| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Medicine (K.C.B.T., A.X., W.S.C., M.C.W.L., K.S.L.L.), University of Hong Kong; and Department of Diagnostic Radiology (V.H.G.A.) and Clinical Biochemistry Unit (S.C.F.T.), Queen Mary Hospital, Hong Kong
Address all correspondence and requests for reprints to: Dr. Kathryn Tan, Department of Medicine, University of Hong Kong, Queen Mary Hospital, 120 Pokfulam Road, Hong Kong. E-mail: kcbtan{at}hkucc.hku.hk.
| Abstract |
|---|
|
|
|---|
Plasma adiponectin level was determined by an in-house RIA assay using a rabbit polyclonal antibody in 73 type 2 diabetic patients and 73 controls. Endothelium-dependent and independent vasodilation of the brachial artery was measured by high-resolution vascular ultrasound. Plasma adiponectin level was lower in diabetic patients than in controls (4.73 ± 1.96 vs. 7.69 ± 2.80 µg/ml, respectively; P < 0.001), and they also had impaired endothelium-dependent (5.6 ± 3.6 vs. 8.6 ± 4.5%, respectively; P < 0.001) and -independent vasodilation (13.3 ± 4.9 vs. 16.5 ± 5.6%, respectively; P < 0.001). Plasma adiponectin correlated with endothelium-dependent vasodilation in controls (P = 0.02) and diabetic patients (P = 0.04). On general linear-model univariate analysis, brachial artery diameter, the presence of diabetes, plasma adiponectin, and high-density lipoprotein were significant independent determinants of endothelium-dependent vasodilation. In vitro experiments showed that endothelial cells expressed adiponectin receptors, and adiponectin increased nitric oxide production in human aortic endothelial cells.
In conclusion, low plasma adiponectin level is associated with impaired endothelium-dependent vasodilation, and the association is independent of diabetes mellitus. Adiponectin may act as a link between adipose tissue and the vasculature.
| Introduction |
|---|
|
|
|---|
In addition to its effect on glucose metabolism, adiponectin also appears to affect vascular function. Hypoadiponectinemia has been described in patients with diabetes, hypertension, and coronary artery disease (CAD) and is associated with an increase in C-reactive protein (CRP) levels (5, 8, 9, 10). In tissue cultures, adiponectin attenuates TNF-
-induced adhesion molecule expression in endothelial cells (11) and suppresses lipid accumulation in monocyte-derived macrophages through the suppression of macrophage-scavenger receptor expression (12). Animal studies have shown that an adenovirus-mediated supplement of adiponectin attenuates neointimal proliferation in mechanically injured arteries in adiponectin-deficient mice (13). Apolipoprotein E-deficient mice treated with recombinant adenovirus expressing human adiponectin have reduced arteriosclerosis in vivo (14). These data suggest that adiponectin has an antiatherogenic effect. Because adiponectin has been shown to suppress adhesion molecule expression in endothelial cells and reduce endothelial activation (10), we postulate that adiponectin may also potentially influence endothelial vasomotor function and a reduced level of adiponectin may be associated with impaired endothelium-dependent vasodilation. Because type 2 diabetes mellitus is frequently associated with hypoadiponectinemia, the aim of this study is to investigate whether plasma adiponectin level is correlated with endothelial dysfunction in patients with type 2 diabetes mellitus and to compare these patients with nondiabetic controls. The effect of adiponectin on endothelial-cell nitric oxide (NO) production in vitro is also determined.
| Patients and Methods |
|---|
|
|
|---|
Plasma total cholesterol and triglyceride (TG) were determined enzymatically on a Hitachi 912 analyzer (Roche Diagnostics, GmbH, Mannheim, Germany). High-density lipoprotein (HDL)-cholesterol was measured using a homogenous method, with polyethylene glycol-modified enzymes and
-cyclodextrin. Low-density lipoprotein (LDL)-cholesterol was calculated by the Friedewald equation. HbA1c was measured in whole blood using ion-exchange HPLC with the Bio-Rad Variant Hemoglobin Testing System (Bio-Rad Laboratories, Inc., Hercules, CA). Plasma high-sensitivity CRP was measured by a particle-enhanced immunoturbidimetric assay (Roche Diagnostics) using anti-CRP mouse monoclonal antibodies coupled to latex microparticles.
Plasma adiponectin level was determined by an in-house RIA assay, using a rabbit polyclonal antibody against adiponectin (16, 17). Serum was diluted 1000-fold before assay. A total of 100 µl of diluted serum or standard samples of recombinant human adiponectin were then incubated with 125I-labeled adiponectin tracer and rabbit antiadiponectin polyclonal antibody at room temperature overnight. The immunocomplexes were recovered by polyethylene glycol precipitation. Intra- and interassay coefficients of variation were 5.2% and 5.7%, respectively.
High-resolution B-mode ultrasound (ATL HDI 3000 ultrasound system, Advanced Technology Laboratories, Inc., Bothell, WA) was used to measure the IMT of the carotid artery. The anterior, lateral, and posterolateral projections were used to image longitudinally the right and left common carotid arteries. At each projection, three determinations of IMT were made at 2 cm proximal to the bulb and at the site of greatest thickness. The values at each site were averaged, and the greatest value of the averaged IMT was used as the representative value for each individual. Carotid plaque was defined as the presence of a focal lesion measuring at least twice the thickness of the IMT (18). If a plaque was present in one of the projections, that value was excluded from the analysis, and IMT was averaged on the remaining values.
Endothelium-dependent and endothelium-independent vasodilation of the brachial artery was assessed by high-resolution ultrasound as previously described (see Patients and Methods) (19). In brief, diameter measurements of the right brachial artery were taken at rest and then during reactive hyperemia after occlusion by inflation of a pneumatic tourniquet to a pressure of 300 mm Hg for 4.5 min. Twenty minutes were allowed for vessel recovery, and a resting scan was repeated. Sublingual glyceryl trinitrate spray (400 µg) was then administered, and measurement was taken after 5 min. Flow-mediated (endothelium-dependent) and glyceryl trinitrate-induced (endothelium-independent) vasodilation was calculated as the percentage change in diameter compared with baseline.
Results were expressed as mean and SD or median and interquartile range if the data were not normally distributed. We used a criterion for defining hypoadiponectinemia similar to that used in a study by Kumada et al. (9). Hypoadiponectinemia and impaired endothelial function were therefore defined as plasma levels of adiponectin and endothelium-dependent vasodilation below the cutoff points of the lowest quartile of the healthy controls (<5.49 µg/ml and <5.41%, respectively). Comparisons between two different groups were done using independent sample Students t test, and skewed data were logarithmically transformed before analysis. Pearsons correlations were used to test the relationship between variables. General linear model univariate analysis was used to assess the relationships between vasomotor function and various variables simultaneously. All analyses were performed using SPSS 11.0 for Windows (SPSS Inc., Chicago, IL).
In vitro experiments were performed to determine whether adiponectin influenced endothelial cell NO production and whether endothelial cells expressed adiponectin receptors (adipR) (20). Human aortic endothelial cells (Clonetics Corp., San Diego, CA) were grown in M199 medium supplemented with growth supplement, fetal bovine serum, and hydrocortisone. At 90% cell confluence, cells were starved for 18 h and then stimulated with a physiological concentration of human adiponectin (30 µg/ml) (16, 17). The cells were then incubated at 37 C for 24 h, and the amount of total NO produced was determined by measuring its metabolites using the Nitrate/Nitrite Fluorometric Assay Kit (Cayman Chemical, Ann Arbor, MI). Nitrate was first converted to nitrite using nitrate reductase. Then, 2,3-diaminonaphthalene was added, followed by NaOH, which converted nitrite into a fluorescent compound. Data are presented as mean ± SD determined from three independent experiments.
adipR expression was determined by RT-PCR. Total cellular RNA was isolated from human aortic endothelial cells using TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturers instructions. Two micrograms of total RNA was reverse-transcribed to synthesize cDNA using SuperScript First Strand Synthesis System (Invitrogen). cDNA was PCR-amplified using primers specific to human adipR as follows: human adipR1 (NM_015999): sense, GTCAGGGATCCGCTGAAGCTGCAGGGTATTC; antisense, GATCACTCGAGCTGAAGCTTGGTTGGTACTG; human adipR2 (NM_024551): sense, GACTAGAATTCATGG AAAAAATGGAAGAATTTG; antisense, GATCGCTCGAGCTGGC ATCAGTAGCCAGCAG.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Endothelial cells cause vasodilation by releasing a number of vasodilating substances. Generally, NO has been considered to be the principal mediator of this vasodilation, and impaired endothelium-dependent vasodilation is frequently associated with reduced bioavailability of NO (25). The mechanism(s) whereby adiponectin affects endothelium-dependent vasodilation have not been studied, and we speculate that there may be several potential mechanisms. Firstly, adiponectin might have a direct effect on vessel walls. Plasma adiponectin has been shown to accumulate rapidly in the subendothelial space of the injured human artery (26). adipR has recently been cloned (20), and we have shown for the first time that endothelial cells express both isoforms of adipRs and that adiponectin is able to stimulate NO production in endothelial cell culture. Chen et al. (27) have also reported that adiponectin stimulates phosphorylation and activation of endothelial NO synthase via phosphatidylinositol 3-kinase-dependent pathways and increases NO production in vascular endothelial cells. Hence, adiponectin might act as an endogenous modulator of endothelial cell function. Secondly, adiponectin may indirectly cause impaired endothelial vasomotor function through insulin resistance and its associated metabolic abnormalities (28). Thirdly, adiponectin may serve as an antiinflammatory molecule for vascular walls, and therefore low levels of adiponectin predispose patients to endothelial dysfunction. We have found an inverse relationship between plasma CRP and adiponectin levels in both our controls and diabetic patients. A similar inverse relationship between circulating CRP and adiponectin levels has also been described in subjects with CAD, and Ouchi et al. (10) have reported a reciprocal association between CRP and adiponectin mRNA levels in human adipose tissue. Therefore, it has been suggested that adiponectin might directly counteract the proinflammatory effects of TNF-
in vascular cellular components and adipose tissues (11, 29) or might indirectly influence IL-6 and CRP production through modulating the action of TNF-
.
In conclusion, low plasma adiponectin level is associated with impaired endothelium-dependent vasodilation in subjects with or without type 2 diabetes mellitus. In addition to its role in glucose metabolism, adiponectin may act as a link between adipose tissue and the vasculature. There is already some prospective data available suggesting that plasma adiponectin level is an inverse predictor of cardiovascular outcomes among patients with end-stage renal disease (30). Additional prospective studies are necessary to determine whether low plasma level of adiponectin can be considered as a cardiovascular risk factor.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: adipR, Adiponectin receptors; BMI, body mass index; CAD, coronary artery disease; CRP, C-reactive protein; HbA1c, hemoglobin A1c; HDL, high-density lipoprotein; IMT, intima-media thickness; LDL, low-density lipoprotein; NO, nitric oxide; TG, triglyceride.
Received June 11, 2003.
Accepted October 21, 2003.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Teoh, A. Quan, K. W. A. Bang, G. Wang, F. Lovren, V. Vu, J. J. Haitsma, P. E. Szmitko, M. Al-Omran, C.-H. Wang, et al. Adiponectin deficiency promotes endothelial activation and profoundly exacerbates sepsis-related mortality Am J Physiol Endocrinol Metab, September 1, 2008; 295(3): E658 - E664. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Q. Xu, K. Mahadev, X. Wu, L. Fuchsel, S. Donnelly, R. G. Scalia, and B. J. Goldstein Adiponectin Protects Against Angiotensin II or Tumor Necrosis Factor {alpha}-Induced Endothelial Cell Monolayer Hyperpermeability: Role of cAMP/PKA Signaling Arterioscler. Thromb. Vasc. Biol., May 1, 2008; 28(5): 899 - 905. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Chandrasekar, D. N. Patel, S. Mummidi, J.-w. Kim, R. A. Clark, and A. J. Valente Interleukin-18 Suppresses Adiponectin Expression in 3T3-L1 Adipocytes via a Novel Signal Transduction Pathway Involving ERK1/2-dependent NFATc4 Phosphorylation J. Biol. Chem., February 15, 2008; 283(7): 4200 - 4209. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. V. Wang and P. E. Scherer Adiponectin, Cardiovascular Function, and Hypertension Hypertension, January 1, 2008; 51(1): 8 - 14. [Full Text] [PDF] |
||||
![]() |
R. Li, W.-Q. Wang, H. Zhang, X. Yang, Q. Fan, T. A. Christopher, B. L. Lopez, L. Tao, B. J. Goldstein, F. Gao, et al. Adiponectin improves endothelial function in hyperlipidemic rats by reducing oxidative/nitrative stress and differential regulation of eNOS/iNOS activity Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1703 - E1708. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Masuyama, H. Nakatsukasa, N. Takamoto, and Y. Hiramatsu Correlation between Soluble Endoglin, Vascular Endothelial Growth Factor Receptor-1, and Adipocytokines in Preeclampsia J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2672 - 2679. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Johnston, B. L. Beezhold, B. Mostow, and P. D. Swan Plasma Vitamin C Is Inversely Related to Body Mass Index and Waist Circumference but Not to Plasma Adiponectin in Nonsmoking Adults J. Nutr., July 1, 2007; 137(7): 1757 - 1762. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-S. Chow, B. M.Y. Cheung, A. W.K. Tso, A. Xu, N. M.S. Wat, C. H.Y. Fong, L. H.Y. Ong, S. Tam, K. C.B. Tan, E. D. Janus, et al. Hypoadiponectinemia as a Predictor for the Development of Hypertension: A 5-Year Prospective Study Hypertension, June 1, 2007; 49(6): 1455 - 1461. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Beckman, A. B. Goldfine, A. Dunaif, M. Gerhard-Herman, and M. A. Creager Endothelial Function Varies According to Insulin Resistance Disease Type Diabetes Care, May 1, 2007; 30(5): 1226 - 1232. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K.Y. Cheng, K. S.L. Lam, Y. Wang, Y. Huang, D. Carling, D. Wu, C. Wong, and A. Xu Adiponectin-Induced Endothelial Nitric Oxide Synthase Activation and Nitric Oxide Production Are Mediated by APPL1 in Endothelial Cells Diabetes, May 1, 2007; 56(5): 1387 - 1394. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. Szmitko, H. Teoh, D. J. Stewart, and S. Verma Adiponectin and cardiovascular disease: state of the art? Am J Physiol Heart Circ Physiol, April 1, 2007; 292(4): H1655 - H1663. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wolk, P. Berger, R. J. Lennon, E. S. Brilakis, D. E. Davison, and V. K. Somers Association between plasma adiponectin levels and unstable coronary syndromes Eur. Heart J., February 1, 2007; 28(3): 292 - 298. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Negro and H. Hassan The effects of telmisartan and amlodipine on metabolic parameters and blood pressure in type 2 diabetic, hypertensive patients Journal of Renin-Angiotensin-Aldosterone System, December 1, 2006; 7(4): 243 - 246. [Abstract] [PDF] |
||||
![]() |
H. Takano, Y. Kodama, Y. Kitta, T. Nakamura, J.-e. Obata, A. Mende, K.-i. Kawabata, Y. Saitoh, D. Fujioka, T. Kobayashi, et al. Transcardiac adiponectin gradient is independently related to endothelial vasomotor function in large and resistance coronary arteries in humans Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2641 - H2646. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. U. Momin, N. Melikian, A. M. Shah, D. J. Grieve, S. B. Wheatcroft, L. John, A. El Gamel, J. B. Desai, T. Nelson, C. Driver, et al. Leptin is an endothelial-independent vasodilator in humans with coronary artery disease: evidence for tissue specificity of leptin resistance Eur. Heart J., October 1, 2006; 27(19): 2294 - 2299. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bajaj and O. Ben-Yehuda A Big Fat Wedding: Association of Adiponectin With Coronary Vascular Lesions J. Am. Coll. Cardiol., September 19, 2006; 48(6): 1163 - 1165. [Full Text] [PDF] |
||||
![]() |
R. Ouedraogo, X. Wu, S.-Q. Xu, L. Fuchsel, H. Motoshima, K. Mahadev, K. Hough, R. Scalia, and B. J. Goldstein Adiponectin Suppression of High-Glucose-Induced Reactive Oxygen Species in Vascular Endothelial Cells: Evidence for Involvement of a cAMP Signaling Pathway Diabetes, June 1, 2006; 55(6): 1840 - 1846. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. S. Hermann, W. Li, H. Dominguez, N. Ihlemann, C. Rask-Madsen, A. Major-Pedersen, D. B. Nielsen, K. W. Hansen, M. Hawkins, L. Kober, et al. Quinapril Treatment Increases Insulin-Stimulated Endothelial Function and Adiponectin Gene Expression in Patients with Type 2 Diabetes J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 1001 - 1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Schalkwijk, N. Chaturvedi, M. T. Schram, J. H. Fuller, C. D. A. Stehouwer, and the EURODIAB Prospective Complications Study Group Adiponectin Is Inversely Associated with Renal Function in Type 1 Diabetic Patients J. Clin. Endocrinol. Metab., January 1, 2006; 91(1): 129 - 135. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Singhal, N. Jamieson, M. Fewtrell, J. Deanfield, A. Lucas, and N. Sattar Adiponectin Predicts Insulin Resistance But Not Endothelial Function in Young, Healthy Adolescents J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4615 - 4621. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gungor, T. Thompson, K. Sutton-Tyrrell, J. Janosky, and S. Arslanian Early Signs of Cardiovascular Disease in Youth With Obesity and Type 2 Diabetes Diabetes Care, May 1, 2005; 28(5): 1219 - 1221. [Full Text] [PDF] |
||||
![]() |
B. Becker, F. Kronenberg, J. T. Kielstein, H. Haller, C. Morath, E. Ritz, D. Fliser, and for the MMKD Study Group Renal Insulin Resistance Syndrome, Adiponectin and Cardiovascular Events in Patients with Kidney Disease: The Mild and Moderate Kidney Disease Study J. Am. Soc. Nephrol., April 1, 2005; 16(4): 1091 - 1098. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Olijhoek, J. Koerselman, P. P.Th. de Jaegere, M. C. Verhaar, D. E. Grobbee, Y. van der Graaf, F. L.J. Visseren, and for the SMART Study Group Presence of the Metabolic Syndrome Does Not Impair Coronary Collateral Vessel Formation in Patients With Documented Coronary Artery Disease Diabetes Care, March 1, 2005; 28(3): 683 - 689. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S.-L. Lam, A. Xu, K. C.-B. Tan, L.-C. Wong, S.-C. Tiu, and S. Tam Serum Adiponectin Is Reduced in Acromegaly and Normalized after Correction of Growth Hormone Excess J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5448 - 5453. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. K. Shetty, P. A. Economides, E. S. Horton, C. S. Mantzoros, and A. Veves Circulating Adiponectin and Resistin Levels in Relation to Metabolic Factors, Inflammatory Markers, and Vascular Reactivity in Diabetic Patients and Subjects at Risk for Diabetes Diabetes Care, October 1, 2004; 27(10): 2450 - 2457. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Malyszko, J. S. Malyszko, S. Brzosko, S. Wolczynski, and M. Mysliwiec Adiponectin Is Related to CD146, a Novel Marker of Endothelial Cell Activation/Injury in Chronic Renal Failure and Peritoneally Dialyzed Patients J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4620 - 4627. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Goldstein and R. Scalia Adiponectin: A Novel Adipokine Linking Adipocytes and Vascular Function J. Clin. Endocrinol. Metab., June 1, 2004; 89(6): 2563 - 2568. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||