| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Molecular and Cellular Biology (I.U.A., N.L.W., D.G.K.) and Obstetrics and Gynecology (D.G.K.), Baylor College of Medicine, Houston, Texas 77030; Red Cross Blood Bank (K.K.), 89081 Ulm, Germany; Department of Biomathematics, University of Texas M. D. Anderson Cancer Center (N.E.A.), Houston, Texas 77030; Department of Pathology and Program in Molecular Biology, University of Colorado Health Sciences Center (D.P.E.), Denver, Colorado 80262; Department of Obstetrics and Gynecology, University Hospital Maastricht (D.-C.F., D.G.K.), 6202 AZ Maastricht, The Netherlands; Texas/United Kingdom Collaborative Research Initiative, Rice University (D.R.H.), Houston, Texas 77251; and Department of Obstetrics and Gynecology, Tongji University (X.-W.T.), 200065 Shanghai, People’s Republic of China
Address all correspondence and requests for reprints to: Dr. Dirk G. Kieback, Department of Obstetrics and Gynecology, Maastricht University Medical Center, P. Debyelaan 25, NL 6202 AZ Maastricht, The Netherlands. E-mail: dki{at}sgyn.azm.nl.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Growth and differentiation of breast and ovary are highly dependent on steroid hormones and their cognate receptors. Two isoforms of the progesterone receptor (PR) are known (PRA and PRB), and they are generated by utilization of different start codons present in the PR gene. Human PRB is 164 amino acids longer than the PRA isoform, and the isoforms exhibit unique biological action (5). During pregnancy, PR is required in breast for increased branching, formation of the lobular-alveolar structures, and milk protein synthesis (6). Using a mouse PR knockout model in which the A isoform was deleted, it has been shown that the B isoform is sufficient to induce proliferative and differentiation responses in the mammary gland (7). Elimination of the B isoform causes defects in mammary gland development (8). In the ovary, PR is absolutely necessary for ovulation, because the antiprogestin RU486 inhibits ovulation (9), and PR knockout animals fail to ovulate despite exposure to superovulatory levels of gonadotropins (6).
PR has also been implicated in development of breast and ovarian cancers. It is expressed in mammary epithelium and in the human ovarian surface epithelium, the site where more than 90% of ovarian cancers originate (10). Chemical and steroidal induction of tumorigenesis using wild-type (WT) and PR knockout animals demonstrated that PR facilitates initiation of tumorigenesis in rodent breast and ovary (11, 12). Moreover, progesterone signaling greatly increases chromosomal instability in mouse mammary gland (13).
Little is known about the role of PR and PR mutations in cancer. The first restriction fragment length polymorphism (RFLP) in the PR gene, caused by a 320-bp Alu insertion in intron G, was reported in 1991 (14). The HindIII PR gene RFLP did not display typical Mendelian distribution in the breast tumors; the factors affecting the HindIII allele frequencies are presently unknown (14). As Alu insertions in the intron of a gene can be associated with mutations elsewhere in the same gene, the complete coding region of the gene was examined by single strand conformation polymorphism (SSCP) analysis and sequencing of the full-length PR in 30 individuals harboring this polymorphism. Two additional variations that are strongly linked to the Alu insertion were identified: a silent substitution in exon 5 (H770H) and an amino acid change in exon 4 (V660L) (15, 16, 17). The V660L mutation is located in the hinge region of the PR, a poorly conserved sequence between the ligand and DNA binding domains of steroid receptors. It plays a role in receptor dimerization, nuclear localization, ligand binding, and interaction with corepressors (18, 19). This receptor variant, consisting of the 320-bp Alu insertion in intron G and the point mutations in exon 4 (V660L) and exon 5 (H770H), was named PROGINS. Our analysis of the frequency of PROGINS in ovarian cancer patients and corresponding healthy populations from different origins indicated that the PROGINS haplotype is more frequently identified among patients, thereby suggesting that PROGINS might participate in ovarian carcinogenesis. Moreover, our functional comparison of mutated (M) and WT PR revealed that the M receptor is more stable than the WT one, resulting in higher expression and increased transcriptional activity.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
WT PRB was cloned in the BamHI site of the pLEN vector (20). WT PRB and PRA were recloned into the BamHI site of pcDNA3.1 (Invitrogen Life Technologies, Inc., Carlsbad, CA) vector. The V660L mutation was introduced into pLEN PRB using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), and this plasmid was used to clone M PRB and M PRA into the BamHI site of pcDNA3 vector. All plasmids were verified by DNA sequencing. The sequence of the primer used for mutagenesis was: TCTCCCACAGCCATTGGGCGTTCCAAAT [the site of the mutation (G to T) is underlined]. The reporter plasmid GRE2-E1b-chloramphenicol acetyltransferase (GRE2-E1b-CAT) was obtained from Dr. John Cidlowski (NIEHS) (21).
Promegestone (R5020) and [35S]methionine were purchased from PerkinElmer (Boston, MA), [3H]chloramphenicol was obtained from NEN (Boston, MA), and poly-L-lysine was purchased from Sigma-Aldrich Corp. (St. Louis, MO). Tissue culture reagents and supplies were obtained from Fisher Scientific (Pittsburgh, PA) and Invitrogen Life Technologies, Inc. All other chemicals were reagent grade.
DNA isolation
DNA was extracted from paraffin-embedded tumor tissues essentially as previously described (22). Briefly, the sections (5 µm) were deparaffinized with octane, washed with ethanol, and digested with proteinase K. The protease was heat inactivated at 95 C, insoluble cell debris was removed by centrifugation, and the supernatants were subjected to PCR analysis.
SSCP assay
The complete coding region of the human PR gene was screened using SSCP analysis. Exons were amplified with the addition of [
-32P]deoxy-CTP. The exon-specific primers are summarized in Table 1
. A standard PCR reaction mixture (10 µl) was prepared containing 1 µCi [-32P]deoxy-CTP and 100 ng genomic DNA. PCR products were resolved on a nondenaturing polyacrylamide gel to identify conformational changes. Briefly, 1 µl of the reaction mixture was added to 4 µl stop solution (95% formamide, 20 mM EDTA, 20 mM NaOH, 0.05% bromophenol blue, and xylene cyanol), applied to a 7% nondenaturing polyacrylamide gel, and run in 0.6x TBE buffer (89 mM Tris-borate and 2 mM EDTA, pH 8.0) at constant power (exon 4: 14 h, 8 watts; exon 5: 10 h, 6 watts). Finally, the gel was dried and exposed overnight. SSCP analysis revealed an aberrant migration of the amplified exons 4 and 5, which subsequently were submitted to sequence analysis.
|
The PCR products of exons 4 and 5 were purified through Centricon-100 columns (Amicon, Inc., Beverly, MA) as recommended by the manufacturer, and the same primers used for amplification were used for cycle sequencing in both directions (Thermo Sequenase Radio Labeled Terminator Cycle Sequencing kit, Amersham Biosciences, Piscataway, NJ). Samples were resolved on a 6% polyacrylamide gel, dried, and analyzed on a Fuji X BAS 1000 phosphorimager using MacBas program version 2.0 (Fuji Photo Film Co. Ltd., Kohshin Graphic Systems, Inc., Tokyo, Japan).
RFLP analysis of exons 4 and 5
DNA fragments generated after amplification of genomic DNA with primer pairs specific for exons 4 and 5, respectively, were subsequently digested with BsrI (exon 4) and NlaIII (exon 5). Enzymatic digestions were performed as recommended by the manufacturer (New England Biolabs, Beverly, MA). BsrI cleaves WT exon 4 into four fragments (from 5' to 3': 47, 22, 157, and 80 bp), whereas the M exon is cut into three fragments (from 5' to 3': 47, 179, and 80 bp). NlaIII digestion of WT exon 5 results in two fragments of 99 and 46 bp, whereas the M exon 5 lacks the NlaIII cleavage site.
Study population
Samples taken from patients (n = 84) who underwent surgery for ovarian cancer between 1980 and 1995 at Ulm University Medical Center (Ulm, Germany) were included. Patients were selected without regard to family history. DNA isolated from 440 healthy female volunteers without a history of cancer served as a control group. This set of samples was collected and provided anonymously by the blood bank Ulm (K.K.). The ovarian cancer patients and the healthy volunteers both agreed to the use of these specimens for research purposes in advance.
Peripheral blood samples of 120 healthy female Caucasians, 100 Hispanics, and 101 African-Americans from the United States were collected at the blood bank of Baylor College of Medicine (Houston, TX). In addition, whole blood samples from Chinese ovarian cancer patients (n = 114) and healthy female volunteers (n = 512) were provided from Tongji Medical University (Wuhan, Peoples Republic of China). Informed consent was obtained from all study participants.
Statistical methods
Statistical significance of the difference in frequencies between the control group and the group of ovarian cancer patients was confirmed by 
2 test of independence, and P values are based on 2 values from contingency table analysis. For computation, the StataXact (Cytel, Cambridge, MA) software package was used; P values for the Chinese population are based on exact calculations. The P values for Hardy-Weinberg equilibrium are two-sided and were obtained according to Yates by doubling the one-sided P value (23).
Transient transfection
Transient transfections were performed as described previously. The indicated plasmid DNAs were ionically bound to polylysine-coupled adenovirus using a cell to viral particle ratio of 1:500 (24).
Transactivation assay
COS-1, HeLa, and MDAH:2774 cells were purchased from American Type Culture Collection (Manassas, VA) and were maintained as recommended by American Type Culture Collection. The GRE2-E1b-CAT reporter, a gift from Dr. J. Cidlowski (21), was used to compare activities of WT and M receptor. Cells (COS-1, 9 x 104 cells/well; HeLa, 1.5 x 105 cells/well; MDAH:2774, 2 x 105 cells/well) were plated in six-well plates 1 d before transfection. Five hundred nanograms of GRE2-E1b-CAT reporter plasmid and the indicated amounts of either M or WT PR were transfected. The transfected cells were incubated 24 h in medium containing 5% charcoal-stripped fetal calf serum (FCS) with or without 10 nM R5020. Subsequently, cells were harvested and assayed for CAT activity as previously described (25). Each data point was tested in triplicate using multiple preparations of both M and WT receptor DNA.
Hormone binding assay
COS-1 cells were transfected with 250 ng of either M or WT PRB plasmid or were mock-transfected with the corresponding vector essentially as previously described (24). The transfected cells were incubated overnight in DMEM containing 5% (vol/vol) charcoal-stripped FCS. Two hours before harvesting, [3H]R5020 (final concentration, 50–6400 pM) was added to the medium. The harvested cells were washed with PBS and subjected to ethanol extraction, and bound hormone was measured by scintillation counting. Nonspecific binding of the hormone in mock-transfected cells was subtracted to obtain specific binding. Each data point was determined at least in duplicate.
Pulse-chase analysis
COS-1 cells were transfected with 250 ng of either M or WT PRB expression plasmid and allowed to express PR for 24 h. Cells were then placed in a medium containing 10% dialyzed FCS for 1 h. For biosynthetic labeling, cells were cultured in the presence of 100 µCi/ml [35S]methionine (specific activity, >1000 Ci/mmol) for 4 h. After three washes with PBS, DMEM containing 5% dialyzed FCS and a 100-fold excess of unlabeled methionine was added. At the times indicated, cells were harvested, and PR was immunoprecipitated using antibody AB 1294 (26). Immunoprecipitated protein was run on a 6% polyacrylamide-sodium dodecyl sulfate gel; the gel was dried and exposed to a phosphorimager plate for 3 h. The amount of radioactive protein was assessed using a Fuji X BAS 1000 phosphorimager (Fuji Photo Film Co., Tokyo, Japan) and MacBas version 2.0 software. Signal intensity in pixels was plotted against time, and the exponential trendline was added to the degradation curve. The equation for the trendline was used to calculate the half-life of the receptor.
Intracellular dissociation rate of R5020 from PR
COS-1 cells were transfected with 100 ng of either WT or M human PRB. Twenty-four hours later, the medium was replaced with serum-free DMEM containing 3 nM [3H]R5020 in the presence or absence of 300 nM unlabeled R5020. After 2 h of incubation, cells were washed, and dissociation of bound ligand was initiated by adding a 1000-fold excess of unlabeled R5020. At the time intervals indicated, a hormone binding assay was performed as described above. Radioactivity was determined by scintillation counting, and the amount of hormone specifically bound to the receptor was calculated.
GenBank accession numbers
The accession number for the Alu insertion into intron G of the PR gene called PROGINS is GDB Z49816. The accession number for the PR gene allele with the three described changes (PROGINS allele) is AF016381.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We and others have previously described the PR RFLP caused by insertion of the Alu repeat in intron G (14, 15, 27). It is known that an Alu insertion in the intron of a gene can be associated with a mutation elsewhere in the same gene (28). Therefore, we examined the complete coding region of the PR gene by SSCP in 30 individuals carrying this Alu insertion. We identified two additional changes in exons 4 (V660L) and 5 (H770H). The exon 5 mutation created an additional NlaIII site, whereas the exon 4 mutation abolished a BsrI site. These findings were used to devise a diagnostic strategy consisting of PCR amplification of exons 4 and 5, followed by digestion with the restriction enzymes mentioned above and subsequent gel electrophoresis (PCR-RFLP). The presence of the Alu insertion in intron G was verified by PCR analysis and subsequent agarose gel electrophoresis.
PROGINS is a risk factor for sporadic ovarian cancer
To determine whether PROGINS might be a genetic risk factor for nonfamilial ovarian cancer and to investigate whether it cosegregates with an increased risk for ovarian cancer, we examined the frequency of PROGINS in the genomic DNA of healthy German Caucasians and central mainland Chinese women and ovarian cancer patients from the same ethnic groups. For this purpose, the PCR strategy described above was used, and all samples were tested for the presence of all three mutation to minimize the number of false negatives. Compared with the corresponding control population, we found approximately 2- and 4.5-fold increases in the frequency of PROGINS among German Caucasians and Chinese ovarian cancer patients, respectively (Table 2). However, no statistically significant differences with respect to the histology of cancer tissue and the age at diagnosis of ovarian cancer were seen between carriers and noncarriers of the PROGINS allele (data not shown). The frequency of PROGINS translated into odds ratios of 3.02 (German Caucasians) and 4.55 (Chinese women) and correlated well with the incidences of sporadic ovarian cancer in the five ethnic groups studied (Table 3) (29, 30, 31). Examination of the allele distribution in these populations revealed a deviation from Hardy-Weinberg distribution in Chinese and Hispanic groups. In 1603 specimens tested, all three alterations always occurred together. Thus, a PR with the three described changes represents a new allele that is frequent in many ethnic populations, indicating an early origin in human evolution. Although the frequency of PROGINS did not differ in a statistically significant manner between healthy women and ovarian cancer patients, our data suggest an association between PROGINS and the risk for ovarian cancer. In a first effort to verify the likelihood of this hypothesis, a functional comparison of WT and M PR was performed.
|
|
Because the mutation is located in the hinge region close to the hormone binding domain (Fig. 1A), we first compared the hormone binding affinities of WT and M PR. COS-1 cells transfected with saturating amounts of WT, M PRB, or vector (background) were treated with various concentrations of [3H]R5020, and hormone binding was measured (Fig. 1B). The slope of the curves generated by Scatchard analysis (Fig. 1C) after subtraction of background were identical, indicating that the affinities of the receptors are the same. The average dissociation constant determined from several experiments was 0.2 nM for both receptors. However, we repeatedly observed that the amount of M receptor protein was higher than that of the WT receptor.
|
To determine whether the mutation affected the transcriptional activity of PR, COS-1 cells were transfected with equal amounts of WT, M, or an equimolar mix of both plasmids and a GRE2-E1b-CAT reporter plasmid. As shown in Fig. 2A, the M PRB was more active than the WT. Interestingly, if the cells were transfected with equal amounts of WT and M PRB, the transcriptional activity was at least the same as that observed after transfection of cells with M PRB only. On the average, the activity of the M receptor is about 40% higher than the activity of the WT receptor. Although PRA is a much weaker transcriptional activator than PRB, the activity of M PRA was similarly, on the average, 30% higher (Fig. 2B). The same results were obtained with ovarian cancer-derived MDAH:2774 cells (Fig. 2C) and HeLa cells (data not shown) and regardless of whether pLEN or pcDNA3.1 expression vectors were used to express PR.
|
The increase in total transcriptional activity of the M receptor correlated with the higher amount of the receptor detected in the hormone binding assay (Figs. 2A
and 1B). While determining ligand binding affinity, we used saturating amounts of receptor DNA for transfection. Hence, to compare the levels of receptors per cell, we conducted a series of experiments measuring the amount of expressed PR at lower concentrations of [3H]R5020 and receptor plasmid in the same time frame as the CAT assay. We used equal amounts of WT and M human PR B DNAs to infect COS-1 cells. Whereas the WT receptor is expressed at a fairly constant level, with little increase over 16 h, the amount of M receptor increases in a hormone-dependent manner (Fig. 3A), pointing to an increased stability of the M receptor protein (see Fig. 4 and below). The results indicated that the M PR is present in the COS-1 cells at levels about 40% higher for the B isoform (Fig. 3A) and 25–30% for the A isoform (Fig. 3B) compared with levels of the WT. These findings are consistent with the increased transcriptional activities of the M receptor proteins. However, the activity per receptor molecule is similar for WT and M PR.
|
|
To confirm the difference in stability of the WT and M receptors we conducted pulse-chase experiments for both M and WT receptors (Fig. 4). PR was expressed in COS-1 cells in the absence of the ligand for 48 h, labeled with [35S]methionine, and chased with an excess of unlabeled methionine. Subsequently, the receptor was immunoprecipitated, and the amount of receptor protein was determined from band intensity after electrophoretic separation. The results indicated that the WT PRB degrades faster than the M PRB (Fig. 4A), and the calculated half-lives were 12.5 and 23.7 h, respectively. This result was confirmed by measuring degradation rates of M and WT PRB in the presence of cycloheximide (data not shown). Pulse-chase experiments with WT and M PRA also revealed an approximately 2 times increased half-life of the M receptor (21.2 vs. 38.9 h for WT PRA and M PRA, respectively).
Hormone dissociation rate is the same for WT and M receptors
Because there is a naturally occurring mutation in the androgen receptor that increases the rate of androgen dissociation and receptor degradation without altering ligand binding affinity (32), we investigated whether the difference in stability of the WT and M PRB was caused by changes in ligand dissociation kinetics. We expressed saturating amounts of the WT or M receptor in the COS-1 cells and treated them with the [3H]R5020 alone or with [3H]R5020 and the unlabeled hormone at the indicated time points. We found that the dissociation rates of ligand were indistinguishable (Fig. 5).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Almost 10 yr ago, a RFLP affecting intron G of the PR was described (14, 15, 16). Now we have extended these studies and identified two additional mutations (V660L and H770H) accompanying the Alu insertion in intron G. These three mutations always occur together and are in complete linkage disequilibrium (17).
We have shown that the frequency of this polymorphism is increased in women with ovarian cancer compared with healthy controls of the same ethnic origin (Tables 2 and 3). This finding suggests that the presence of the PROGINS allele might be an additional risk factor for this malignancy. Although data obtained from the Chinese population are consistent with this hypothesis, the number of samples studied was too low to obtain a statistically significant result. To reach this goal, i.e. to detect the difference between 0.4% and 1.8% at a significance level of P = 0.05 and a power of 0.8, a study of at least 1546 subjects would be required. However, populations with the highest incidence of ovarian cancer have the highest frequency of the PROGINS allele as well (Table 3). Taken together, our data suggest a link between the risk for ovarian cancer and the presence of PROGINS and encouraged us to proceed with the functional characterization of the M receptor variant. To date, no functional consequences of coding sequence mutations have been described, although several PR mutations have been reported (17).
The V600L substitution is located in the hinge region of the receptor, a link between the DNA binding domain and the ligand binding domain. The hinge region has been implicated in receptor dimerization, stability, and cofactor interaction (18, 19). We found no differences in ligand binding affinity or ligand dissociation rate between the WT and M receptors, which suggests that V600L does not affect hormone-receptor interactions. Although Scatchard plots revealed identical ligand binding affinities, the amount of protein per cell differed. Because mutation did not alter the interaction between receptor and ligand, we were able to use this most sensitive assay (hormone binding) to compare the amounts of WT and M receptors synthesized after transfection of cells with equal amounts of either plasmid. As shown in Fig. 3, the amounts of M PRB and PRA were higher than in cells expressing the corresponding WT receptor. Interestingly, DeVivo et al. (17, 34) described a mutation in the PR promoter that selectively increases expression and presumably levels of PRB. This mutation has been linked to an increased risk of endometrial and breast cancers (17, 34).
To determine whether elevated levels of M receptors lead to increased transcriptional activity, we carried out transient transactivation experiments with a consensus PRE reporter. Both M PRA and M PRB are more active than the corresponding WT isoforms of the receptor. Surprisingly, an equimolar mix of WT and M PR was at least as active as the M PR alone. This is consistent with the observation that the presence of PROGINS increased the risk for ovarian cancer virtually independent of the zygosity. To determine whether the mutation causes a change in the degradation rate, thereby resulting in increased accumulation of the receptor, we compared the degradation rates of WT and M receptors in a pulse-chase assay. The results demonstrate that the mutation stabilizes both A and B isoforms. The calculated half-life of the WT PR is very similar to that in a previous report (35). It is likely that the heterodimer also has increased stability, accounting for the elevated transcriptional activity in cells expressing both forms. As we were preparing this manuscript, De Vivo et al. (17) reported that the PROGINS haplotype frequently includes an S344T substitution located in a domain shared by both isoforms. However, a functional characterization of this mutation has not been reported (17). In unrelated studies, Takimoto et al. (36) found that substituting an alanine 344 for serine had no effect on transcriptional activity. Thus, the S344T mutation, a more conservative substitution, is also unlikely to affect the function of the receptor.
In conclusion, we have shown that the PROGINS allele occurs more frequently in ovarian cancer patients, indicating that PROGINS may be a risk modifier. The V660L mutation in the PR is associated with increased transcriptional activity due to accumulation of the receptor protein secondary to an increased half-life. Importantly, the increase in transcriptional activity appears to be independent of the homo- and heterozygous state. This might also explain why heterozygous carriers of the PROGINS allele are virtually at the same increased risk for ovarian cancer as homozygous carriers.
|
Footnotes |
|---|
Received January 22, 2004.
Accepted September 8, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and -ß, progesterone receptor, and androgen receptor mRNA in normal and malignant ovarian epithelial cells. Proc Natl Acad Sci USA 96:5722–5727This article has been cited by other articles:
 |
|
 |
|
  B. Diergaarde, J. D. Potter, E. R. Jupe, S. Manjeshwar, C. D. Shimasaki, T. W. Pugh, D. C. DeFreese, B. A. Gramling, I. Evans, and E. White Polymorphisms in Genes Involved in Sex Hormone Metabolism, Estrogen Plus Progestin Hormone Therapy Use, and Risk of Postmenopausal Breast Cancer Cancer Epidemiol. Biomarkers Prev., July 1, 2008; 17(7): 1751 - 1759. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Romano, B. Delvoux, D.-C. Fischer, and P. Groothuis The PROGINS polymorphism of the human progesterone receptor diminishes the response to progesterone J. Mol. Endocrinol., February 1, 2007; 38(2): 331 - 350. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.J.A.F. van Kaam, A. Romano, J.P. Schouten, G.A.J. Dunselman, and P.G. Groothuis Progesterone receptor polymorphism +331G/A is associated with a decreased risk of deep infiltrating endometriosis Hum. Reprod., January 1, 2007; 22(1): 129 - 135. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Palanker, A. S. Necakov, H. M. Sampson, R. Ni, C. Hu, C. S. Thummel, and H. M. Krause Dynamic regulation of Drosophila nuclear receptor activity in vivo Development, September 15, 2006; 133(18): 3549 - 3562. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. J.B. van Duijnhoven, P. H.M. Peeters, R. M.L. Warren, S. A. Bingham, A. G. Uitterlinden, P. A.H. van Noord, E. M. Monninkhof, D. E. Grobbee, and C. H. van Gils Influence of Estrogen Receptor {alpha} and Progesterone Receptor Polymorphisms on the Effects of Hormone Therapy on Mammographic Density. Cancer Epidemiol. Biomarkers Prev., March 1, 2006; 15(3): 462 - 467. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Vigano, E. Somigliana, I. Chiodo, A. Abbiati, and P. Vercellini Molecular mechanisms and biological plausibility underlying the malignant transformation of endometriosis: a critical analysis Hum. Reprod. Update, January 1, 2006; 12(1): 77 - 89. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S E Bojesen, S K Kjaer, E V S Hogdall, B L Thomsen, C K Hogdall, J Blaakaer, A Tybjaerg-Hansen, and B G Nordestgaard Increased risk of ovarian cancer in integrin {beta}3 Leu33Pro homozygotes Endocr. Relat. Cancer, December 1, 2005; 12(4): 945 - 952. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Wieser, J.-L. Vigne, I. Ryan, D. Hornung, S. Djalali, and R. N. Taylor Sulindac Suppresses Nuclear Factor-{kappa}B Activation and RANTES Gene and Protein Expression in Endometrial Stromal Cells from Women with Endometriosis J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6441 - 6447. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. F. Zheng, R.-C. Wu, C. L. Smith, and B. W. O'Malley Rapid Estrogen-Induced Phosphorylation of the SRC-3 Coactivator Occurs in an Extranuclear Complex Containing Estrogen Receptor Mol. Cell. Biol., September 15, 2005; 25(18): 8273 - 8284. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
), WT (
), or mixed receptor (
) PRB (A) or PRA (B) were used to transfect COS-1 cells. Cells were treated with 10 nM R5020 or were left untreated and harvested, and equal amounts of protein were assayed for CAT activity. Each data point was tested at least in duplicate with different preparations of both M and WT receptor DNA. The hormone-induced transcriptional activity of the M progesterone receptor DNA was about 40% higher than that of the WT receptor DNA. C, Combinations of DNA identical with those in A were transfected into the epithelial ovarian cancer cell line MDAH:2774. Cells were left untreated for 24 h or were treated with 10 nM R5020 for 24 h and harvested, and equal amounts of protein were assayed for CAT activity. Analysis by one-way ANOVA (SigmaStat) of the obtained data showed that the difference between normal and M receptor activity was statistically significant. The mixture of the receptors showed significantly higher transcriptional activation than WT receptor (P < 0.05), but the apparent additional increase compared with the activity of the M receptor was not statistically significant. *, Statistically significant difference compared with the WT (P < 0.05).
) degraded more slowly than the WT (