The Journal of Clinical Endocrinology & Metabolism Vol. 89, No. 12 6282-6285
Copyright © 2004 by The Endocrine Society
An Analysis of the Genetic Factors Involved in Testicular Descent in a Cohort of 14 Male Patients with Anorchia
Giovanna Vinci,
Marie-Nöelle Anjot,
Christine Trivin,
Henri Lottmann,
Raja Brauner and
Ken McElreavey
Reproduction, Fertility and Populations Unit (G.V., K.M.), Institut Pasteur, 75724 Paris, France; Pediatric Endocrinology Unit (M.-N.A., R.B.), Hôpital Bicêtre, Assistance Publique-Hôpitaux de Paris and Université René Descartes, 94275 Paris, France; Physiology Laboratory (C.T.), Hôpital Necker-Enfants Malades, Assistance Publique-Hôpitaux de Paris, 95743 Paris, France; and Anthony Private Clinic (H.L.), 92160 Anthony, France
Address all correspondence and requests for reprints to: Dr. Ken McElreavey, Reproduction, Fertility and Populations Unit, Institut Pasteur, Paris, France. E-mail: kenmce{at}pasteur.fr.
 |
Abstract
|
|---|
Anorchia, or the "vanishing testis syndrome," is characterized by the absence of testis in a 46,XY individual with a male phenotype. The etiology is unknown; however, the familial occurrence of the disease and the association of this phenotype with 46,XY gonadal dysgenesis has led to the suggestion that genetic factors, which play a role in testicular determination, may be involved. Alternatively, exploratory laparoscopy has suggested that anorchia may be caused by a prenatal testicular vascular accident associated with torsion during testicular descent. We screened a cohort of 14 boys with bilateral anorchia for mutations in the Y chromosome-linked testis-determining gene SRY (sex-determining region, Y chromosome); in the gene necessary for correct testicular descent, INSL3; and in the gene of its receptor (LGR8). Mutations in the INSL3 gene and the LGR8 T222P mutation are known to cause cryptorchidism. We confirmed previous reports that mutations in the SRY gene are not associated with anorchia. Although a common polymorphism was identified in the INSL3 gene, no mutations were observed. The recurrent T222P mutation in the LGR8 gene was not found in any of the patients. These data show for the first time a lack of association between genetic factors necessary for correct testicular descent and anorchia.
 |
Introduction
|
|---|
ANORCHIA, ALSO REFERRED to as embryonic testicular regression sequence ("vanishing testis syndrome"), is defined as the absence of testicular material in genetic and phenotypic males (1, 2, 3). Bilateral congenital anorchia affects one in 20,000 males, and unilateral congenital anorchia affects one in 5,000 males (4). The actual incidence may be higher than these figures suggest, because one fifth of cryptorchid patients at age 12 months or older are found to have a nonpalpable gonad (5). A substantial minority of the latter cases are thought to have anorchia (6, 7). Although some patients with anorchia present with ambiguous external genitalia or micropenis, the majority of cases have a normal male phenotype (3, 7, 8). Because male differentiation of the genital tract and development of the penis and scrotum is dependent on the production of anti-Müllerian hormone (AMH) and androgens, the testis may have disappeared after initial hormonal activity in cases of bilateral anorchia. If Wolffian duct structures are present, an ipsilateral testis must be present at least up to the 16th week of gestation. These observations suggest that anorchia may arise from the loss of testes at a critical period during development. The causes of congenital anorchia are unknown; however, among the patients with anorchia, familial recurrence and the association with other malformations suggests genetic or environmental origins (8, 9, 10, 11). In some of these familial cases, other individuals present with pure or partial 46,XY gonadal dysgenesis, and this has led to the suggestion that anorchia forms part of the clinical spectrum of 46,XY gonadal dysgenesis (12). Testes are determined by the presence of the SRY gene located on the Y chromosome, and mutations involving the SRY gene are associated with a failure of testis determination manifested by 46,XY gonadal dysgenesis. However, several studies have failed to identify mutations in this gene in patients presenting with anorchia. An alternative hypothesis postulates that anorchia may be due to a compromise of vascularization during the descent of the testes resulting from torsion, kinking of the vasculature, direct trauma, or spermatic vascular thrombosis (13). This hypothesis is supported by the consistent pathological finding of a characteristic vascularized fibrous nodule found at the terminus of the spermatic cord (6, 14).
Testicular descent is dependent on the interaction between anatomical and hormonal factors. In particular, insulin-like 3 (INSL3) and the leucine-rich repeat-containing G protein-coupled receptor 8 (LGR8; also known as GREAT) proteins act as ligand and receptor, respectively, and are involved in gubernaculum development during testicular descent (15, 16, 17, 18, 19). The INSL3 protein belongs to the insulin-like hormone superfamily, which comprises insulin, relaxin, and insulin-like growth factors I and II. The members of this family are characterized by a signal peptide, a B-chain, a connecting C-peptide, and an A-chain. INSL3 is expressed exclusively in prenatal and postnatal Leydig cells. LGR8 is the only receptor for INSL3 (19). Mutations have been described in both genes in a relatively small minority of cases of cryptorchidism (18, 20, 21, 22, 23). We hypothesized that anorchia may be due to mutations in either the INSL3 or LGR8 genes because cryptorchid testes are prone to torsion (24). Although several studies have found a relatively small number of mutations in the INSL3 gene in individuals presenting with cryptorchidism, a recurrent mutation (T222P) has been described in the ectodomain region of the LGR8 gene, which renders the receptor inactive (18). This mutation is present in 4.6% of men with cryptorchidism in an Italian population and has also been found in one French individual, suggesting that it may have arisen in a common ancestor (18, 23). Here, we describe the sequencing of the INSL3 gene in a cohort of boys presenting with anorchia and, in addition, we describe the results of a screen of these boys for the T222P recurrent mutation in the LGR8 gene.
 |
Subjects and Methods
|
|---|
Study subjects
Clinical data, hormonal levels, and DNA were analyzed in 14 boys seen for anorchia by one of us (R.B.) between 1981 and 2003 (Table 1
). Signed informed consent was obtained from the parents for the surgery and molecular biology analyses. None of these cases have been reported elsewhere. Each of the boys presented initially with suspected cryptorchidism. Anorchia was confirmed by the complete absence of testicular tissue at surgery or by the presence of a small nodule of residual fibrous tissue. In case 2, surgery has not yet been performed; however, on the basis of the hormonal and clinical data, we believe that the patient also has anorchia. None of the patients had sexual ambiguity, hypospadias, microphallus or body malformation, or antecedents of radiotherapy, chemotherapy, testes traumatism, inflammation, or infection. The familial antecedents of abnormalities of the genitalia and fertility and previous palpation of testes by another physician were recorded. The hypothalamo-hypophyso-testicular axis was evaluated in four patients by measuring basal and stimulated (using GnRH, 100 µg/m2) plasma FSH and LH concentrations. The normal basal concentrations were 15 IU/liter for LH and 29 IU/liter for FSH. Leydig cell function was evaluated by measuring the plasma testosterone concentration before and after stimulation with human chorionic gonadotropin (hCG) (six patients, three to seven injections of 1500 IU, given im every other day, with samples taken the day after the last injection). Plasma concentrations of AMH were measured in six patients whose samples were available and compared to reference values for age. Plasma hormone concentrations were measured by RIA.
Cytogenetic analysis was performed on peripheral blood leukocytes. The chromosome complement was determined by examining 40 to 50 metaphases in cases 2, 4, 6, 9, and 14.
DNA analysis
DNA was extracted from peripheral blood lymphocytes using standard techniques. The entire open reading frame of the sex-determining gene SRY (sex-determining region, Y chromosome) was amplified by PCR and directly sequenced as described elsewhere (25). The two exons of the INSL3 gene were also amplified by PCR and sequenced (26). The T222P mutation in the LGR8 gene was detected using the Primer-Introduced Restriction Site (PIRS) assay. In this technique, a nucleotide change is introduced in the PCR primer that immediately flanks the mutation, such that depending on which nucleotide (A or C) is present at position 664 (which generates the T222P mutation), the modified primer creates a new restriction site that is specific for the polymorphism.
The LGR8 PCR-PIRS reaction mixture contained 20 ng of genomic DNA, all four deoxynucleotide triphosphates (each at 200 µM), 1.5 mM MgCl2, 1 U of Taq polymerase (Eurobio), and each oligonucleotide at 0.25 µM. The 5' mismatched primer (GREATT222PF1: TTTGTCAGAATTCTAGATGACAATCCAGTA) used in combination with the reverse primer (GREATT222PR1: TACATCTTTGGTCAACCACTGCAAA) generates a 372-bp PCR product that creates a MaeIII restriction site derived from alleles containing the mutant sequence at position 664. After heating for 10 min at 95 C, the PCR was performed for 35 cycles at 95 C for 30 sec, 56 C for 30 sec, and 72 C for 30 sec. The PCR products were digested with MaeIII (New England BioLabs, Beverly, MA) and separated by electrophoresis on 4% agarose gel with 0.5 g/ml ethidium bromide. The digestion of the wild-type sequence results in two fragments of 122 and 250 bp, whereas the T222P mutated sequence generates three fragments of 250, 92, and 30 bp. A DNA sample with a known T222P mutation was used as a mutant positive control for PCR-PIRS.
 |
Results
|
|---|
Clinical evaluation
Weight and length at birth were normal in all cases. In two cases, anomalies were also detected in the father. The father of case 6 had increased basal FSH levels (FSH 12 IU/liter at 38 yr), and the father of case 9 had secondary sterility with oligoasthenospermia (Table 1
). In all cases, testes were not palpated at the initial evaluation. Unilateral testicular torsion occurred in case 12 at 2.7 yr and in case 13 immediately after birth. There was no change in the plasma testosterone concentration after hCG stimulation in the eight patients who were tested. All plasma AMH concentrations were undetectable when measured. Basal plasma concentrations of FSH were increased in all except in case 5, while those of LH were increased in only eight cases (Table 1
). The LH and FSH peaks after the GnRH test were increased in all patients for FSH and in three of four for LH. In all cases in which a karyotype was performed, the chromosome complement was 46,XY.
DNA analysis
Direct sequencing of PCR products revealed that all patients had an SRY open reading frame with a DNA sequence that was identical with that of a normal male. The sequence of both exons of the INSL3 gene did not reveal any mutations; however, a previously reported polymorphism, G to A (Ala-Thr) at nucleotide position 178 of the first exon, was observed in 10 patients. Eight of these patients were heterozygous for the polymorphism, and the two remaining patients were homozygous for the A allele (Thr). The PCR-PIRS assay for the LGR8 T222P mutation revealed that all cases carried the wild-type allele.
 |
Discussion
|
|---|
In boys with cryptorchidism and nonpalpable gonads, serum AMH levels correlate with the presence or absence of testicular tissue. A measurable value is predictive of undescended testes, whereas an undetectable value is highly suggestive of anorchia. All of the boys in this study evaluated for AMH had undetectable plasma AMH concentrations. Similar observations were made by Lee et al. (27) in 1997, and these data confirm the essential role of plasma AMH levels in aiding the diagnosis of anorchia. In the present study, all basal plasma concentrations of FSH were increased except in one patient age 5 yr. The concentrations of LH were more variable. In eight patients, the basal LH levels were increased, whereas in six patients, all 1.36 yr of age, the LH concentrations were within the normal range. These findings have been reported elsewhere. For example, Misra et al. (28) in 2002 studied five boys who presented with anorchia and who were all under 2 yr of age. The FSH levels were found to be elevated in all five boys, whereas the LH concentrations varied from 2.990 IU/liter. In the same study, a group of six patients with anorchia, all between 2 and 10 yr of age, the FSH values were observed to be between 0.1 and 84.9 IU/liter, and LH levels were between 0.2 and 2.4 IU/liter. The authors concluded that FSH values were elevated in only 50% of the prepubertal anorchic boys and LH values were on the whole not elevated. Jarow et al. (29) in 1986 also found increased FSH concentrations in six of seven prepubertal patients with anorchia. It should be noted that the GnRH and hCG tests are not necessary for the diagnosis of anorchia in cases with increased basal plasma concentrations of FSH and LH. The increased LH secretion has an effect similar to that of hCG administration on testosterone secretion. Thus, most of the time, the determination of basal plasma concentrations of AMH, FSH, LH, and testosterone will indicate whether there is an absence of functional testicular tissue.
Genetic factors have been suggested to play an important role in the etiology of anorchia. Bilateral congenital anorchia was reported in three siblings who were the products of nonconsanguineous marriage (30), and in a family with 46,XY gonadal dysgenesis, anorchia was reported in one brother with micropenis and absence of gonad, bilateral Fallopian tubes, and bilateral vas deferens (12). These observations suggest that anorchia is part of the clinical spectrum of 46,XY gonadal dysgenesis. Anorchia has also been associated with other anomalies including true agonadism (3), severe mental retardation (11), and other somatic anomalies such as craniofacial and limb anomalies (12, 31). Despite these associations of phenotypes, the molecular etiology of anorchia is unknown. In this study we confirmed previously reported findings that the testis-determining gene, SRY, is not mutated in anorchia patients (32, 33, 34). Assuming that anorchia forms part of the clinical spectrum of 46,XY gonadal dysgenesis, it may be of interest to study other sex-determining genes, which may act downstream to SRY, such as DMRT1. Although the relationship between true agonadism and anorchia has been noted elsewhere (34), we have previously investigated the possibility that mutations in the LIM homeobox domain gene LHX9, whose murine ortholog causes isolated gonadal agenesis when inactivated, might be responsible for gonadal dysgenesis, agenesis, and anorchia in humans (35). In that study we did not detect mutations in the open reading frame of LHX9 (35). Here, we also report for the first time the association between anorchia and abnormal tubular function in two fathers. One father had secondary infertility, and the second father had increased basal plasma FSH concentrations. This suggests that the underlying genetic cause may act in a dominant manner.
Testicular torsion leading to vascular compromise and anorchia is often considered as an alternative mechanism to a genetic etiology for the condition, i.e. a genetic mutation vs. a mechanical defect. However, we would argue that these hypotheses are not mutually exclusive. Indeed, Castilla et al. (36) in 1975 first suggested that there may be genetic factors leading to testicular torsion and anorchia. In this study we tested the hypothesis that anorchia may be due to a combination of testicular maldescent with torsion leading to a compromise of the vascular system and that the initial maldescent of the testis may be caused by a genetic mutation. In the human, two genes are known to be specifically involved in testicular descent, INSL3 and LGR8. Although a number of polymorphisms in the INSL3 gene have been described in the literature, causal mutations associated with the cryptorchid phenotype are rare (20, 21, 22, 23, 26). In this study we failed to identify mutations in the INSL3 gene; however, a previously reported polymorphism that results in an alanine-to-threonine change at codon position 60 was found in several cases (26). Although this change is unlikely to cause anorchia, it is formally possible that it may be a genetic risk factor for the congenital anomaly.
Mutations in the receptor for the INSL3 hormone, LGR8, are rare in cases of cryptorchidism, although a recurrent mutation T222P has been described in five apparently unrelated men of European descent (18, 23). Using the PCR-PIRS technique, we failed to detect the T222P mutation in the LGR8 gene in our series of patients with anorchia. Taken together, these results suggest that mutations in two genes known to be involved solely in testicular descent, the INSL3 open-reading frame and the T222P recurrent mutation in the LGR8 gene, are not associated with anorchia. These data do not exclude the possibility that other genetic factors, which are necessary for testicular descent, such as the HOXA10 gene may be involved (37, 38, 39).
 |
Acknowledgments
|
|---|
We thank the following surgeons: Dr. Jean-Françoise Colombani, Centre Hospitalier Universitaire de Fort de France, Martinique, France (case 4); Prof. Daniel Beurton, Hôpital Ambroise Paré, Boulogne Billancourt, France (case 9); Prof. Claire Nihoul-Fékété, Hôpital Necker Enfants Malades, Paris, France (case 8); Dr. Robert Politi, Hôpital privé d Anthony, Anthony, France (case 5); Dr. Gérard Weisgerber, Hôpital Louis Mourier, Colombes, France (case 11); Dr. Hervé Tricot, Clinque de Val Fourré, Mantes la Jolie, France (case 7); Dr. Christian Boyer, Hôpital Armand Trousseau, Paris, France (case 10); and Prof. Yann Revillon, Pediatric Surgery Department, Necker Hospital, Paris, France (cases 12 and 13).
 |
Footnotes
|
|---|
This work was partly supported by GIS-Institut des Maladies Rares.
Abbreviations: AMH, Anti-Müllerian hormone; hCG, human chorionic gonadotropin; PIRS, primer-introduced restriction site.
Received May 12, 2004.
Accepted September 15, 2004.
 |
References
|
|---|
- Abeyaratne WA, Aherne WA, Scott JES 1969 The vanishing testis. Lancet 2:822824[Medline]
- Sarto GE, Opitz JM 1973 The XY gonadal agenesis syndrome. Am J Med Genet 10:288293[CrossRef]
- Edman DC, Winter AJ, Porter JC 1977 Embryonic testicular regression: a clinical spectrum of XY agonadal individuals. Obstet Gynecol 49:208217[Medline]
- Borrow M, Gough M 1970 Bilateral absence of testes. Lancet 1:366
- Frey HL, Rajfer J 1982 Incidence of cryptorchidism. Urol Clin North Am 9:327329[Medline]
- Schned AR, Cendron M 1997 Pathological findings in the vanishing testes syndrome. J Urol Pathol 6:95107
- Kirsch AJ, Escala J, Duckett JW, Smith GH, Zderic SA, Canning DA, Snyder 3rd HM 1998 Surgical management of the nonpalpable testis: the Childrens Hospital of Philadelphia experience. J Urol 159:13401343[CrossRef][Medline]
- Josso N, Briard ML 1980 Embryonic testicular regression syndrome: variable phenotypic expression in siblings. J Pediatr 97:200204[CrossRef][Medline]
- Naffah J 1989 [Familial testicular regression syndrome]. Bull Acad Natl Med 173:709714 (French)[Medline]
- Hall JG, Morgan A, Blizzard RM 1975 Familial congenital anorchia. Birth Defects Orig Art Ser 11:115119
- de Grouchy J, Gompel A, Salomon-Bernard Y, Kuttenn F, Yaneva H, Paniel JB, Le Merrer M, Roubin M, Doussau de Bazignan M, Turleau C 1985 Embryonic testicular regression syndrome and severe mental retardation in sibs. Ann Genet 28:154160[Medline]
- Mantonarcio SM, Fechner PY, Migeon CJ, Perlman EJ, Berkovitz GD 1994 Embryonic testicular regression sequence: a part of the clinical spectrum of 46,XY gonadal dysgenesis. Am J Med Genet 49:15[CrossRef][Medline]
- Huff DS, Wu HY, Snyder 3rd HM, Hadziselimovic F, Blythe B, Duckett JW 1991 Evidence in favor of the mechanical (intrauterine torsion) theory over the endocrinopathy (cryptorchidism) theory in the pathogenesis of testicular agenesis. J Urol 146:630631[Medline]
- Smith NM, Byard RW, Bourne AJ 1991 Testicular regression syndromea pathological study of 77 cases. Histopathology 19:269272[Medline]
- Nef S, Parada LF 1999 Cryptorchidism in mice mutant for Insl3. Nat Genet 22:295299[CrossRef][Medline]
- Zimmermann S, Steding G, Emmen JM, Brinkmann AO, Nayernia K, Holstein AF, Engel W, Adham IM 1999 Targeted disruption of the Insl3 gene causes bilateral cryptorchidism. Mol Endocrinol 13:681691[Abstract/Free Full Text]
- Adham IM, Steding G, Thamm T, Bullesbach EE, Schwabe C, Paprotta I, Engel W 2002 The overexpression of the insl3 in female mice causes descent of the ovaries. Mol Endocrinol 16:244252[Abstract/Free Full Text]
- Gorlov IP, Kamat A, Bogatcheva NV, Jones E, Lamb DJ, Truong A, Bishop CE, McElreavey K, Agoulnik AI 2002 Mutations of the GREAT gene cause cryptorchidism. Hum Mol Genet 11:23092318[Abstract/Free Full Text]
- Bogatcheva NV, Truong A, Feng S, Engel W, Adham IM, Agoulnik AI 2003 GREAT/LGR8 is the only receptor for insulin-like 3 peptide. Mol Endocrinol 17:26392646[Abstract/Free Full Text]
- Canto P, Escudero I, Soderlund D, Nishimura E, Carranza-Lira S, Gutierrez J, Nava A, Mendez JP 2003 A novel mutation of the insulin-like 3 gene in patients with cryptorchidism. J Hum Genet 48:8690[CrossRef][Medline]
- Marin P, Ferlin A, Moro E, Rossi A, Bartoloni L, Rossato M, Foresta C 2001 Novel insulin-like 3 (INSL3) gene mutation associated with human cryptorchidism. Am J Med Genet 103:348349[CrossRef][Medline]
- Tomboc M, Lee PA, Mitwally MF, Schneck FX, Bellinger M, Witchel SF 2000 Insulin-like 3/relaxin-like factor gene mutations are associated with cryptorchidism. J Clin Endocrinol Metab 85:40134018[Abstract/Free Full Text]
- Ferlin A, Simonato M, Bartoloni L, Rizzo G, Bettella A, Dottorini T, Dallapiccola B, Foresta C 2003 The INSL3-LGR8/GREAT ligand-receptor pair in human cryptorchidism. J Clin Endocrinol Metab 88:42734279[Abstract/Free Full Text]
- Fonkalsrud EW 1987 Testicular undescent and torsion. Pediatr Clin North Am 34:13051317[Medline]
- Veitia R, Ion A, Barbaux S, Jobling MA, Souleyreau N, Ennis K, Ostrer H, Tosi M, Meo T, Chibani J, Fellous M, McElreavey K 1997 Mutations and sequence variants in the testis-determining region of the Y chromosome in individuals with a 46,XY female phenotype. Hum Genet 99:648652[CrossRef][Medline]
- Krausz C, Quintana-Murci L, Fellous M, Siffroi JP, McElreavey K 2000 Absence of mutations involving the INSL3 gene in human idiopathic cryptorchidism. Mol Hum Reprod 6:298302[Abstract/Free Full Text]
- Lee MM, Donahoe PK, Silverman BL, Hasegawa T, Hasegawa Y, Gustafson ML, Chang YC, MacLaughlin DT 1997 Measurements of serum Müllerian inhibiting substance in the evaluation of children with nonpalpable gonads. N Engl J Med 336:14801486[Abstract/Free Full Text]
- Misra M, MacLaughlin DT, Donahoe PK, Lee MM 2002 Measurement of Müllerian inhibiting substance facilitates management of boys with microphallus and cryptorchidism. J Clin Endocrinol Metab 87:35983602[Abstract/Free Full Text]
- Jarow JP, Berkovitz GD, Migeon CJ, Gearhart JP, Walsh PC 1986 Elevation of serum gonadotropins establishes the diagnosis of anorchism in prepubertal boys with bilateral cryptorchidism. J Urol 136:277279[Medline]
- Rai M, Agrawal JK, Sasikumar V, Singh SK 1994 Bilateral congenital anorchia in three siblings. Clin Pediatr 33:367369
- Kennerknecht I, Sorgo W, Oberhoffer R, Teller WM, Mattfeldt T, Negri G, Vogel W 1993 Familial occurrence of agonadism and multiple internal malformations in phenotypically normal girls with 46,XY and 46,XX karyotypes, respectively: a new autosomal recessive syndrome. Am J Med Genet 47:11661170[CrossRef][Medline]
- Lobaccaro JM, Medlej R, Berta P, Belon C, Galifer RB, Guthmann JP, Chevalier C, Czernichow P, Dumas R, Sultan C 1993 PCR analysis and sequencing of the SRY sex determining gene in four patients with bilateral congenital anorchia. Clin Endocrinol (Oxf) 38:197201[Medline]
- McElreavey K, Vilain E, Barbaux S, Fuqua JS, Fechner PY, Souleyreau N, Doco-Fenzy M, Gabriel R, Quereux C, Fellous M, Berkovitz GD 1996 Loss of sequences 3' to the testis-determining gene, SRY, including the Y pseudoautosomal boundary associated with partial testicular determination. Proc Natl Acad Sci USA 93:85908594[Abstract/Free Full Text]
- Zenteno JC, Jimenez AL, Canto P, Valdez H, Mendez JP, Kofman-Alfaro S 2001 Clinical expression and SRY gene analysis in XY subjects lacking gonadal tissue. Am J Med Genet 99:244247[CrossRef][Medline]
- Ottolenghi C, Moreira-Filho C, Mendonca BB, Barbieri M, Fellous M, Berkovitz GD, McElreavey K 2001 Absence of mutations involving the LIM homeobox domain gene LHX9 in 46,XY gonadal agenesis and dysgenesis. J Clin Endocrinol Metab 86:24652469[Abstract/Free Full Text]
- Castilla EE, Sod R, Anzorena O, Texido J 1975 Neonatal testicular torsion in two brothers. J Med Genet 12:112113[Abstract/Free Full Text]
- Satokata I, Benson G, Maas R 1995 Sexually dimorphic sterility phenotypes in Hoxa10-deficient mice. Nature 374:460463[CrossRef][Medline]
- Kolon TF, Wiener JS, Lewitton M, Roth DR, Gonzales Jr ET, Lamb DJ 1999 Analysis of homeobox gene HOXA10 mutations in cryptorchidism. J Urol 161:275280[CrossRef][Medline]
- Bertini V, Bertelloni S, Valetto A, Lala R, Foresta C, Simi P 2004 Homeobox HOXA10 gene analysis in cryptorchidism. J Pediatr Endocrinol Metab 17:4145[Medline]
- Rey RA, Belville C, Nihoul-Fekete C, Michel-Calemard L, Forest MG, Lahlou N, Jaubert F, Mowszowicz I, David M, Saka N, Bouvattier C, Bertrand AM, Lecointre C, Soskin S, Cabrol S, Crosnier H, Leger J, Lortat-Jacob S, Nicolino M, Rabl W, Toledo SP, Bas F, Gompel A, Czernichow P, Chatelain P, Rappaport R, Morel Y, Josso N 1999 Evaluation of gonadal function in 107 intersex patients by means of serum antimüllerian hormone measurement. J Clin Endocrinol Metab 84:627631[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
P. Philibert, D. Zenaty, L. Lin, S. Soskin, F. Audran, J. Leger, J. C. Achermann, and C. Sultan
Mutational analysis of steroidogenic factor 1 (NR5a1) in 24 boys with bilateral anorchia: a French collaborative study
Hum. Reprod.,
December 1, 2007;
22(12):
3255 - 3261.
[Abstract]
[Full Text]
[PDF]
|
 |
|