR1–449 compared against GHRwt. C, Amino acid sequence of GHRwt and GHR1–449 highlights Box1, Box2, and Stat5 binding sites 469 and 516 of the GHRwt. GHR1–449 is only homologous to 423 amino acids of the GHRwt, a frame shift terminating transcription at 449. Highlighted in italics is the non-sense sequence caused by the 22-bp deletion, leading to frame shift in GHR1–449 ranging from amino acid 424 to termination at 449.

 
Most patients with GHIS whose GHR defects have been identified have mutations in exons encoding the extracellular domain of the GHR (1, 2). These mutations usually result in low or absent serum GH binding protein (GHBP) and failure of GH to bind and signal at GH responsive tissues (1, 14). The relatively few mutations described in DNA encoding the transmembrane or intracellular domain of the GHR result in truncated GHRs lacking most of the intracellular domain of the receptor (dominant negative mutations) or are compound heterozygous mutations involving one cytoplasmic domain (15, 16, 17, 18, 19).

We have identified an adult female patient and her brother with GHIS due to a homozygous mutation in the GHR, resulting in a GHR truncated after Box1. We present clinical and in vitro data from studies of this novel mutation in the GHR.


    Patients and Methods
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
The patients gave written informed consent for the studies, as required by the Ethics Committee of the Sant Pau Hospital.

Hormone assays

Serum C-peptide, GH, and insulin were measured by automated immunoassays (Immulite 2000, Diagnostic Products Corp, Los Angeles, CA). Plasma IGF-1 concentration was determined by an enzymatically amplified two-step sandwich immunoassay (Active IGF-1 ELISA, Diagnostic Systems Labs, Inc., Webster, TX). GHBP was measured by both charcoal precipitation (20) and the ligand immunoflurometric assay method (21).

Genetic analysis

To amplify each exon of the GHR gene (in both patients), PCR was performed using primers directed to intronic sequences in a total vol of 50 µl (primer sequences available on request). The reaction mixture contained 100 ng DNA template, 1x PCR buffer (Sigma Genosys, Poole, UK), 200 µM each deoxynucleotide triphosphate, 200 nM each primer, and 1 U Taq DNA polymerase (Sigma Genosys). After an initial denaturation step of 5 min at 95 C, PCR cycling was performed for 30 cycles of 95 C for 30 sec, 55 C for 30 sec, and 72 C for 1 min, followed by a final extension step at 72 C for 5 min. All amplified fragments were purified by spin columns (Qiagen, Crawley, Sussex, UK) and sequenced using the ABI Prism Big Dye Sequencing kit and an ABI 377 automated DNA sequencer (Applied Biosystems, Foster City, CA) as per the manufacturer’s instructions.

Messenger RNA was extracted from skin fibroblasts of the female patient by the RNAzol B method according to the manufacturer’s instructions (Tel Test, Friendswood, TX). cDNA was generated in a reaction mixture containing 5 µg mRNA, 1x M-MLV reverse transcriptase buffer (Promega, Southampton, UK), 200 µM deoxynucleotide triphosphates, 250 ng random hexamers, and 1 U M-MLV reverse transcriptase (Promega). PCR amplification was achieved using primers within exons 9 and 10.

Plasmids

The full-length GHRwt subcloned into pcDNA1/amp (Invitrogen, Paisley, UK) was previously described (22). The truncated GHR1–449 expression plasmid was derived from the reverse transcription of messenger RNA (mRNA) from the female patient’s skin fibroblasts, amplified by PCR using primers in exons 9 and 10 of the GHR transcript [primers: GHRS1ECOR1 (AAACCCGAATTCCACAGTGATG) and GHRASSMA1 (TTTTGGCCCGGGGAAAGGACC)] and both the product and vector (pcDNA1) digested with the enzymes EcoR1 and Sma1 before ligation. The construct was sequenced using the automatic sequencing process and matched 100% to the mRNA isolated from the patient (data not shown). The reporter plasmids, Stat5/Stat3 responsive luciferase reporter vector containing the lactogenic hormone response element LHRE-TK-luc, the internal control of transfection IEP-ß galactosidase-CMV, and the expression plasmid for Stat3 have been described previously (23).

Cell culture and transfection

Human embryonic kidney (HEK293) cells and Chinese hamster ovary (CHO) cells were routinely grown, respectively, in DMEM Nut F12 medium and Nutrient mixture F12 (Ham’s) supplemented with 10% fetal calf serum, 100 IU penicillin, and 100 µg/ml Streptomycin, 2 mg/ml fungizone, 2 mM L-glutamine, and buffered with HEPES (all GIBCO BRL, Paisley, UK), and routinely grown at 37 C in a 95% humidified atmosphere of 5% CO2. Transfection of HEK293 cells was performed using a calcium phosphate transfection kit (GIBCO BRL) and transfection of CHO cells using the LT1 transfection kit (Mirus, Madison, WI), according to the manufacturers’ instructions.

Reporter assays

GHRhi, a stable clone of HEK293 cells expressing high levels of the GHRwt, described previously (24), was used to examine the effect of GHR1–449 on GHRwt signaling. GHRhi cells were transfected with 5 µg GHR1–449 or empty vector, 1.5 µg lactogenic hormone response element/TK-Luc, and 0.25 µg of a ß-galactosidase expression vector per plate. Sixteen hours later, the cells were stimulated with GH in the presence of 0.5 µM dexamethasone (dexamethasone augments the response through an action on Stat5). The cells were harvested and assayed for luciferase and ß-galactosidase activities using Promega kits (Promega). Luciferase activity was normalized using ß-galactosidase activities to adjust for transfection efficiency between samples. The data are presented as fold induction (mean + SEM).

GH binding

HEK293 cells were transfected with 3 µg GHR expression plasmids and cells incubated in serum free medium 12 h before binding. Cells were then washed with PBS containing 1% BSA, and incubated with I125-labeled GH (105 cpm/well) (Novo Nordisk, Bagsvaerd, Denmark) for 3 h at room temperature in the absence (total binding) or presence (nonspecific binding) of excess unlabeled human GH (hGH) (2 µg) (Genotropin, Pharmacia and Upjohn, Milton Keynes, UK). The cells were washed in the same buffer and solubilized in 1 mol/liter NaOH for counting radiation on a {gamma}-counter.

FACS

HEK293 cells (4 x 105 cells) were transfected with 3 µg GHR expression plasmid. After preincubation in FCS free DMEM Nut F-12 (GIBCO BRL) for 2 h, cells were dislodged from the culture dish using cell dissociation solution (Sigma Genosys). HEK293 cells were suspended in 600 µl PBS 1% BSA (washing buffer). Cells (100 µl) were incubated with 5 µg of an anti-GHR Ab (2C8) or isotype-matched negative control Ab (R&D Systems, Abingdon, UK) for 30 min on ice. Primary antibody binding was detected by incubation with biotinylated goat antimouse IgG polyclonal Ab (1 µg; Calbiochem, Nottingham, UK), followed by incubation with Streptavidin-R.Phycoerythrin 3 conjugate (10 µl; Serotec, Oxford, UK) for 30 min on ice. Flow cytometry was performed using a FACScan flow cytometer (BD Biosciences, Oxford, UK) and CellQuest data acquisition and analysis software.

Immunofluorescence

Immunofluorescence was performed on fixed cells to determine the cellular distribution of GHR. Labeling was carried out on CHO cells expressing either GHRwt or the mutated receptor GHR1–449. Cells were fixed in 2% paraformaldehyde for 15 min and permeabilized or not with Triton X-100 (0.1% in 2% paraformaldehyde) for 2 min. After blocking in PBS 5% goat serum plus 0.1% saponin, the cells were incubated with the anti-GHR extracellular domain 2C8 monoclonal antibody (10 µg/ml) in antibody buffer (PBS 1% goat serum, 0.1% BSA, 0.1% saponin). After washing, cells were incubated with biotinylated Fab fragment of goat antimouse antibody and streptavidin alexa 488 (both Molecular Probes) (Eugene, OR) and slides mounted in vectashield mounting medium (Vector Laboratories UK, Peterborough, UK). Fluorescence was detected using a Molecular Dynamics CLSM2010 confocal fluorescent microscope (Amersham Pharmacia Biotech, Little Chalfont, UK). Cells were excited at 488 nm, and detection was through a 530-nm band pass filter.

Western blotting

CHO cells transfected with GHR expression plasmids were starved overnight in FCS free nutrient mixture F12 (Ham’s) and stimulated at 37 C with GH (500 ng/ml). Cells were harvested at 2 min (Jak2), 10 min (Erk1/2), 15 min (Stat3), or 30 min (Stat5, in the presence of 0.5 µM dexamethasone). Cells were washed in 5 ml PBS, 1 mM sodium orthovanadate and lysed. For Jak2 and Stat5, lysates were immunoprecipitated with 15 µl anti-Jak2 (Santa Cruz Biotechnology, Santa Cruz, CA) or 10 µl anti-Stat5 (Santa Cruz Biotechnology) and 20 µl protein A Sepharose 4B fast flow beads (Sigma Genosys). Proteins were separated on a 7.5% SDS-PAGE gel and blotted onto polyvinylidene difluoride membrane. For visualization, membranes were probed with a species-specific secondary antibody conjugated to horseradish peroxidase, and detection of binding was performed by chemiluminescent detection (enhanced chemiluminescence) according to the manufacturer’s instructions (Amersham Pharmacia Biotech). Phosphorylation of Jak2 and Stat5 was detected with an antiphosphotyrosine antibody (4G10) (1;2500) (UBI, Lake Placid, NY). Stat3, and Erk1/2 blots were performed on crude lysate, with antiphospho Stat3(Tyr705) (Cell Signaling Technology, Beverley, MA), or antiphospho Erk1/2 (UBI). All blots were reprobed for total Jak2, Stat5, Stat3, or Erk1/2. Blots shown are representative of at least three individual experiments.


    Results
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Phenotype

The index case was a 53-yr-old woman initially seen at age 47 with a toxic thyroid nodule, when she was noted to be of short stature. She was treated with I-131; she has remained euthyroid since. She had regular menstrual cycles until menopause at age 51 (FSH value, 80 mIU/liter). The patient had a 57-yr-old brother whose height was 140 cm [SD score (SDS), -6], presenting with a similar phenotype, and a 60-yr-old sister who was phenotypically normal, with a height of 152 cm (SDS, -2.1). Both patients were single, without offspring, and of normal intelligence. The brother had a normal puberty and normal gonadal development. Their parents, deceased, were phenotypically normal. The family came from a remote region of the Spanish province of Teruel (Tronchón). Although no consanguinity was reported, both grandmothers had the same surname.

The index patient had a height of 114 cm (SDS, -8.7), weight of 40.25 kg, central obesity, BMI of 30.7 kg/m2 (normal < 25), a waist/hip ratio of 1.13 (normal < 0.8), and a high-pitched voice. Dual-energy x-ray absorptiometry scanning confirmed high body fat (51.3% of total body composition, normal 29.7 ± 5.6%); lean plus bone mineral content was low (48%, normal 72.7 ± 5.0), demonstrating low absolute lean body mass, because bone mineral density and content were within the age-matched normal range (0.907 g/cm2 and 948.36 g; Z-score, -1.4 SD; T-score, -2.2 SD). Total cholesterol was initially elevated (8.6 mmol/liter), as was low-density lipoprotein cholesterol (5.74 mmol/liter), with normal triglycerides (1.1 mmol/liter), high-density pipoprotein cholesterol (1.81 mmol/liter), and very-low-density lipoprotein cholesterol (0.49 mmol/liter). Treatment with simvastatin (10 mg/d) induced a decrease of cholesterol to 6.4 mmol/liter. Circulating blood glucose was 4.9 mmol/liter (normal < 6.4); immunoreactive insulin, 53 pmol/liter [normal range (N) < 216]; and C-peptide, 656 pmol/liter (N = 300–600), with a normal oral glucose tolerance test. HbA1C was 6.1%. The homeostasis assessment model index (insulin x glucose/22.5) was 11.54, i.e. higher than that in an age-matched normal subject, 3.02–10.86 (25, 26), suggestive of insulin resistance compatible with her central obesity. She had an exaggerated response of GH to insulin hypoglycemia (GH peak, 45 µg/liter). Both the index patient and her brother had very low IGF-l (8.0 and 38.8; N 54–389 and 54–290 µg/liter, respectively) and IGFBP-3 (16 and 30; N 61–254 and 61–196 nmol/liter, respectively) levels. GHBP in the index patient was 6.8% (normal >10%) by charcoal precipitation and less than 100 pM, (<1st centile) by ligand immunoflurometric assay.

Genetic analysis

Sequencing of the nine GHR coding exons (exons 2–10) revealed a homozygous 22-bp deletion in exon 10. The predicted consequence of this is a frameshift introducing novel codons from position 424–449 and a premature termination codon at 450 (Fig. 1CGo). The protein resulting from this would be truncated and lack a large portion of the intracellular domain. In the truncated protein, the membrane proximal region containing Box1 and Box2, critical for JAK2 and STAT3 activation, is intact; but GHR1–449 lacks the C-terminal portion, including tyrosine residues essential for STAT5 activation (Fig. 1BGo).

To investigate the possibility that non-sense mRNA degradation was the cause of GHIS in these patients, RT-PCR using primers directed to exons 9 and 10 was performed on mRNA from fibroblasts of the female patient. This demonstrated an amplification product of the predicted size and sequence, indicating that the defect does not lie at the mRNA level (data not shown).

GHR expression

GHR1–449 binds GH at the cell surface at levels similar to that of GHRwt. GHR1–449 and GHRwt were transfected into HEK293 cells, and binding at the cell surface was detected using iodinated hGH-I125 (Fig. 2Go). GHR1–449 consistently showed a similar level of binding to GHRwt.



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 2. Radioligand binding was carried out on HEK293 cells expressing either GHRwt or GHR1–449, using hGH-I125 in the presence (non-specific binding) or absence (total binding) of excess cold GH. Nontransfected cells were used as a negative control. Results are expressed as percent specific binding of labeled GH (mean + SEM).

 
GHR1–449 is expressed at the cell surface at levels similar to that of GHRwt. To further characterize the expression of GHR1–449 at the cell surface, FACS analysis using the anti-GHR 2C8 (binds within the extracellular domain) was carried out on transfected HEK293 cells (Fig. 3Go). Mean fluorescence levels for expressed GHR1–449 and GHRwt were similar. Immunocytochemistry for GHRwt and GHR1–449 showed a similar intracellular distribution consistent with localization in the endoplasmic reticulum and the Golgi complex, and a similar cell surface distribution (Fig. 4Go).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 3. FACS analysis on GHR1–449 and GHRwt. Untransfected HEK293 cells and HEK293 cells transfected with either 3 µg GHR1–449 or GHRwt were incubated with 2C8 (mouse antihuman GHR). Biotinylated goat antimouse antihuman GHR and phycoerythrin linked to streptavidin were used for detection. 2C8 recognizes an epitope upstream of the GHR1–449 deletion site. FACS analysis results are expressed as mean fluorescence of cells with 2C8.

 


View larger version (43K):
[in this window]
[in a new window]
 
FIG. 4. CHO cells transfected with control plasmid pcDNA3, GHRwt, or mutated GHR1–449 were grown on coverslips. Cells were fixed with 2% paraformaldehyde and permeabilized or not with 0.1% Triton X-100. Cells were then labeled with 10 µg/ml anti-GHR antibody (monoclonal antibody 2C8), an antibody which recognizes an epitope in the extracellular domain of the receptor, and biotinylated antimouse antibody and streptavidin labeled Alexa 488. A, Permeabilized: Control shows no immunofluorescence, whereas GHRwt and GHR1–449 show an endoplasmic reticulum and Golgi complex localization. B, Non-permeabilized: Control shows no immunofluorescence, whereas GHRwt and GHR1–449 show a similar cell surface distribution.

 
GHR signal transduction

GHR1–449 is able to signal through Jak2. CHO cells were transfected with plasmids expressing GHR1–449 or GHRwt and stimulated with 500 ng/ml GH (this dose of GH provides a maximal response, data not shown). Pilot studies showed that maximal Jak2 phosphorylation occurred at 2 min (data not shown). GH induced Jak2 phosphorylation in cells expressing both GHRwt and GHR1–449 (Fig. 5Go).



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 5. Western blots of CHO cells transfected with either GHR1–449 or GHRwt and stimulated with (+) or without (-) 500 ng/ml GH. Cells transfected with GHR1–449 show phosphorylation of Jak2, Stat3, and Erk2 but no activation of Stat5. GHRwt consistently showed an increased background phosphorylation of Stat3.

 
GHR1–449 is unable to signal via the Stat5 pathway. Pilot studies on GH-induced Stat5 phosphorylation demonstrated maximal activation at 30 min (data not shown). Treatment with GH of cells expressing GHRwt was seen to show consistent phosphorylation of Stat5 at 30 min (Fig. 5Go). In contrast, no Stat5 phosphorylation was detected in cells expressing GHR1–449.

GHR1–449 activates Stat3. The capacity of GHR1–449 to signal through Stat3 was analyzed by transfecting CHO cells with either GHR1–449 or GHRwt and stimulating with 500 ng/ml GH for 15 min. A Stat3 expression plasmid was also cotransfected, because the level of endogenous Stat3 phosphorylation was seen to be minimal in earlier experiments (data not shown). Immunoblotting of lysate with an antiphospho Stat3 antibody showed greater fold activation of Stat3 for GHR1–449 compared with GHRwt (Fig. 5Go), although the cells transfected with GHRwt consistently showed a greater background activation of Stat3.

GHR1–449 has reduced lactogenic hormone response element activation through the Stat5/Stat3 response element. To further explore the relationship between GHR1–449 and GHRwt on Stat5 and Stat3 signaling, GHR1–449 was transfected into HEK293 cells, stably expressing a high level of GHRwt (GHRhi). The Stat5/Stat3 responsive reporter LHRE/TK-luc was used as an indicator of signaling. In the absence of mutated receptor expression, a 6-h exposure to GH induces a dose-dependent increase in luciferase activity compared with unstimulated cells. The transfection of GHR1–449 into cells already expressing the GHRwt demonstrated reduced luciferase induction throughout the dose-response curve, with a maximum reduction of 2.5-fold at 500 ng/ml (P < 0.05) (Fig. 6Go).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 6. HEK293 cells stably expressing high levels of GHRwt (GHRhi cells) were transfected or not with the vector pcDNA1 containing GHR1–449 plus 1.5 µg LHRE/TK-luc (Stat5/Stat3 reporter) and 0.5 µg of a ß-galactosidase expression vector. Cells were incubated with dexamethasone (0.5 µM) in the presence of increasing amounts of GH, and cell lysates were used for determination of luciferase and ß-galactosidase activities. ß-galactosidase activity was used to normalize luciferase activity. Values are expressed as fold induction (mean + SEM).

 
GHR1–449 can activate the MAPK pathway. The capacity of GHR1–449 to signal through Erk1/2 was analyzed by transfecting CHO cells with either GHR1–449 or GHRwt and stimulating with 500 ng/ml GH for 10 min. Immunoblotting lysate with an antiphospho Erk1/2 antibody showed Erk2 to be phosphorylated at greater levels than the unstimulated controls. Levels of phosphorylation were similar for both GHR1–449 and GHRwt. (Fig. 5Go).


    Discussion
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
We report two siblings homozygous for a mutation in the intracellular domain of the GHR (GHR1–449). Both patients had the phenotype of GHIS with short stature, increased fat mass, high GH, low IGF-1, and IGFBP-3 levels (2). Our in vitro studies suggest that the primary defect is failure in the mutated receptor to signal through Stat5.

Despite low exposure to IGF-1, bone mineral density in this perimenopausal patient with GHIS was within normal limits. This is compatible with previous reports of patients with GHIS who have a normal apparent bone mineral density (27). Fat mass was 2-fold higher and lean body mass markedly lower than normal in our patient. Furthermore, her body fat distribution was central, with a high waist/hip ratio; together with unfavorable serum lipid profile in both the patient and her brother (who was also a smoker and required coronary bypass surgery in his fifties), this suggests an increased cardiovascular risk as previously described (28); glucose tolerance was normal but her homeostasis assessment model index (an index of insulin resistance) was above that found in normal subjects (26), although this would be compatible with her central obesity.

The only other example of an exon 10 mutation is a deletion of a single base that gives rise to 20 novel amino acids after Box1 (at codon 310) and premature termination at codon 330 (16). The patient in this case was a compound heterozygote for the exon 10 mutation and E224X exon 7 mutation in the extracellular domain. No detectable GHBP was found in that case; and in studies on the father, a heterozygote for the exon 10 mutation, only wild-type mRNA was produced. Hence, it was concluded that the exon 10 mutated mRNA is unstable. Some mutations in the GHR result in a defect in expression level (29), but this is not the case with GHR1–449. RT-PCR from the patient’s fibroblasts confirmed that the mutant GHR mRNA was expressed. Furthermore, our experiments showed levels of GHR1–449 binding similar to those of the GHRwt, demonstrating that the 22-bp deletion in GHR1–449 does not affect either receptor expression, or trafficking to the cell surface. In addition, immunocytochemistry showed GHR1–449 and GHRwt to possess similar intracellular and cell surface localization and distribution to GHRwt. GHR1–449 was associated with a low, but detectable, serum GHBP in the index patient. The significance of this is not clear, because generally levels of GHBP have been related to level of GHR expression. It might be predicted that our patient would have normal levels of GHBP, because GHR1–449 is expressed at the cell surface. However, GHR proteolysis can be inhibited by GH, because the dimerized receptor is resistant to cleavage (30). Our patient had high GH levels, and the GHR would be expected to dimerize; thus this may reduce GHBP levels in patients with the GHR1–449 mutation. Additionally obese postmenopausal women have lower GHBP levels; although in this situation, there are low GH levels in contrast to GHI (31).

The signaling capacity for GHR1–449 could be predicted from the mutation. Box1 on the GHR is the binding site for Jak2 and is retained in GHR1–449. Jak2 is a key mediator in GH-induced signaling and is phosphorylated upon GH binding and dimerization of GHR, inducing a phosphorylation cascade leading to the activation of a number of different signaling pathways (7, 8, 9, 10, 11, 12). As predicted, Western blotting confirmed that GHR1–449 could phosphorylate Jak2.

Two forms of Stat5, Stat5a and Stat5b, have been shown to exist in a variety of cell types, encoded by two different genes possessing greater than 90% homology in the coding sequences (32, 33, 34, 35). Generation of Stat5a/b knockout mice has been shown to result in mice significantly reduced in size, in both sexes, and correlated with reduced levels of IGF-1 (36), and the Stat5b knockout suggests that Stat5b mediates the sexually dimorphic effects of GH pulses in the rat (37). Before Stat5 can be phosphorylated by GH, it must first bind via its SH2 domain to specific phospho-tyrosyl residues in the cytoplasmic domain of the GHR. Mutating the conserved arginine in the floor of the SH2 pocket to a glycine has been shown to abort the capacity of Stat5 to bind to the GHR. Tyrosines 469 and/or 516 have been implicated in the rabbit GHR, sites which are homologous to tyrosines 469 and 516 of the human GHR (13). Knowing that the tyrosine sites 469 and 516 were not available on GHR1–449, due to premature termination of the GHR, we wished to verify that no Stat5 activity would be generated by this receptor. In transfected CHO cells, GHRwt activated Stat5, but no activation was seen in cells transfected with GHR1–449.

In contrast to Stat5, Stat3 does not require phosphorylated tyrosine residues in the carboxyl terminal domain of the GHR to be activated by JAK2, and only requires the membrane proximal region of the GHR necessary for binding and transphosphorylation of Jak2 (13, 38). Jak2 is known to contain two Stat3 association motifs (YXXQ), obviating the need for a direct GHR/Stat3 association for Stat3 phosphorylation to occur. Using truncated GHRs, Stat3 activation has been shown to remain high, provided Box1 is still present (13). Generation of GHR possessing Box1 mutations results in abolition of Stat3 activity (38). In our experiments, GHR1–449, possessing Box1 and Jak2 activity was shown to induce a higher fold induction of Stat3 compared with GHRwt, although GHRwt had a higher background activation of Stat3. The reason for the greater background activation of Stat3 by GHRwt is not clear, although it is possible that the unliganded GHRwt, which is in a preformed dimer, can partially activate Stat3.

To confirm that GHR1–449 could not signal through Stat5, we cotransfected GHR1–449 and the Stat5/Stat3 reporter LHRE/TK-luc into HEK293 cells, stably expressing a high level of GHRwt (GHRhi). Inhibition of luciferase induction was seen throughout the dose-response curve, with a maximum inhibition of 2.5-fold at 500 ng/ml. We suggest that the partial activation of LHRE observed for GHR1–449 may be due to the ability of GHR1–449 to signal through Stat3, while signaling through Stat5 is abolished.

Activation of the MAPK Erk1/2 pathway is known to occur through a well-established pathway involving SHC, Grb2, SOS, Ras, Raf, and MAP/Erk kinase (39, 40). It is now known that upon GH stimulation SHC interacts with phosphorylated Jak2, leading to the initiation of this pathway. In addition, the coexpression of dominant negative forms of H-Ras and Raf-1 inhibit Erk2 activation in HEK293 cells (41). Our experiments demonstrated that GHR1–449 retained the ability to signal through the Erk2 pathway in a manner similar to that of GHRwt.

In conclusion, GHR1–449 was seen to show cell surface expression at levels similar to that of GHRwt, suggesting that this mutation does not affect receptor expression, trafficking to the cell surface, or its ability to bind circulating GH. For GHR1–449, Western blotting for Jak2 showed that Jak2 could still be activated through Box1 and was able to phosphorylate Erk2 and Stat3. GHR1–449 provides further evidence that the carboxyl terminal domain of the GHR is not required for either Erk2 or Stat3 phosphorylation to occur. Most important to note, however, is the fact that possessing no Stat5 binding site, GHR1–449 was unable to signal through Stat5, and it seems reasonable to presume that it is this defect that is the reason for GHIS in these patients. This would be compatible with the recent description of GHIS in a patient with a Stat5b mutation (42).


    Acknowledgments
 
We are grateful to Novo Nordisk for supplying iodinated GH. The contributions in the work-up of these patients of Montserrat Baiget, Roser Casmitjana, Jordi Farrerons, Ma Luisa Granada, and José Rodríguez-Espinosa, as well as those of Ana Wägner and Josep Ma Pou, all in Barcelona, Spain, are gratefully acknowledged.


    Footnotes
 
This work was supported by Novo Nordisk (to M.M.).

A.M. and L.M. contributed equally to this work.

Abbreviations: CHO, Chinese hamster ovary; GHBP, GH binding protein; GHIS, GH insensitivity syndrome; GHR, GH receptor; GHRwt, wild-type GHR; hGH, human GH; IGFBP, IGF binding protein; Jak, Janus kinase; N, normal range; SDS, SD score; Stat, signal transducer and activator of transcription.

Received August 19, 2003.

Accepted November 13, 2003.


    References
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 

  1. Woods KA, Dastot F, Preece MA, Clark AJ, Postel-Vinay MC, Chatelain PG, Ranke MB, Rosenfeld RG, Amselem S, Savage MO 1997 Phenotype: genotype relationships in growth hormone insensitivity syndrome. J Clin Endocrinol Metab 82:3529–3535[Abstract/Free Full Text]
  2. Rosenfeld RG, Rosenbloom AL, Guevara-Aguirre J 1994 Growth hormone (GH) insensitivity due to primary GH receptor deficiency. Endocr Rev 15:369–390[Abstract/Free Full Text]
  3. Leung DW, Spencer SA, Cachianes G, Hammonds RG, Collins C, Henzel WJ, Barnard R, Waters MJ, Wood WI 1987 Growth hormone receptor and serum binding protein: purification, cloning and expression. Nature 330:537–543[CrossRef][Medline]
  4. Argetsinger LS, Campbell GS, Yang X, Witthuhn BA, Silvennoinen O, Ihle JN, Carter-Su C 1993 Identification of JAK2 as a growth hormone receptor-associated tyrosine kinase. Cell 74:237–244[CrossRef][Medline]
  5. Colosi P, Wong K, Leong SR, Wood WI 1993 Mutational analysis of the intracellular domain of the human growth hormone receptor. J Biol Chem 268:12617–12623[Abstract/Free Full Text]
  6. Wang YD, Wood WI 1995 Amino acids of the human growth hormone receptor that are required for proliferation and Jak-STAT signaling. Mol Endocrinol 9:303–311[Abstract/Free Full Text]
  7. Meyer DJ, Campbell GS, Cochran BH, Argetsinger LS, Larner AC, Finbloom DS, Carter-Su C, Schwartz J 1994 Growth hormone induces a DNA binding factor related to the interferon-stimulated 91-kDa transcription factor. J Biol Chem 269:4701–4704[Abstract/Free Full Text]
  8. Campbell GS, Meyer DJ, Raz R, Levy DE, Schwartz J, Carter-Su C 1995 Activation of acute phase response factor (APRF)/Stat3 transcription factor by growth hormone. J Biol Chem 270:3974–3979[Abstract/Free Full Text]
  9. Wood TJJ, Sliva D, Lobie PE, Pircher TJ, Gouilleux F, Wakao H, Gustafsson J, Groner B, Norstedt G, Haldos{epsilon}n L-A 1995 Mediation of growth hormone-dependent transcriptional activation by mammary gland factor/Stat 5. J Biol Chem 270:9448–9453[Abstract/Free Full Text]
  10. Winston LA, Bertics PJ 1992 Growth hormone stimulates the tyrosine phosphorylation of 42- and 45-kDa ERK-related proteins. J Biol Chem 267:4747–4751[Abstract/Free Full Text]
  11. Zhu T, Lobie PE 2000 Janus kinase 2-dependent activation of p38 mitogen-activated protein kinase by growth hormone. Resultant transcriptional activation of ATF-2 and CHOP, cytoskeletal re-organization and mitogenesis. J Biol Chem 275:2103–2114[Abstract/Free Full Text]
  12. Zhu T, Goh EL, LeRoith D, Lobie PE 1998 Growth hormone stimulates the formation of a multiprotein signaling complex involving p130(Cas) and CrkII. Resultant activation of c-Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK). J Biol Chem 273:33864–33875[Abstract/Free Full Text]
  13. Sotiropoulos A, Moutoussamy S, Renaudie F, Clauss M, Kayser C, Gouilleux F, Kelly PA, Finidori J 1996 Differential activation of Stat3 and Stat5 by distinct regions of the growth hormone receptor. Mol Endocrinol 10:998–1009[Abstract/Free Full Text]
  14. Wojcik J, Berg MA, Esposito N, Geffner ME, Sakati N, Reiter EO, Dower S, Francke U, Postel-Vinay MC, Finidori J 1998 Four contiguous amino acid substitutions, identified in patients with Laron syndrome, differently affect the binding affinity and intracellular trafficking of the growth hormone receptor. J Clin Endocrinol Metab 83:4481–4489[Abstract/Free Full Text]
  15. Gastier JM, Berg MA, Vesterhus P, Reiter EO, Francke U 2000 Diverse deletions in the growth hormone receptor gene cause growth hormone insensitivity syndrome. Hum Mutat 16:323–333[CrossRef][Medline]
  16. Kaji H, Nose O, Tajiri H, Takahashi Y, Iida K, Takahashi T, Okimura Y, Abe H, Chihara K 1997 Novel compound heterozygous mutations of growth hormone (GH) receptor gene in a patient with GH insensitivity syndrome. J Clin Endocrinol Metab 82:3705–3709[Abstract/Free Full Text]
  17. Ayling RM, Ross R, Towner P, von Laue S, Finidori J, Moutoussamy S, Buchanan CR, Clayton PE, Norman MR 1997 A dominant-negative mutation of the growth hormone receptor causes familial short stature. Nat Genet 16:13–14[CrossRef][Medline]
  18. Woods KA, Fraser NC, Postel-Vinay MC, Savage MO, Clark AJ 1996 A homozygous splice site mutation affecting the intracellular domain of the growth hormone (GH) receptor resulting in Laron syndrome with elevated GH-binding protein. J Clin Endocrinol Metab 81:1686–1690[Abstract]
  19. Iida K, Takahashi Y, Kaji H, Nose O, Okimura Y, Abe H, Chihara K 1998 Growth hormone (GH) insensitivity syndrome with high serum GH-binding protein levels caused by a heterozygous splice site mutation of the GH receptor gene producing a lack of intracellular domain. J Clin Endocrinol Metab 83:531–537[Abstract/Free Full Text]
  20. Tar A, Hocquette JF, Souberbielle JC, Clot JP, Brauner R, Postel-Vinay MC 1990 Evaluation of the growth hormone-binding proteins in human plasma using high pressure liquid chromatography gel filtration. J Clin Endocrinol Metab 71:1202–1207[Abstract/Free Full Text]
  21. Kratzsch J, Schreiber G, Selisko T, Keller E, Pflaum CD, Strasburger CJ 1997 Measurement of serum exon 3-retaining growth hormone-binding protein in children and adolescents by radioimmunoassay. Horm Res 48:252–257[Medline]
  22. Ross RJ, Esposito N, Shen XY, von Laue S, Chew SL, Dobson PR, Postel-Vinay MC, Finidori J 1997 A short isoform of the human growth hormone receptor functions as a dominant negative inhibitor of the full-length receptor and generates large amounts of binding protein. Mol Endocrinol 11:265–273[Abstract/Free Full Text]
  23. von Laue S, Finidori J, Maamra M, Shen XY, Justice S, Dobson PR, Ross RJ 2000 Stimulation of endogenous GH and interleukin-6 receptors selectively activates different Jaks and Stats, with a Stat5 specific synergistic effect of dexamethasone. J Endocrinol 165:301–311[Abstract]
  24. Maamra M, Finidori J, von Laue S, Simon S, Justice S, Webster J, Dower S, Ross R 1999 Studies with a growth hormone antagonist and dual-fluorescent confocal microscopy demonstrate that the full-length human growth hormone receptor, but not the truncated isoform, is very rapidly internalized independent of Jak2-Stat5 signaling. J Biol Chem 274:14791–14798[Abstract/Free Full Text]
  25. Wagner AM, Ordonez-Llanos J, Arcelus R, Bonet R, Jorba O, Sanchez-Quesada JL, Alonso E, Julve J, Perez A, Postprandial lipidaemia is normal in non-obese type 2 diabetic patients with relatively preserved insulin secretion. Metabolism, in press
  26. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC 1985 Homeostasis model assessment: insulin resistance and ß-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28:412–419[CrossRef][Medline]
  27. Bachrach LK, Marcus R, Ott SM, Rosenbloom AL, Vasconez O, Martinez V, Martinez AL, Rosenfeld RG, Guevara-Aguirre J 1998 Bone mineral, histomorphometry, and body composition in adults with growth hormone receptor deficiency. J Bone Miner Res 13:415–421[CrossRef][Medline]
  28. Rosenbloom AL, Martinez V, Kranzier JH, Bachrach LK, Rosenfeld RG, Guevara-Aguirre J 1999 Natural history of growth hormone receptor deficiency. Acta Paediatr Suppl 88:153–156[Medline]
  29. Esposito N, Wojcik J, Chomilier J, Martini JF, Kelly PA, Finidori J, Postel-Vinay MC 1998 The D152H mutation found in growth hormone insensitivity syndrome impairs expression and function of human growth hormone receptor but is silent in rat receptor. J Mol Endocrinol 21:61–72[Abstract]
  30. Baumann G, Frank SJ 2002 Metalloproteinases and the modulation of GH signaling. J Endocrinol 174:361–368[Abstract]
  31. Bondanelli M, Margutti A, Ambrosio MR, Plaino L, Cobellis L, Petraglia F, degli Uberti EC 2001 Blood growth hormone-binding protein levels in premenopausal and postmenopausal women: roles of body weight and estrogen levels. J Clin Endocrinol Metab 86:1973–1980[Abstract/Free Full Text]
  32. Mui AL, Wakao H, O’Farrell AM, Harada N, Miyajima A 1995 Interleukin-3, granulocyte-macrophage colony stimulating factor and interleukin-5 transduce signals through two STAT5 homologs. EMBO J 14:1166–1175[Medline]
  33. Liu X, Robinson GW, Gouilleux F, Groner B, Hennighausen L 1995 Cloning and expression of Stat5 and an additional homologue (Stat5b) involved in prolactin signal transduction in mouse mammary tissue. Proc Natl Acad Sci USA 92:8831–8835[Abstract/Free Full Text]
  34. Hou J, Schindler U, Henzel WJ, Wong SC, McKnight SL 1995 Identification and purification of human Stat proteins activated in response to interleukin-2. Immunity 2:321–329[CrossRef][Medline]
  35. Kazansky AV, Raught B, Lindsey SM, Wang YF, Rosen JM 1995 Regulation of mammary gland factor/Stat5a during mammary gland development. Mol Endocrinol 9:1598–1609[Abstract/Free Full Text]
  36. Teglund S, McKay C, Schuetz E, van Deursen JM, Stravopodis D, Wang D, Brown M, Bodner S, Grosveld G, Ihle JN 1998 Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell 93:841–850[CrossRef][Medline]
  37. Udy GB, Towers RP, Snell RG, Wilkins RJ, Park SH, Ram PA, Waxman, DJ, Davey HW 1997 Requirement of STAT5b for sexual dimorphism of body growth rates and liver gene expression. Proc Natl Acad Sci USA 94:7239–7244[Abstract/Free Full Text]
  38. Sotiropoulos A, Moutoussamy S, Binart N, Kelly PA, Finidori J 1995 The membrane proximal region of the cytoplasmic domain of the growth hormone receptor is involved in the activation of Stat 3. FEBS Lett 369:169–172[CrossRef][Medline]
  39. Cobb MH 1999 MAP kinase pathways. Prog Biophys Mol Biol 71:479–500[CrossRef][Medline]
  40. Lewis TS, Shapiro PS, Ahn NG 1998 Signal transduction through MAP kinase cascades. Adv Cancer Res 74:49–139[Medline]
  41. Winston LA, Hunter T 1995 JAK2, Ras, and Raf are required for activation of extracellular signal-regulated kinase/mitogen-activated protein kinase by growth hormone. J Biol Chem 270:30837–30840[Abstract/Free Full Text]
  42. Kofoed EM, Hwa V, Little B, Woods KA, Buckway CK, Tsubaki J, Pratt KL, Bezrodnik L, Jasper H, Tepper A, Heinrich JJ, Rosenfeld RG 2003 Growth hormone insensitivity associated with a STAT5b mutation. N Engl J Med 349:1139–1147[Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
J. E. Rowland, L. M. Kerr, M. White, P. G. Noakes, and M. J. Waters
Heterozygote Effects in Mice with Partial Truncations in the Growth Hormone Receptor Cytoplasmic Domain: Assessment of Growth Parameters and Phenotype
Endocrinology, December 1, 2005; 146(12): 5278 - 5286.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
V. Hwa, B. Little, P. Adiyaman, E. M. Kofoed, K. L. Pratt, G. Ocal, M. Berberoglu, and R. G. Rosenfeld
Severe Growth Hormone Insensitivity Resulting from Total Absence of Signal Transducer and Activator of Transcription 5b
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4260 - 4266.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. E. Rowland, A. M. Lichanska, L. M. Kerr, M. White, E. M. d'Aniello, S. L. Maher, R. Brown, R. D. Teasdale, P. G. Noakes, and M. J. Waters
In Vivo Analysis of Growth Hormone Receptor Signaling Domains and Their Associated Transcripts
Mol. Cell. Biol., January 1, 2005; 25(1): 66 - 77.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Milward, A.
Right arrow Articles by Webb, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Milward, A.
Right arrow Articles by Webb, S. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals