| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Laboratorio de Biología Molecular (V.J.G., C.M.M., C.M.R., S.D., V.V., H.M.T.), Cátedra de Genética y Biología Molecular, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, 1120 Buenos Aires, Argentina; and Thyroid Unit (J.V.T., G.M.-N.), Division of Endocrinology, Hospital das Clínicas, São Paulo University School of Medicine, 05403-900 São Paulo, Brazil
Address all correspondence and requests for reprints to: Dr. Héctor M. Targovnik, Laboratorio de Biología Molecular, Cátedra de Genética y Biología Molecular, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Av. Córdoba 2351, 4to piso-sala 5, 1120 Buenos Aires, Argentina. E-mail: htargovn{at}huemul.ffyb.uba.ar.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Several mutations in the human TG gene have been reported and are associated with congenital goiter (16, 17, 18, 19, 20, 21, 22, 23) or endemic (29) and nonendemic simple goiter (30, 31). In one such patient, there was defective synthesis of TG due to the absence of exon 4 from the major TG transcript because of a cytosine to guanine transversion at position minus 3 in the acceptor splice site of intron 3 (16). van de Graaf et al. (20) identified a point mutation in exon 7 that replaces the normal cytosine in nucleotide 886 with a thymine. As a result, the normal arginine in codon 277 is replaced with a stop codon (R277X). Other reports have indicated that cysteine substitutions (C1245R and C1977S in exons 17 and 33, respectively) cause an abnormal three-dimensional structure of TG and its defective intracellular transport (21). Molecular analysis in two members of a family with a history of congenital goiter reveal an aberrant splicing due to a guanine to thymine transversion at position +1 in the donor splice site of intron 30 (18, 22). More recently, we identified two siblings with fetal goitrous hypothyroidism caused by a compound heterozygous mutation (1143delC and 6725G
A [R2223H]) (23). In animals, hereditary thyroid disorders linked to TG defects have been reported in Afrikander cattle (R697X) (32), Dutch goats (Y296X) (33), cog/cog mouse (L2263P) (34), and rdw rats (G2320R) (35, 36).
We previously identified a TG nonsense mutation in members of a Brazilian family (MA) with a complex history of congenital goiter (37). An analysis of the TG transcripts in the goiter of one of the affected siblings showed a cytosine to thymine transition at nucleotide position 4588 in exon 22 that generates a stop codon at amino acid position 1511 (R1511X) (17). The nonsense mutation is thus removed from the transcripts by exon skipping, and there is a preferential accumulation in the goiter of a TG mRNA lacking exon 22. The nonsense mutation converts the TCGA sequence into TTGA, thus removing a Taq I site at this position in the mutant TG gene. The preliminary genetic studies indicate that the two affected siblings, their father, and three unaffected brothers are all heterozygous for the nonsense mutation (19). The mutation was not identified in the affected nephew, suggesting that at least one, and probably two, additional mutations of the TG gene segregate in this family.
In the present study, we extended our initial molecular studies to show that the MA family carries three different single nucleotide changes in the TG gene and that the affected individuals are either compound heterozygote for R277X/IVS341G>C or R277X/R1511X. This is, to our knowledge, the first time that the presence of two compound heterozygous constellations in the TG gene within a family is reported. We also present evidences that a founder effect accounts for the R277X mutation.
| Subjects and Methods |
|---|
|
|
|---|
A detailed clinical and laboratory evaluation (37), TG mRNA analysis (17), and initial genetic studies (19) of this nonconsanguineous MA family have been reported previously. The affected members, two siblings (II-1 and II-2) and one of their nephews (III-2), had goiter, congenital hypothyroidism, and a marked impairment of TG synthesis. The siblings father, six other siblings, the nephews brother, and the nephews father had no goiter and normal thyroid function.
The results of thyroid function tests of the MA family members studied are shown in Table 1
.
|
DNA sequencing
Genomic DNA was isolated from peripheral blood leukocytes following standard procedure. The complete coding sequence of the human TG gene, including regions of the TG promoter, and splicing signals and the flanking intronic regions of each intron, were amplified from the index patient III-2 by PCR as described previously (23). Forward and reverse intronic primers were specially designed for each one of the 48-TG exons (38, 39, 40, 41). Their oligonucleotide sequences and the position of their 5' coding sequence ends are shown in Table 2
. M13 sequences (18 nucleotides long) have been incorporated at the 5' end of the forward and reverse primers. After amplification, PCR products were run on a 2% agarose gel, stained with ethidium bromide, and visualized under UV light.
|
The results were analyzed using the PC gene (Intelligenetics, Geneva, Switzerland), DNASTAR (DNASTAR Inc., University of CaliforniaSan Francisco, San Francisco, CA) and Nucleotide BLAST (http://www.ncbi.nlm.nih.gov/BLAST) software programs.
Construction and expression of the minigenes
To study the effect of the IVS341G>C mutation, wild-type and mutated minigenes were constructed using the exon trapping vector pSPL3 (Life Technologies, Inc., Gaithersburg, MD). Genomic DNA region from index patient III-2 containing exon 35 and intronic flanking sequences (2138 bp upstream from the 5' exon end and 2252 bp downstream from the 3' exon end) was amplified by Long PCR technique, as described previously (42): the forward primer (pSPL3-In34F: 5' ccggaattctgacgtgagatgcatggta 3') containing the EcoRI site and the reverse primer (pSPL3-In35R: 5' ccggatatctcgagtgacagcaggatagctgaa 3') containing XhoI and EcoRV sites. The 4453 bp PCR products were purified using GFX PCR DNA and gel band purification kit (Amersham Biosciences, Piscataway, NJ) and sequentially digested with XhoI and EcoRI. The insert was directionally cloned into the EcoRI and XhoI sites of the pSPL3 vector. Because the index patient III-2 is heterozygous for the IVS341G>C mutation, the wild-type and mutated alleles were thus cloned. The recombinant plasmids were amplified in HB101 competent cells and purified using Concert high purity plasmid miniprep system (Life Technologies, Inc.). The correct sequence was confirmed by sequencing (fmol; Promega) with the pSPL3-In34F primer.
CV-1 cells were grown in 3.8-cm dishes in DMEM supplemented with 5% bovine calf serum and 100 U/ml penicillin-streptomycin in a 5% CO2 atmosphere at 37 C. When cells reached approximately 90% confluence, they were transfected with 1 µg plasmid DNA (wild-type, mutant, and control pSPL3)/3.8-cm dish with the Lipofectamine 2000 (Invitrogen, Life Technologies, Carlsbad, CA). Forty-eight hours later, cells were harvested and total RNA was extracted with Trizol (Invitrogen, Life Technologies). The RT-PCR was performed as described previously (17) using vector-specific primers: forward primer (pSPL3F), 5' tctgagtcacctggacaacc 3' and reverse primer (pSPL3R), 5' atctcagtggtatttgtgagc 3'. Samples were heated to 95 C for 3 min, followed by 40 cycles of DNA denaturation (95 C for 30 sec), annealing (62 C for 30 sec), and polimerization (72 C for 1 min). After the last cycle, the samples were incubated for an additional 10 min at 72 C. The RT-PCR products were purified from the gel as described above, cloned into pGemT-easy vector (Promega), and then sequenced (fmol; Promega) with the pSPL3F primer.
Identification of 886C>T and IVS341G>C mutations by single-strand conformation polymorphism (SSCP) analysis
SSCP was used to screen for the presence of 886C>T and IVS341G>C mutations. PCR was performed using the intronic forward and reverse exon 7 and exon 35 primers (Table 2
) under identical PCR conditions as reported previously (23).
The gel matrix for SSCP contained 8% (886C>T mutation) or 10% (IVS341G>C mutation) polyacrylamide (29:1) (Invitrogen, Life Technologies), without glycerol. Samples were electrophoresed for up to 18 h at a constant temperature (4 C). DNA was visualized by silver-staining according to standard procedures.
Identification of 4588C>T mutation by Taq I restriction analysis
The mutation detected at position 4588 in exon 22 destroys a Taq I recognition site (17, 19). The presence of the mutation was, therefore, independently analyzed by restriction analysis with Taq I. A 316-bp fragment containing exon 22 was generated by PCR, under identical PCR conditions as described previously (23), using the intronic forward and reverse exon 22 primers (Table 2
). Restriction enzyme digestion with Taq I was performed as recommended by the manufacturer (New England BioLabs Inc., Beverly, MA). After digestion, the DNA fragments were separated on a 12% polyacrylamide gel. Digestion of the wild-type allele results in two fragments of 125 and 191 bp.
Insertion/deletion (Indel) polymorphism analysis
The large Indel polymorphism of 1464 bp localized in intron 18 of the human TG gene (42) was analyzed by multiplex PCR. The reactions were performed in 50 µl, using a standard PCR buffer (Highway Molecular Biology, Tandil, Argentina), containing 200300 ng DNA, 2.5 mmol/liter MgCl2, 200 µmol/liter of each dNTP, 1 U Taq polymerase (Highway Molecular Biology), and 100 pmol of each primer. The primers used were 18 forward primer (Table 2
), i183-F (intronic forward primer, located in the 1464 Indel region) (42) and i181-R (intronic reverse primer) (42).
Samples were heated to 94 C for 2 min, followed by 35 cycles of DNA denaturation (94 C for 30 sec), annealing (55 C for 30 sec), and polymerization (72 C for 1 min). After the last cycle, the samples were incubated for an additional 10 min at 72 C. The amplified fragments were analyzed in a 2% agarose gel.
The amplification generates two fragments of 374 (between 18 forward primer and i181-R) and 541 (between i183-F and i181-R) bp, indicating the exclusion or inclusion of the Indel polymorphic region, respectively.
Microsatellite analysis
The TGrI29 microsatellite, localized in intron 29 of the human TG gene, was amplified using the primers and PCR conditions described previously (43). PCR products were resolved by electrophoresis in 6% polyacrylamide denaturing gels.
Single nucleotide polymorphism (SNP) analysis
Taq I endonuclease was used to screen for the presence of the 7589G>A SNP in exon 44. The primers and PCR conditions were described previously (44). The samples were cleaved with Taq I restriction endonuclease according to the specifications of the manufacturer (Invitrogen, Life Technologies) and analyzed by electrophoresis in 12% polyacrylamide gel. The fragment contains two Taq I sites (positions 7587 polymorphic and 7667 not polymorphic). Taq I restriction showed two fragments (94 and 107 bp) in the homozygous form with absence of the 7587 Taq I site, three fragments (27, 80, 94 bp) in the homozygous form with presence of the 7587 Taq I site, and four fragments (27, 80, 94, and 107 bp) in the heterozygous state.
| Results |
|---|
|
|
|---|
All 48 exons of the TG gene from index patient III-2 (affected nephew) from the MA family were analyzed as well as 180 bp of the TG promoter and all the flanking regions of each intron. A total of 15,000 bases were analyzed. A heterozygous cytosine to thymine transition at nucleotide position 886 in exon 7 (886C>T) was found in the proposita. Its position in the gene near the end of the exon is schematically given in Fig. 1
, and the expected amino acid sequence after translation is also shown. Instead of encoding for an arginine residue at amino acid position 277, the triplet harboring the mutation encodes for a premature stop codon (R277X). The same nonsense mutation had been reported previously in the offspring of a consanguineous Brazilian kindred with multiple occurrence of congenital hypothyroidism with goiter (20). The GT-AG splicing consensus sequences are rigorously respected in all introns, except for the acceptor splice site of intron 34. A novel heterozygous G to C transversion was observed at position -1 (IVS341G>C), compared with the expected sequence (AC instead of AG) (Fig. 2
).
|
|
We reported previously that both affected siblings II-1 and II-2 were heterozygous for the 4588C>T mutation (R1511X) (17). In contrast, because their sister II-8 carries the R277X mutation, we speculated that II-1 and II-2 also carry this mutation together with the R1511X mutation. To test this hypothesis, we performed direct sequencing of PCR products of exons 7 (Fig. 1
) and 22 (data not shown) from II-1, II-2, II-3 (unaffected siblings brother), and their father I-1. The results indeed indicated that II-1 and II-2 have inherited one copy of the R277X from their mother (I-2) and one copy of the R1511X mutation from their father. Their healthy brother (II-3) is heterozygous for the R1511X mutation and does not carry the R277X mutation. These results are in perfect agreement with the data obtained previously in the thyroid tissue of II-2 (17) and in direct and indirect segregation analyses (19).
Minigenes analysis
We tested a minigene containing the IVS341G>C mutation for abnormal splicing using the exon trapping system. In vitro transcription showed that the exon 35, which consists of 63 bp, is skipped entirely when the IVS341G>C mutation is present, whereas the minigene that contains the wild-type allele is spliced correctly (Fig. 3
).
|
Genomic DNA from each MA family member was amplified in separated PCR reactions with use of the sense and antisense primers for exons 7, 22, and 35. The PCR fragments were analyzed by SSCP (exon 7 and 35) or restriction analysis (exon 22) using Taq I.
As shown in Fig. 4
, individuals II-1, II-2, II-8, III-1, and III-2 were heterozygous for the presence of an aberrant fragment in SSCP analysis of exon 7. These results indicate that the three affected individuals (III-2, II-1, II-2), the nephews mother (II-8), and the unaffected nephew (III-1) are all heterozygous for the R277X mutation.
|
SSCP analysis of exon 35 confirmed that III-2 and his father are heterozygous for the IVS341G>C mutation (Fig. 4
). IVS341G>C was not detected in 50 unaffected unrelated control subjects by SSCP analysis.
Segregation analyses of polymorphic markers in the TG gene
The previously characterized markersIndel located in intron 18 (42), the microsatellite in intron 29 (TGrI29) (43), and the 7589G>A SNP in exon 44 (44)proved to be interesting and informative polymorphisms for indirect segregation analysis of the mutations in the MA family.
The results show that the two affected siblings, II-1 and II-2, are homozygous for the 541 bp Indel allele and the 29.3 microsatellite allele (Fig. 5
); I-1 (father), II-3, II-6,and II-7 (carriers of the R1511X mutation and normal thyroid function) are heterozygous for the 374- and 541-bp alleles in the Indel system and 29.2 and 29.3 alleles in the microsatellite, whereas II-4 and II-5 (noncarriers of any nonsense mutations) are homozygous for the 374- and 29.2-bp alleles.
|
The unaffected nephews mother, II-8 (carrier of the R277X mutation), displays heterozygosity for the 374- and 541-bp Indel alleles and for 29.2 and 29.3 microsatellite alleles (Fig. 5
), whereas the healthy nephew III-1 (carrier of the R277X mutation) is homozygous for the 541-bp and 29.3 alleles. The unaffected nephews father, II-9 (carrier of the IVS341G>C mutation), and the affected nephew, III-2, are homozygous for the 541-bp Indel allele and heterozygous for the 29.2 and 29.3 microsatellite alleles. This implies that the IVS341G>C mutation is associated with the 541-bp Indel and 29.2 microsatellite alleles.
The two brothers, III-1 and III-2, and their father, II-9, are homozygous for the presence of the Taq I site in the 7589G>A SNP analysis (Fig. 5
), whereas their mother, II-8, is heterozygous because she inherited a wild-type allele with adenine at position 7589 from her father.
The results of haplotype analyses of the R277X, R1511X, and IVS341G>C mutations and Indel, microsatellite, and SNP markers in the TG gene of MA family members are shown in Fig. 6
. An important observation is that II-8 has a clearly distinct haplotype. The mothers (I-2) haplotype data were inferred with the aid of her siblings.
|
| Discussion |
|---|
|
|
|---|
We previously characterized the structure of the TG gene and defined the intronic sequence adjacent to each of the 48 coding exons (38, 39, 40, 41) to provide tools for detecting mutations and sequence variants by either direct sequence analysis or other methods of mutation detection such as SSCP. We also identified polymorphic markers within introns and exons of the TG gene that should be useful in either linkage or association studies (42, 43, 44). TG is encoded by a single gene of 270 kb located on chromosome 8q24 and contains an 8.5-kb coding sequence (38, 39, 40, 41). The preprotein monomer is composed of a 19-amino acid signal peptide, followed by a 2749-residue polypeptide. Eighty percent of the monomeric primary structure is characterized by the presence of three types of repetitive units (Fig. 7A
). The remaining 20%, which constitutes the carboxy-terminal domain of the molecule, is not repetitive and shows a striking homology with acetylcholinesterase (41). The monomer structure includes 11 type 1, three type 2, and five type 3 repeat motifs. TG is glycosylated and forms a dimer. A correct three-dimensional structure is essential for thyroid hormonogenesis.
|
The 4588 C>T transition in exon 22 is also characterized by a predicted premature stop codon, which results in a truncated protein of 1510 amino acids (R1511X) (Fig. 7C
). However, this mutation is not present in most of the TG mRNA transcripts because the detected TG mRNA lacks 171 nucleotides corresponding to exon 22. Interestingly, skipping of mutated exon 22 (17) in the pre-mRNA restores the reading frame allowing translation to reach the normal stop codon (Fig. 7D
). This alternative splicing is also present in mRNA from normal thyroid tissue, but it represents a minor fraction of the total TG transcripts (17). The excision of exon 22 in the TG mRNA results in an in-frame deletion of 57 amino acid residues, which is localized in the TG type 1 repeat motif (subtypes: 111, Fig. 6A
). A TTG leucine codon is generated by the junction. The nonsense mutations in exon 7 and 22 occur in a CpG dinucleotide sequence and could be caused by deamination of a methylated cytosine resulting in a thymine. The CGA arginine codon is considered a hot spot for mutations in mammalian DNA.
The third mutation found in this family is a novel G to C transversion at position -1 in the acceptor site of intron 34. This infers the possibility that the splice site mutation might generate a total elimination of exon 35 of the TG gene (Fig. 7E
) because removal of 63 nucleotides maintains the reading frame. It is known from other genes that mutations in this site, which alter the consensus acceptor site, can result in exon skipping. We ruled out the possibility that the IVS341G>C mutation could be a common polymorphism because it was not detected in 100 chromosomes from the general population by SSCP analysis. In contrast, exon 35 is the smallest exon of the TG gene and is flanked by two large introns (intron 34: 10,608 bp; intron 35: 28,488 bp) (40). It is conceivable that intron size could affect the splicing; however, the presence of this alternative transcript was not detected in humans by RT-PCR reactions (17, 41).
Because the thyroid tissue from III-2 is unavailable, we used an in vitro exon-trapping system to evaluate whether the IVS341G>C mutation produces an abnormal transcript by a defect in exon splicing. Minigenes were constructed using the pSPL3 vector, which has a minimal gene organization: the SV40 promoter followed by an exon-intron-exon structure with a multiple cloning site located inside the intron. When a fragment cloned in the multiple cloning site contains functional exons with their corresponding splicing sites, they are included in the mature mRNA. We found that in in vitro transcription the mutation in the acceptor splice site caused skipping of the exon 35 (Fig. 3
). The excision of exon 35 in the TG mRNA results in an inframe deletion of 21 amino acid residues, which are located in the TG type 3 repeat motif (subtypes 3b-2, Fig. 7A
). An ATG methionine codon is generated by the junction. Therefore, the minigenes and the CV-1 cells are an adequate genetic and cellular environment to recreate the splicing pattern of TG exon 35.
The functional consequences of the deletion of exon 22 or 35 could be structural changes in the protein molecule that alter the normal protein folding and assembly, leading to a marked reduction in the ability to export the protein from the endoplasmic reticulum with massive induction of selective synthesis of molecular chaperones, which bind to the misfolded exportable protein (34, 45). Alternatively, it is possible that the elimination of exons containing repeat motifs by alternative splicing or splicing errors would result in an altered ability to transfer an iodophenoxyl group from the donor site to the acceptor iodotyrosine in the coupling machinery. Cysteines are thought to play an important role in the tertiary structure of TG, and five cysteine residues are localized in exon 22 and one in exon 35. Exon 22 contains a tyrosine residue, at position 1510, that might be involved in hormonogenesis.
In this kindred, we also characterized polymorphisms (Indel, microsatellite, and SNP) located within introns 18 and 29 and exon 44 (42, 43, 44) that are associated with the described mutations. The availability of informative polymorphic markers will allow indirect disease diagnosis by linkage or association studies, such as in cases with no identified mutations and for rapid identification of affected newborns or gene carriers in families with TG mutations. Additionally, these three polymorphic markers are well suited for routine use in laboratories engaged in linkage or association analysis in families with autoimmune thyroid diseases. Interestingly, all six affected individuals from the two unrelated Brazilian families with congenital goiter and hypothyroidism harboring the mutation R277X, either in a homozygous state (20) or as a compound heterozygous mutation with R1511X or IVS341G>C, had an identical haplotype for these three polymorphic markers. This suggests that both families may have a distant common ancestor and, consequently, that R277X is a putative founder mutation.
Five different conclusions emerged from our study. First, the sequencing of the entire coding sequence of the human TG gene, including part of the TG promoter, the splicing signals, and the flanking intronic regions of each intron revealed that three different mutations are present in the MA family: 886C>T (R277X), 4588 C>T (R1511X), and IVS341G>C. Second, this finding established the inheritance of two compound heterozygous constellations (R277X/IVS341G>C or R277X/R1511X). Third, in vitro transcription analysis confirmed that exon 35 is skipped entirely when the IVS341G>C mutation is present. Fourth, analysis of Indel, microsatellite, and SNP in the MA family showed association between the mutant TG alleles and the polymorphic markers. Finally, the two unrelated families that carry the R277X mutation had an identical haplotype for the three markers analyzed, suggesting a founder effect for the R277X mutation. These studies confirm the allelic heterogeneity of TG gene mutations, alterations that may provide insight into the structure-function relationship of TG.
| Acknowledgments |
|---|
| Footnotes |
|---|
C.M.M. is a research fellow of the Universidad de Buenos Aires. C.M.R. is a research fellow of the Argentine National Research Council. H.M.T. is an established investigator of the Argentine National Research Council. J.V.T. presently is a postdoctoral fellow supported by Conselho Nacional de Desenvolvimento Científico e Tecnológico, Brazil (201571/88-91) at Northwestern University (Chicago, IL).
V.J.G. and C.M.M. contributed equally to the study.
Abbreviations: Indel, Insertion/deletion; SNP, single nucleotide polymorphism; SSCP, single-strand conformation polymorphism; TG, thyroglobulin.
Received April 3, 2003.
Accepted October 16, 2003.
| References |
|---|
|
|
|---|
A[R2223H]) resulting in fetal goitrous hypothyroidism. J Clin Endocrinol Metab 88:35463553This article has been cited by other articles:
![]() |
M. Caputo, C. M Rivolta, V. J Gutnisky, L. Gruneiro-Papendieck, A. Chiesa, G. Medeiros-Neto, R. Gonzalez-Sarmiento, and H. M Targovnik Recurrence of the p.R277X/p.R1511X compound heterozygous mutation in the thyroglobulin gene in unrelated families with congenital goiter and hypothyroidism: haplotype analysis using intragenic thyroglobulin polymorphisms J. Endocrinol., October 1, 2007; 195(1): 167 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hishinuma, S. Fukata, S. Nishiyama, Y. Nishi, M. Oh-Ishi, Y. Murata, Y. Ohyama, N. Matsuura, K. Kasai, S. Harada, et al. Haplotype Analysis Reveals Founder Effects of Thyroglobulin Gene Mutations C1058R and C1977S in Japan J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3100 - 3104. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Alzahrani, E. Y. Baitei, M. Zou, and Y. Shi Metastatic Follicular Thyroid Carcinoma Arising from Congenital Goiter as a Result of a Novel Splice Donor Site Mutation in the Thyroglobulin Gene J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 740 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Varela, C. M. Rivolta, S. A. Esperante, L. Gruneiro-Papendieck, A. Chiesa, and H. M. Targovnik Three Mutations (p.Q36H, p.G418fsX482, and g.IVS19-2A>C) in the Dual Oxidase 2 Gene Responsible for Congenital Goiter and Iodide Organification Defect Clin. Chem., February 1, 2006; 52(2): 182 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Rivolta, C. M. Moya, V. J. Gutnisky, V. Varela, J. M. Miralles-Garcia, R. Gonzalez-Sarmiento, and H. M. Targovnik A New Case of Congenital Goiter with Hypothyroidism Caused by a Homozygous p.R277X Mutation in the Exon 7 of the Thyroglobulin Gene: A Mutational Hot Spot Could Explain the Recurrence of This Mutation J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3766 - 3770. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |