| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Obstetrics and Gynecology (V.V., C.G., B.N., G.E.), Division of Nephrology and Rheumatology (S.B.), Division of Gastroenterology and Endocrinology (H.S., D.R.), Department of Trauma Surgery, Plastic and Reconstructive Surgery (K.-H.F.), Georg-August-University of Goettingen, Goettingen, Germany D-37075; and Division of Gastroenterology and Endocrinology, Philipps-University of Marburg (L.C.H.), Marburg, Germany D-35033
Address all correspondence and requests for reprints to: Volker Viereck, M.D., Department of Obstetrics and Gynecology, University of Goettingen, Robert-Koch-Strasse 40, D-37075 Goettingen, Germany. E-mail: viereck{at}med.uni-goettingen.de.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B ligand is essential for osteoclasts and enhances bone resorption, whereas osteoprotegerin (OPG) neutralizes receptor activator of nuclear factor-B ligand. Here, we assessed the effects of raloxifene on OPG production in human osteoblasts (hOB). Raloxifene enhanced gene expression of ER-
and progesterone receptor. Moreover, raloxifene increased OPG mRNA levels and protein secretion by hOB in a dose- and time-dependent fashion by 2- to 4-fold with a maximum effect at 10-7 M and after 72 h (P < 0.001). Treatment with the ER antagonist ICI 182,780 abrogated the effects of raloxifene on OPG production. Moreover, raloxifene enhanced osteoblastic differentiation markers, type 1 collagen secretion, and alkaline phosphatase activity by 3- and 2-fold, respectively (P < 0.001). In addition, raloxifene inhibited expression of the bone-resorbing cytokine IL-6 by 25–45% (P < 0.001). In conclusion, our data suggest that raloxifene stimulates OPG production and inhibits IL-6 production by hOB. Because OPG production increases with osteoblastic maturation, enhancement of OPG production by raloxifene could be related to its stimulatory effects on osteoblastic differentiation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Estrogens reduce bone resorption directly by inhibiting osteoclasts and indirectly by suppressing osteoblastic production of various proresorptive paracrine factors such as IL-1ß, IL-6, and TNF- (5). More recently, receptor activator of nuclear factor-B (RANK) ligand (RANKL), a member of the TNF ligand family (6), its receptor (RANK) (7), and its receptor antagonist osteoprotegerin (OPG) (8) have been identified as essential regulators of osteoclast formation and activation. OPG acts as a decoy receptor for RANKL and prevents RANKL from binding to, and activating, RANK on the surface of osteoclastic lineage cells (6, 7, 8). The relative ratio of RANKL to OPG is considered the critical determinant and final step in the regulation of osteoclast biology and bone resorption, and this ratio is modulated by various osteotropic hormones, cytokines, and drugs (9, 10). Of note, 17ß-estradiol (11, 12, 13) and the phytoestrogen genistein (14) enhance osteoblastic production of OPG through activation of estrogen receptor (ER)-.
In this study, we show that raloxifene concurrently stimulates OPG mRNA levels and protein secretion and inhibits IL-6 production by human trabecular osteoblasts that predominantly express ER-.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell culture medium and supplements were purchased from Life Technologies, Inc.-BRL (Karlsruhe, Germany). Culture flasks and dishes were obtained from Nunc (Roskilde, Denmark). Unless otherwise stated, all other chemicals were purchased from Sigma (Munich, Germany). Raloxifene was kindly provided by Lilly Research Laboratories (Indianapolis, IN).
Cell culture
After written informed consent, bone specimens were obtained from the iliac crest of five patients (four women and one man; age, 36.4 ± 7.1 yr) undergoing corrective surgery after traumatic fractures. None of the patients had signs or symptoms of bone or autoimmune diseases. The study was approved by the Institutional Review Board of the University of Goettingen (Goettingen, Germany). The experiments were conducted using cells from individual patients, and the specimens were not pooled. First-passage human osteoblastic cells (hOB) from primary cultures of trabecular bone explants were used as previously described (14, 15). These hOB cells have been shown to further differentiate in culture and, according to the time course of osteoblastic differentiation, represent the phenotype within the matrix maturation phase or intermediate phenotype (15, 16). This phase during the differentiation sequence is characterized by high alkaline phosphatase (AP) expression and low osteocalcin and collagen type I expression (15). The cells (plating density, 4,000 cells/cm2) were grown at 37 C and maintained in phenol red-free MEM supplemented with 10% charcoal-stripped fetal calf serum (cs-FCS) from Allgaeu BioTech Service (Goerisried, Germany). Cells were cultured in serum-free MEM supplemented with 0.125% (wt/vol) BSA for 4 d before RNA isolation. Cultures were analyzed on d 16, after they had reached confluence by d 10.
Immunocytochemistry
For immunocytochemical analysis of ER-, ER-ß, and progesterone receptor (PR) protein expression, hOB cells were fixed at d 16 in acetone (-20 C, 20 min) on poly-L-lysine-coated slides as previously described (14). After washing in Tris-buffered saline (TBS), cells were incubated with normal goat serum (1:10 in TBS) for 1 h at room temperature. Primary antibodies included a monoclonal mouse antihuman ER- antibody (clone 6F11) and a monoclonal mouse antihuman PR antibody (clone 1A6) from Novocastra (Newcastle, UK). In addition, a polyclonal rabbit anti-ER-ß antibody was generated by immunization with a keyhole limpet hemocyanin-conjugate of the ER-ß-specific peptide CSPAEDSKSKEGSQNPQSQ as immunogen. After 8 wk, sera were drawn and purified by ammonium sulfate precipitation and immunoaffinity as previously described (17). The specificity of the ER-ß antibody reaction was ascertained by substituting the primary antibody with nonimmune serum at the same IgG concentration and omission of primary and secondary antibodies and by performing immunoblots with recombinant ER- protein from Affinity BioReagents (Golden, CO).
Primary antibodies were diluted 1:25 to 1:100 in TBS/0.1% BSA and incubated for 2 h at 37 C in a humidified chamber. Slides were washed three times in TBS/0.5% Tween 20, and specific antibody binding was subsequently assessed by application of a fluorescein isothiocyanate-conjugated secondary goat antimouse antibody or a goat antirabbit antibody, respectively (Jackson ImmunoResearch, West Grove, PA) for 30 min at room temperature. Negative controls included omission of the primary antibody and an isotype control of irrelevant specificity. Slides were mounted in fluorescent mounting medium (Dako, Hamburg, Germany) and subjected to fluorescence microscopy.
RT-PCR analysis
Total cellular RNA was isolated using the RNeasy total RNA extraction kit from Qiagen (Hilden, Germany). RT was performed with 1 µg of total RNA as previously described (14). Each cDNA sample was run in triplicate for each PCR. Competitive RT-PCR was performed with exogenous DNA competitors (mimics) as internal control that were synthesized with the PCR mimic construction kit from Clontech (Palo Alto, CA) (14). PCRs were performed in 15-µl reactions using primer sequences as previously described (14) and cycle numbers ensuring a linear amplification profile. The ribosomal housekeeping gene L7, PR, OPG, type 1 collagen, AP, and osteocalcin mRNA were analyzed as reported elsewhere (14, 18). IL-6 was analyzed using a protocol of 75 sec at 94 C, 30 cycles [of 45 sec at 94 C, 45 sec at 60 C, and 2 min at 72 C], and 10 min at 72 C with specific oligonucleotides (sense, 5'-ATGAACTCCTTCTCCACAAGCGC-3'; antisense, 5'-GAAGAGCCTCAGGCTGGACTG-3'). PCR products were analyzed by agarose gel electrophoresis and visualized by ethidium bromide staining under UV light. The expression of each gene was quantified as target to mimic ratio and normalized to L7. To ensure specificity of the PCR products, the amplification product was sequenced with the Abi Prism system from Perkin-Elmer (Weiterstadt, Germany).
To determine the relative contribution of ER- and ER-ß mRNA to total ER mRNA expression, real time PCR was performed using subtype specific primer sequences for ER, ERß, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as described elsewhere, with the exception that the antisense primer of ER- was GTTTTTATCAATGGTGCACTGGTT (18). For time course experiments, the ERsubtype expression was measured relative to the expression of the housekeeping gene GAPDH by the same method. ERsubtype/GAPDH ratios were calculated for each time point, divided by ERsubtype/GAPDH ratio of the respective control, and presented as percentage of control.
DNA assay
DNA was determined in the cell lysates by using the fluorescent Hoechst 33258 dye (19). Fluorescence was quantified with a Fluostar plate reader (SLT-Tecan, Crailsheim, Germany).
Analysis of total protein
For the determination of total protein and AP activity, the cells were lysed by repeated freeze-thawing cycles and subsequent sonification. The lysates were processed by centrifugation (10 min at 10,000 x g), and the soluble protein fraction was quantified using the Bio-Rad protein assay with an albumin standard (Bio-Rad, Munich, Germany).
OPG protein measurement
Conditioned medium was harvested from cultured cells and centrifuged to remove debris. Samples were stored at -80 C until used. OPG protein secretion was determined in triplicate measurements after 1:50 dilution with an immunoassay from Immunodiagnostik (Bensheim, Germany) (19). The OPG assay has a lower limit of detection of 0.5 pmol/liter. The intraassay (n = 16) coefficient of variation (CV) is between 8 and 10%, and the interassay (n = 7) CV is between 12 and 15%.
IL-6 protein measurement
Cell-free supernatants were collected from cultured cells, and IL-6 protein levels were determined by ELISA according to the manufacturer’s instructions (Pelikine-Compact, Amsterdam, The Netherlands). The IL-6 assay has a lower limit of detection of 0.2 pg/ml. Intraassay and interassay CV are less than 10%.
Analysis of AP activity and procollagen I secretion
AP activity was assayed in cell lysates by determining the release of p-nitrophenol as described previously (19). The secreted carboxy-terminal peptide of procollagen I (PICP) was measured in cell culture supernatants using an ELISA (Quidel, Heidelberg, Germany).
Statistical analysis
Each of the experiments was reproduced at least three times using three of the total five first-passage cells from primary osteoblastic cultures derived from individual donors. Values are expressed as the mean ± SEM of triplicate measurements of these individual hOB cultures, and data obtained from representative experiments are shown. For analysis of time courses and dose responses, multiple measurement ANOVA followed by Newman-Keuls posttest analysis was performed. A P value of less than 0.05 was considered statistically significant. Standard software from StatView 5.0 (SAS Institute, Cary, NC) was used for the statistical analyses.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ER-ß RNA, ER- mRNA was found to be more than 100 times more abundant than ER-ß mRNA on d 13 of hOB culture. Although ER- mRNA was consistently up-regulated by raloxifene exposure at a concentration of 10-7 M for 72 h by 7- to 11-fold (P < 0.0005 by ANOVA), ER-ß mRNA tended to be variably and nonsignificantly (P = 0.15) up-regulated by raloxifene by about 2-fold (Fig. 1
, A and B). Moreover, immunocytochemical analysis demonstrated ER- and ER-ß protein in hOB cells (Fig. 1, C and D). Next, to analyze the functional activity of ER, the ER target gene PR was assessed after treatment with raloxifene and 17ß-estradiol. Both agents increased PR gene expression in a dose- and time-dependent manner by almost 3-fold (P < 0.001) (Fig. 2, A and B). Immunocytochemical analysis demonstrated PR protein expression in hOB cells (Fig. 2C).
|
|
and 4). At the most effective dose of raloxifene (10-7 M for 72 h), the dose-dependent induction of OPG mRNA levels and protein concentrations was 2.2- to 2.9-fold. Of note, the increase of OPG gene expression and protein secretion by raloxifene was comparable to that induced by 17ß-estradiol (Fig. 3). Time kinetics studies indicated that the maximum stimulatory effect of raloxifene occurred after 48–72 h and was 5.2-fold (P < 0.001 for protein values). Again, the stimulatory effects of raloxifene were similar to those observed after 17ß-estradiol exposure (Fig. 4).
|
|
). The maximum inhibitory effect of raloxifene on IL-6 production on the protein level occurred at a concentration of 10-7 M. To further characterize the inhibitory effects of raloxifene on IL-6 gene expression and protein secretion, a time course experiment for 0–72 h was performed. Raloxifene inhibited IL-6 mRNA steady state levels and protein secretion in a time-dependent manner with a maximum effect after 24–48 h (P < 0.001 by ANOVA; Fig. 5).
|
). At the protein level, raloxifene time-dependently increased type 1 collagen (PICP) protein secretion by 2.6-fold (P < 0.0001 by ANOVA), with a maximum effect after 72 h (Fig. 6B). Treatment with raloxifene increased type 1 collagen mRNA steady state levels and protein secretion (P < 0.0001 by ANOVA for protein) in a dose-dependent manner (Fig. 6, C and D). Raloxifene also dose-dependently stimulated mRNA expression (data not shown) and enzyme activity of AP by 1.7- to 2.2-fold, respectively (P < 0.0001 by ANOVA; Table 1). Constitutive osteocalcin mRNA levels were low and nonsignificantly up-regulated by raloxifene (10-7 M for 72 h) by 1.5-fold (P = 0.13).
|
|
). As previously shown, treatment with ICI 182,780 alone inhibited OPG expression only weakly (14), indicating that the stimulatory effects of raloxifene were specifically mediated through the ER.
|
).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this study, we have demonstrated that raloxifene enhanced OPG production and concurrently suppressed IL-6 secretion in normal human osteoblastic cells, which predominantly express ER-. The hOB cells obtained from trabecular bone of healthy young donors, display an osteoblastic phenotype of the matrix maturation phase and express mainly the endogenous ER- and the ER target gene, PR (14, 15), indicating that this osteoblastic cell system is suitable to assess the effects of ER ligands on osteoblastic gene expression.
The stimulatory effects of raloxifene on OPG production of these estrogen-responsive hOB was time- and dose-dependent, occurred at the mRNA and protein level, was specifically abolished by the pure ER antagonist 182,780, and prevented dexamethasone-induced suppression of OPG production (20). Our study has several limitations. First, because our osteoblastic cell system does not form mineralized nodules under the employed culture conditions, we were unable to assess the effects of raloxifene on mineralization, which in light of the raloxifene paradox (fracture reduction without appropriate increase of bone mineral density) may have provided important mechanistic insights. Other investigators have observed mineralized nodule formation by hOB derived from an elderly woman (but not a 1-yr-old infant) at passage 7 when cultured on collagen and using potent differentiation medium (18). Second, we did not assess direct or indirect effects of raloxifene on osteoclast functions. Recent studies indicate that multiple pathways of osteoclastic modulation are used by raloxifene, including direct osteoclastic (22) and paracrine osteoblastic pathways mediated by TGF-ß and TNF- (22, 23).
The pattern of OPG and IL-6 regulation by raloxifene is qualitatively and quantitatively similar to that observed for 17ß-estradiol, which has been shown to enhance OPG production (11, 12, 13) and inhibit IL-6 secretion (24) through activation of the ER-, suggesting that raloxifene acts as an ER agonist on osteoblastic cells. By concurrently inducing osteoblastic production of the antiresorptive cytokine OPG and by suppressing osteoblastic production of the proresorptive cytokines IL-6 and IL-1ß (22), raloxifene favors an antiresorptive cytokine milieu, thus, inhibiting osteoclastic functions as previously reported (22). Moreover, raloxifene and 17ß-estradiol may also inhibit the signal pathway downstream of RANK in osteoclastic lineage cells by repressing c-Jun (25). However, the protective skeletal effects of raloxifene are not limited to its capacity to modulate the mediators of bone resorption, IL-1ß, IL-6, and OPG. Recent data have indicated that raloxifene may induce ER--dependent transcription of IGF-1 by hepatocytes (26), TGF-ß3 (27), and bone morphogenetic protein-4 by osteoblasts (28), all of which are important stimulators of bone formation. Clearly, our studies do not allow us to exclude an important role for ER-ß in regulating osteoblast-osteoclast interactions and modulating bone metabolism (5). Our data are consistent with the findings by Zhou et al. (29) that used mesenchymal stem cells from osteoporotic mice. In this study, ER- was the predominant ER form and was up-regulated by 17ß-estradiol, whereas ER-ß was down-regulated by 17ß-estradiol.
Because raloxifene promotes osteoblastic cell differentiation, as evident from its stimulatory effects on type 1 collagen secretion and AP activity, and because osteoblastic OPG production is positively correlated with the stage of their differentiation (30), the stimulatory effects of raloxifene on osteoblastic OPG production may be, at least in part, related to its capacity to enhance osteoblastic differentiation. A similar mechanism has also been described for the phytoestrogen genistein using a similar approach (14). In support of this, several studies have demonstrated that raloxifene promotes osteoblastic differentiation (31, 32), possibly through activation of the transcription factor cbfa-1 (31). Because the OPG gene contains binding sites for cbfa-1 (33) and TGF-ß (34), which is up-regulated by raloxifene (27), raloxifene may enhance OPG gene expression through a direct genomic mechanism. Of note, RANKL gene expression was very low and was not found to be modulated by raloxifene (data not shown), 17ß-estradiol (11, 12), or genistein (14), suggesting that ER ligands regulate the RANKL/OPG system mainly by altering the OPG component.
In summary, our data indicate that the SERM raloxifene increases the secretion of OPG, a potent inhibitor of bone resorption, and suppresses the production of the bone-resorbing cytokine, IL-6. Thus, regulation of these cytokines in the bone microenvironment may be an important paracrine mechanism whereby raloxifene reduces bone resorption.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: AP, Alkaline phosphatase; cs-FCS, charcoal-stripped fetal calf serum; CV, coefficient(s) of variation; ER, estrogen receptor(s); GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hOB, human osteoblasts; OPG, osteoprotegerin; PICP, carboxy-terminal peptide of procollagen I; PR, progesterone receptor; RANK, receptor activator of nuclear factor-B; RANKL, RANK ligand; SERM, selective estrogen receptor modulator; TBS, Tris-buffered saline.
Received November 27, 2002.
Accepted June 5, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. Endocrinology 142:2205–2212, but not estrogen receptor-ß, is involved in the regulation of the OPG/RANKL (osteoprotegerin/receptor activator of NF-B ligand) ratio and serum interleukin-6 in male mice. J Endocrinol 171:425–433[Abstract]
, but not ER-ß, mediates regulation of the insulin-like growth factor I gene by antiestrogens. J Biol Chem 276:35444–35449 and ß expression, osteogenic activity, and apoptosis in mesenchymal stem cells (MSCs) of osteoporotic mice. J Cell Biochem 81(S36):144–155
This article has been cited by other articles:
 |
|
 |
|
  C. Engdahl, C. Jochems, J.-A. Gustafsson, P. T van der Saag, H. Carlsten, and M. K Lagerquist In vivo activation of gene transcription via oestrogen response elements by a raloxifene analogue J. Endocrinol., December 1, 2009; 203(3): 349 - 356. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Kearns, S. Khosla, and P. J. Kostenuik Receptor Activator of Nuclear Factor {kappa}B Ligand and Osteoprotegerin Regulation of Bone Remodeling in Health and Disease Endocr. Rev., April 1, 2008; 29(2): 155 - 192. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Schumacher, R. Guennoun, A. Ghoumari, C. Massaad, F. Robert, M. El-Etr, Y. Akwa, K. Rajkowski, and E.-E. Baulieu Novel Perspectives for Progesterone in Hormone Replacement Therapy, with Special Reference to the Nervous System Endocr. Rev., June 1, 2007; 28(4): 387 - 439. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U.H. Lerner Bone Remodeling in Post-menopausal Osteoporosis Journal of Dental Research, July 1, 2006; 85(7): 584 - 595. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Esposito, A. Iacono, G. M. Raso, M. Pacilio, A. Coppola, R. Di Carlo, and R. Meli Raloxifene, a Selective Estrogen Receptor Modulator, Reduces Carrageenan-Induced Acute Inflammation in Normal and Ovariectomized Rats Endocrinology, August 1, 2005; 146(8): 3301 - 3308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Rzewuska-Lech, M. Jayachandran, L. A. Fitzpatrick, and V. M. Miller Differential effects of 17{beta}-estradiol and raloxifene on VSMC phenotype and expression of osteoblast-associated proteins Am J Physiol Endocrinol Metab, July 1, 2005; 289(1): E105 - E112. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. C. Hofbauer and M. Schoppet Clinical Implications of the Osteoprotegerin/RANKL/RANK System for Bone and Vascular Diseases JAMA, July 28, 2004; 292(4): 490 - 495. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-Y. Tsang, X. Yao, K. Essin, C.-M. Wong, F. L. Chan, M. Gollasch, and Y. Huang Raloxifene Relaxes Rat Cerebral Arteries In Vitro and Inhibits L-Type Voltage-Sensitive Ca2+ Channels Stroke, July 1, 2004; 35(7): 1709 - 1714. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
