help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Viereck, V.
Right arrow Articles by Hofbauer, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Viereck, V.
Right arrow Articles by Hofbauer, L. C.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*DEXAMETHASONE
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 9 4206-4213
Copyright © 2003 by The Endocrine Society

Raloxifene Concurrently Stimulates Osteoprotegerin and Inhibits Interleukin-6 Production by Human Trabecular Osteoblasts

Volker Viereck, Carsten Gründker, Sabine Blaschke, Britta Niederkleine, Heide Siggelkow, Karl-Heinz Frosch, Dirk Raddatz, Günter Emons and Lorenz C. Hofbauer

Department of Obstetrics and Gynecology (V.V., C.G., B.N., G.E.), Division of Nephrology and Rheumatology (S.B.), Division of Gastroenterology and Endocrinology (H.S., D.R.), Department of Trauma Surgery, Plastic and Reconstructive Surgery (K.-H.F.), Georg-August-University of Goettingen, Goettingen, Germany D-37075; and Division of Gastroenterology and Endocrinology, Philipps-University of Marburg (L.C.H.), Marburg, Germany D-35033

Address all correspondence and requests for reprints to: Volker Viereck, M.D., Department of Obstetrics and Gynecology, University of Goettingen, Robert-Koch-Strasse 40, D-37075 Goettingen, Germany. E-mail: viereck{at}med.uni-goettingen.de.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Raloxifene reduces bone loss and prevents vertebral fractures in postmenopausal women. Its skeletal effects are mediated by estrogen receptors (ER) and their modulation of paracrine osteoblastic factors. Receptor activator of nuclear factor-{kappa}B ligand is essential for osteoclasts and enhances bone resorption, whereas osteoprotegerin (OPG) neutralizes receptor activator of nuclear factor-{kappa}B ligand. Here, we assessed the effects of raloxifene on OPG production in human osteoblasts (hOB). Raloxifene enhanced gene expression of ER-{alpha} and progesterone receptor. Moreover, raloxifene increased OPG mRNA levels and protein secretion by hOB in a dose- and time-dependent fashion by 2- to 4-fold with a maximum effect at 10-7 M and after 72 h (P < 0.001). Treatment with the ER antagonist ICI 182,780 abrogated the effects of raloxifene on OPG production. Moreover, raloxifene enhanced osteoblastic differentiation markers, type 1 collagen secretion, and alkaline phosphatase activity by 3- and 2-fold, respectively (P < 0.001). In addition, raloxifene inhibited expression of the bone-resorbing cytokine IL-6 by 25–45% (P < 0.001). In conclusion, our data suggest that raloxifene stimulates OPG production and inhibits IL-6 production by hOB. Because OPG production increases with osteoblastic maturation, enhancement of OPG production by raloxifene could be related to its stimulatory effects on osteoblastic differentiation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ESTROGEN REPLACEMENT therapy has long been an important therapeutic modality for the prevention and treatment of postmenopausal osteoporosis (1). However, long-term compliance with estrogen therapy is limited, and there are increasing concerns regarding its safety (1, 2). Recently, raloxifene, a selective estrogen receptor modulator (SERM) has been used as an antiresorptive drug for the prevention and treatment of osteoporosis (3). In contrast to 17ß-estradiol, raloxifene lacks agonistic estrogenic effects on reproductive tissues and does not increase the risk of breast or endometrium cancer (1, 3). Although raloxifene acts as an estrogenic agonist on bone, the mechanisms underlying its actions on bone cells and the paradox of reducing vertebral fractures without appropriate increase in bone mineral density have not been well defined (4).

Estrogens reduce bone resorption directly by inhibiting osteoclasts and indirectly by suppressing osteoblastic production of various proresorptive paracrine factors such as IL-1ß, IL-6, and TNF-{alpha} (5). More recently, receptor activator of nuclear factor-{kappa}B (RANK) ligand (RANKL), a member of the TNF ligand family (6), its receptor (RANK) (7), and its receptor antagonist osteoprotegerin (OPG) (8) have been identified as essential regulators of osteoclast formation and activation. OPG acts as a decoy receptor for RANKL and prevents RANKL from binding to, and activating, RANK on the surface of osteoclastic lineage cells (6, 7, 8). The relative ratio of RANKL to OPG is considered the critical determinant and final step in the regulation of osteoclast biology and bone resorption, and this ratio is modulated by various osteotropic hormones, cytokines, and drugs (9, 10). Of note, 17ß-estradiol (11, 12, 13) and the phytoestrogen genistein (14) enhance osteoblastic production of OPG through activation of estrogen receptor (ER)-{alpha}.

In this study, we show that raloxifene concurrently stimulates OPG mRNA levels and protein secretion and inhibits IL-6 production by human trabecular osteoblasts that predominantly express ER-{alpha}.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

Cell culture medium and supplements were purchased from Life Technologies, Inc.-BRL (Karlsruhe, Germany). Culture flasks and dishes were obtained from Nunc (Roskilde, Denmark). Unless otherwise stated, all other chemicals were purchased from Sigma (Munich, Germany). Raloxifene was kindly provided by Lilly Research Laboratories (Indianapolis, IN).

Cell culture

After written informed consent, bone specimens were obtained from the iliac crest of five patients (four women and one man; age, 36.4 ± 7.1 yr) undergoing corrective surgery after traumatic fractures. None of the patients had signs or symptoms of bone or autoimmune diseases. The study was approved by the Institutional Review Board of the University of Goettingen (Goettingen, Germany). The experiments were conducted using cells from individual patients, and the specimens were not pooled. First-passage human osteoblastic cells (hOB) from primary cultures of trabecular bone explants were used as previously described (14, 15). These hOB cells have been shown to further differentiate in culture and, according to the time course of osteoblastic differentiation, represent the phenotype within the matrix maturation phase or intermediate phenotype (15, 16). This phase during the differentiation sequence is characterized by high alkaline phosphatase (AP) expression and low osteocalcin and collagen type I expression (15). The cells (plating density, 4,000 cells/cm2) were grown at 37 C and maintained in phenol red-free MEM supplemented with 10% charcoal-stripped fetal calf serum (cs-FCS) from Allgaeu BioTech Service (Goerisried, Germany). Cells were cultured in serum-free MEM supplemented with 0.125% (wt/vol) BSA for 4 d before RNA isolation. Cultures were analyzed on d 16, after they had reached confluence by d 10.

Immunocytochemistry

For immunocytochemical analysis of ER-{alpha}, ER-ß, and progesterone receptor (PR) protein expression, hOB cells were fixed at d 16 in acetone (-20 C, 20 min) on poly-L-lysine-coated slides as previously described (14). After washing in Tris-buffered saline (TBS), cells were incubated with normal goat serum (1:10 in TBS) for 1 h at room temperature. Primary antibodies included a monoclonal mouse antihuman ER-{alpha} antibody (clone 6F11) and a monoclonal mouse antihuman PR antibody (clone 1A6) from Novocastra (Newcastle, UK). In addition, a polyclonal rabbit anti-ER-ß antibody was generated by immunization with a keyhole limpet hemocyanin-conjugate of the ER-ß-specific peptide CSPAEDSKSKEGSQNPQSQ as immunogen. After 8 wk, sera were drawn and purified by ammonium sulfate precipitation and immunoaffinity as previously described (17). The specificity of the ER-ß antibody reaction was ascertained by substituting the primary antibody with nonimmune serum at the same IgG concentration and omission of primary and secondary antibodies and by performing immunoblots with recombinant ER-{alpha} protein from Affinity BioReagents (Golden, CO).

Primary antibodies were diluted 1:25 to 1:100 in TBS/0.1% BSA and incubated for 2 h at 37 C in a humidified chamber. Slides were washed three times in TBS/0.5% Tween 20, and specific antibody binding was subsequently assessed by application of a fluorescein isothiocyanate-conjugated secondary goat antimouse antibody or a goat antirabbit antibody, respectively (Jackson ImmunoResearch, West Grove, PA) for 30 min at room temperature. Negative controls included omission of the primary antibody and an isotype control of irrelevant specificity. Slides were mounted in fluorescent mounting medium (Dako, Hamburg, Germany) and subjected to fluorescence microscopy.

RT-PCR analysis

Total cellular RNA was isolated using the RNeasy total RNA extraction kit from Qiagen (Hilden, Germany). RT was performed with 1 µg of total RNA as previously described (14). Each cDNA sample was run in triplicate for each PCR. Competitive RT-PCR was performed with exogenous DNA competitors (mimics) as internal control that were synthesized with the PCR mimic construction kit from Clontech (Palo Alto, CA) (14). PCRs were performed in 15-µl reactions using primer sequences as previously described (14) and cycle numbers ensuring a linear amplification profile. The ribosomal housekeeping gene L7, PR, OPG, type 1 collagen, AP, and osteocalcin mRNA were analyzed as reported elsewhere (14, 18). IL-6 was analyzed using a protocol of 75 sec at 94 C, 30 cycles [of 45 sec at 94 C, 45 sec at 60 C, and 2 min at 72 C], and 10 min at 72 C with specific oligonucleotides (sense, 5'-ATGAACTCCTTCTCCACAAGCGC-3'; antisense, 5'-GAAGAGCCTCAGGCTGGACTG-3'). PCR products were analyzed by agarose gel electrophoresis and visualized by ethidium bromide staining under UV light. The expression of each gene was quantified as target to mimic ratio and normalized to L7. To ensure specificity of the PCR products, the amplification product was sequenced with the Abi Prism system from Perkin-Elmer (Weiterstadt, Germany).

To determine the relative contribution of ER-{alpha} and ER-ß mRNA to total ER mRNA expression, real time PCR was performed using subtype specific primer sequences for ER{alpha}, ERß, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as described elsewhere, with the exception that the antisense primer of ER-{alpha} was GTTTTTATCAATGGTGCACTGGTT (18). For time course experiments, the ERsubtype expression was measured relative to the expression of the housekeeping gene GAPDH by the same method. ERsubtype/GAPDH ratios were calculated for each time point, divided by ERsubtype/GAPDH ratio of the respective control, and presented as percentage of control.

DNA assay

DNA was determined in the cell lysates by using the fluorescent Hoechst 33258 dye (19). Fluorescence was quantified with a Fluostar plate reader (SLT-Tecan, Crailsheim, Germany).

Analysis of total protein

For the determination of total protein and AP activity, the cells were lysed by repeated freeze-thawing cycles and subsequent sonification. The lysates were processed by centrifugation (10 min at 10,000 x g), and the soluble protein fraction was quantified using the Bio-Rad protein assay with an albumin standard (Bio-Rad, Munich, Germany).

OPG protein measurement

Conditioned medium was harvested from cultured cells and centrifuged to remove debris. Samples were stored at -80 C until used. OPG protein secretion was determined in triplicate measurements after 1:50 dilution with an immunoassay from Immunodiagnostik (Bensheim, Germany) (19). The OPG assay has a lower limit of detection of 0.5 pmol/liter. The intraassay (n = 16) coefficient of variation (CV) is between 8 and 10%, and the interassay (n = 7) CV is between 12 and 15%.

IL-6 protein measurement

Cell-free supernatants were collected from cultured cells, and IL-6 protein levels were determined by ELISA according to the manufacturer’s instructions (Pelikine-Compact, Amsterdam, The Netherlands). The IL-6 assay has a lower limit of detection of 0.2 pg/ml. Intraassay and interassay CV are less than 10%.

Analysis of AP activity and procollagen I secretion

AP activity was assayed in cell lysates by determining the release of p-nitrophenol as described previously (19). The secreted carboxy-terminal peptide of procollagen I (PICP) was measured in cell culture supernatants using an ELISA (Quidel, Heidelberg, Germany).

Statistical analysis

Each of the experiments was reproduced at least three times using three of the total five first-passage cells from primary osteoblastic cultures derived from individual donors. Values are expressed as the mean ± SEM of triplicate measurements of these individual hOB cultures, and data obtained from representative experiments are shown. For analysis of time courses and dose responses, multiple measurement ANOVA followed by Newman-Keuls posttest analysis was performed. A P value of less than 0.05 was considered statistically significant. Standard software from StatView 5.0 (SAS Institute, Cary, NC) was used for the statistical analyses.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
As determined by a quantitative PCR approach with identical conditions for the detection of ER-{alpha} and ER-ß RNA, ER-{alpha} mRNA was found to be more than 100 times more abundant than ER-ß mRNA on d 13 of hOB culture. Although ER-{alpha} mRNA was consistently up-regulated by raloxifene exposure at a concentration of 10-7 M for 72 h by 7- to 11-fold (P < 0.0005 by ANOVA), ER-ß mRNA tended to be variably and nonsignificantly (P = 0.15) up-regulated by raloxifene by about 2-fold (Fig. 1Go, A and B). Moreover, immunocytochemical analysis demonstrated ER-{alpha} and ER-ß protein in hOB cells (Fig. 1Go, C and D). Next, to analyze the functional activity of ER, the ER target gene PR was assessed after treatment with raloxifene and 17ß-estradiol. Both agents increased PR gene expression in a dose- and time-dependent manner by almost 3-fold (P < 0.001) (Fig. 2Go, A and B). Immunocytochemical analysis demonstrated PR protein expression in hOB cells (Fig. 2CGo).



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 1. Raloxifene up-regulates ER-{alpha} and ER-ß gene expression. A and B, The hOB cells were treated with raloxifene (RAL) at 10-7 M for various time points (in hours). RT-PCR data in A and B represent the mean ± SEM of triplicate measurement of ER-{alpha} or ER-ß receptor/GAPDH ratios as a percentage of control with the vehicle control at 48 h normalized to 1.0. P < 0.0005 for ER-{alpha} < ß P = 0.15 for ER-ß by ANOVA. **, P < 0.01, posttest Newman-Keuls analysis, for individual values compared with the respective control for ER-{alpha}. C and D, immunocytochemical detection of ER-{alpha} (C) and ER-ß protein (D) after 16 d of culture demonstrating ER-{alpha} and ER-ß protein in hOB cells. An isotype control of primary antibody was used as negative control (insets).

 


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2. Raloxifene and 17ß-estradiol up-regulate PR gene expression. A, Dose response. The hOB cells were treated with various concentrations of raloxifene (RAL) and 17ß-estradiol (E) (numbers indicate the dose in -log M) for 72 h. B, Time course. The hOB cells were treated with RAL at 10-7 M or E at 10-8 M for various time points (in hours). C, Immunocytochemical detection of PR protein after 16 d of culture. An isotype control of primary antibody was used as negative control (inset). Semiquantitative RT-PCR was performed, and the data represent the mean ± SEM of triplicates of the PR/L7 ratios normalized to the vehicle control (V, ethanol) (A) or the control at 0 h (B), P < 0.0001 by ANOVA. Posttest Newman-Keuls analysis: *, P < 0.05; **, P < 0.01; and ***, P < 0.001 for individual values compared with the respective control.

 
To assess estrogenic effects of raloxifene on OPG mRNA expression, time course and dose-response experiments were performed in first-passage hOB cells along with negative (ethanol vehicle) and positive controls (17ß-estradiol). Raloxifene increased OPG mRNA levels and protein secretion by hOB cells in a dose- and time-dependent manner (P < 0.001; Figs. 3Go and 4Go). At the most effective dose of raloxifene (10-7 M for 72 h), the dose-dependent induction of OPG mRNA levels and protein concentrations was 2.2- to 2.9-fold. Of note, the increase of OPG gene expression and protein secretion by raloxifene was comparable to that induced by 17ß-estradiol (Fig. 3Go). Time kinetics studies indicated that the maximum stimulatory effect of raloxifene occurred after 48–72 h and was 5.2-fold (P < 0.001 for protein values). Again, the stimulatory effects of raloxifene were similar to those observed after 17ß-estradiol exposure (Fig. 4Go).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3. Raloxifene stimulates OPG mRNA levels and protein secretion by hOB in a dose-dependent manner. A, RT-PCR analysis of OPG mRNA levels isolated from hOB that were cultured for 72 h in the presence of various concentrations of raloxifene (RAL) and 17ß-estradiol (E) (numbers indicate the dose in -log M). The values indicate the mean ± SEM of OPG/L7 ratios normalized to the vehicle control (V, ethanol). B, OPG protein secretion was measured by ELISA from conditioned medium harvested from the hOB treated as described in A. Data represent the mean ± SEM of triplicates (percentage of control). P < 0.0001 by ANOVA; posttest Newman-Keuls analysis: *, P < 0.05; **, P < 0.01; and ***, P < 0.001 for individual values compared with the respective control.

 


View larger version (11K):
[in this window]
[in a new window]
 
FIG. 4. Raloxifene stimulates OPG mRNA levels and protein secretion in a time-dependent manner. A, RT-PCR analysis of OPG mRNA levels from hOB that were cultured for the time indicated (in hours) in the presence of raloxifene (RAL, 10-7 M) and 17ß-estradiol (E, 10-8 M). B, OPG protein secretion was measured by ELISA from conditioned medium harvested from the hOB treated as described in A. Data represent the mean ± SEM of triplicates of OPG/L7 ratios (A) or OPG protein concentrations (B). P < 0.0001 by ANOVA. Posttest Newman-Keuls analysis: *, P < 0.01; and **, P < 0.001 for individual values compared with the respective control at 0 h.

 
In addition, raloxifene inhibited gene expression and protein synthesis of the bone resorbing cytokine IL-6 by 25–45%, respectively (P < 0.001; Fig. 5Go). The maximum inhibitory effect of raloxifene on IL-6 production on the protein level occurred at a concentration of 10-7 M. To further characterize the inhibitory effects of raloxifene on IL-6 gene expression and protein secretion, a time course experiment for 0–72 h was performed. Raloxifene inhibited IL-6 mRNA steady state levels and protein secretion in a time-dependent manner with a maximum effect after 24–48 h (P < 0.001 by ANOVA; Fig. 5Go).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 5. Raloxifene inhibits IL-6 mRNA levels and protein synthesis by hOB in a dose- and time-dependent manner. A, RT-PCR analysis of IL-6 mRNA levels isolated from hOB that were cultured for 72 h in the presence of various concentrations of raloxifene (RAL) (numbers indicate the dose in -log M). B, IL-6 protein synthesis was measured by ELISA from conditioned medium harvested from the hOB treated as described in A. C, RT-PCR analysis of IL-6 mRNA levels isolated from hOB that were cultured for the time indicated (in hours) in the presence of RAL (10-7 M). D, IL-6 protein synthesis was measured by ELISA from conditioned medium harvested from the hOB treated as described in C. Data represent the mean ± SEM of triplicates of IL-6/L7 ratios (A and C) or IL-6 protein concentrations (B and D). P < 0.001 by ANOVA for RAL. Posttest Newman-Keuls analysis: *, P < 0.05; **, P < 0.01; and ***, P < 0.001 for individual values compared with the respective control (A) or 0 h (B).

 
As shown previously, the hOB cells displayed a characteristic pattern of gene expression and protein synthesis of various osteoblastic phenotypic markers (type 1 collagen, AP, and osteocalcin) that were developmentally regulated by differentiating agents such as dexamethasone and vitamin D (15). Analysis of cellular markers of osteoblastic differentiation revealed that raloxifene enhanced type 1 collagen secretion and AP activity. Specifically, raloxifene (10-7 M) led to an increase of type 1 collagen mRNA by 2.6-fold (compared with the 72-h control) (P < 0.0001 by ANOVA; Fig. 6AGo). At the protein level, raloxifene time-dependently increased type 1 collagen (PICP) protein secretion by 2.6-fold (P < 0.0001 by ANOVA), with a maximum effect after 72 h (Fig. 6BGo). Treatment with raloxifene increased type 1 collagen mRNA steady state levels and protein secretion (P < 0.0001 by ANOVA for protein) in a dose-dependent manner (Fig. 6Go, C and D). Raloxifene also dose-dependently stimulated mRNA expression (data not shown) and enzyme activity of AP by 1.7- to 2.2-fold, respectively (P < 0.0001 by ANOVA; Table 1Go). Constitutive osteocalcin mRNA levels were low and nonsignificantly up-regulated by raloxifene (10-7 M for 72 h) by 1.5-fold (P = 0.13).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 6. Raloxifene stimulates type 1 collagen production OPG mRNA levels and protein secretion by hOB in a time- and dose-dependent manner. A, RT-PCR analysis of type 1 collagen mRNA levels isolated from hOB that were cultured for the time indicated (in hours) in the presence of raloxifene (RAL, 10-7 M). B, Type 1 collagen (PICP) protein secretion was measured by ELISA from conditioned medium harvested from the hOB treated as described in A. C, RT-PCR analysis of type 1 collagen mRNA levels isolated from hOB that were cultured for 72 h in the presence of various concentrations of RAL (numbers indicate the dose in -log M). D, Type 1 collagen protein secretion was measured by ELISA from conditioned medium harvested from the hOB treated as described in C. Data represent the mean ± SEM of triplicates of COL-1/L7 ratios (A and C) or PICP protein concentrations (B and D). P < 0.0001 by ANOVA for RAL. Posttest Newman-Keuls analysis: *, P < 0.01; and **, P < 0.001 for individual values compared with the respective control (A) or 0 h (B).

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Raloxifene stimulates enzyme activity of AP by hOB in a dose-dependent manner

 
To determine whether the stimulatory effects of raloxifene on OPG production are directly and specifically mediated by ER, we used combinations of raloxifene (10-7 M for 72 h) and the pure ER antagonist ICI 182,780. The raloxifene-induced increase of OPG mRNA and protein synthesis was dose-dependently abrogated by ICI 182,780 (by 49% for OPG protein at an ICI concentration of 10-6 M for 48 h; P < 0.01) (Table 2Go). As previously shown, treatment with ICI 182,780 alone inhibited OPG expression only weakly (14), indicating that the stimulatory effects of raloxifene were specifically mediated through the ER.


View this table:
[in this window]
[in a new window]
 
TABLE 2. The ER antagonist ICI 182,780 blocks raloxifene-induced OPG protein secretion

 
We also evaluated whether raloxifene may counteract the inhibitory effects of glucocorticoids, which is one of the strongest inhibitors of OPG production in vitro (20). To test this, hOB cells were treated with either vehicle, raloxifene (at various concentrations for 72 h) and dexamethasone (10-8 M for the last 24 h before RNA isolation). Raloxifene completely and dose-dependently prevented the inhibitory effects of dexamethasone on OPG mRNA (data not shown) and protein production (P < 0.0001 by ANOVA; Table 3Go).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Raloxifene prevents dexamethasone-induced inhibition of osteoblastic OPG protein production

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Administration of the SERM raloxifene reduced the risk of both osteoporotic vertebral fractures (3) and invasive breast cancer (21) in postmenopausal women. In light of the recent findings of the Women’s Health Initiative, which demonstrated reduction of osteoporotic fractures at the cost of increased risks of breast cancer (and cardiovascular events) after prolonged combined exposure of conjugated equine estrogens and medroxyprogesterone acetate (2), SERMs, including raloxifene, are becoming an important novel class of drugs for the reduction of vertebral fractures in postmenopausal women. However, despite their increasing use, the cellular and molecular basis of their skeletal action(s) are still poorly defined.

In this study, we have demonstrated that raloxifene enhanced OPG production and concurrently suppressed IL-6 secretion in normal human osteoblastic cells, which predominantly express ER-{alpha}. The hOB cells obtained from trabecular bone of healthy young donors, display an osteoblastic phenotype of the matrix maturation phase and express mainly the endogenous ER-{alpha} and the ER target gene, PR (14, 15), indicating that this osteoblastic cell system is suitable to assess the effects of ER ligands on osteoblastic gene expression.

The stimulatory effects of raloxifene on OPG production of these estrogen-responsive hOB was time- and dose-dependent, occurred at the mRNA and protein level, was specifically abolished by the pure ER antagonist 182,780, and prevented dexamethasone-induced suppression of OPG production (20). Our study has several limitations. First, because our osteoblastic cell system does not form mineralized nodules under the employed culture conditions, we were unable to assess the effects of raloxifene on mineralization, which in light of the raloxifene paradox (fracture reduction without appropriate increase of bone mineral density) may have provided important mechanistic insights. Other investigators have observed mineralized nodule formation by hOB derived from an elderly woman (but not a 1-yr-old infant) at passage 7 when cultured on collagen and using potent differentiation medium (18). Second, we did not assess direct or indirect effects of raloxifene on osteoclast functions. Recent studies indicate that multiple pathways of osteoclastic modulation are used by raloxifene, including direct osteoclastic (22) and paracrine osteoblastic pathways mediated by TGF-ß and TNF-{alpha} (22, 23).

The pattern of OPG and IL-6 regulation by raloxifene is qualitatively and quantitatively similar to that observed for 17ß-estradiol, which has been shown to enhance OPG production (11, 12, 13) and inhibit IL-6 secretion (24) through activation of the ER-{alpha}, suggesting that raloxifene acts as an ER agonist on osteoblastic cells. By concurrently inducing osteoblastic production of the antiresorptive cytokine OPG and by suppressing osteoblastic production of the proresorptive cytokines IL-6 and IL-1ß (22), raloxifene favors an antiresorptive cytokine milieu, thus, inhibiting osteoclastic functions as previously reported (22). Moreover, raloxifene and 17ß-estradiol may also inhibit the signal pathway downstream of RANK in osteoclastic lineage cells by repressing c-Jun (25). However, the protective skeletal effects of raloxifene are not limited to its capacity to modulate the mediators of bone resorption, IL-1ß, IL-6, and OPG. Recent data have indicated that raloxifene may induce ER-{alpha}-dependent transcription of IGF-1 by hepatocytes (26), TGF-ß3 (27), and bone morphogenetic protein-4 by osteoblasts (28), all of which are important stimulators of bone formation. Clearly, our studies do not allow us to exclude an important role for ER-ß in regulating osteoblast-osteoclast interactions and modulating bone metabolism (5). Our data are consistent with the findings by Zhou et al. (29) that used mesenchymal stem cells from osteoporotic mice. In this study, ER-{alpha} was the predominant ER form and was up-regulated by 17ß-estradiol, whereas ER-ß was down-regulated by 17ß-estradiol.

Because raloxifene promotes osteoblastic cell differentiation, as evident from its stimulatory effects on type 1 collagen secretion and AP activity, and because osteoblastic OPG production is positively correlated with the stage of their differentiation (30), the stimulatory effects of raloxifene on osteoblastic OPG production may be, at least in part, related to its capacity to enhance osteoblastic differentiation. A similar mechanism has also been described for the phytoestrogen genistein using a similar approach (14). In support of this, several studies have demonstrated that raloxifene promotes osteoblastic differentiation (31, 32), possibly through activation of the transcription factor cbfa-1 (31). Because the OPG gene contains binding sites for cbfa-1 (33) and TGF-ß (34), which is up-regulated by raloxifene (27), raloxifene may enhance OPG gene expression through a direct genomic mechanism. Of note, RANKL gene expression was very low and was not found to be modulated by raloxifene (data not shown), 17ß-estradiol (11, 12), or genistein (14), suggesting that ER ligands regulate the RANKL/OPG system mainly by altering the OPG component.

In summary, our data indicate that the SERM raloxifene increases the secretion of OPG, a potent inhibitor of bone resorption, and suppresses the production of the bone-resorbing cytokine, IL-6. Thus, regulation of these cytokines in the bone microenvironment may be an important paracrine mechanism whereby raloxifene reduces bone resorption.


    Acknowledgments
 
We acknowledge the excellent technical assistance of Ms. H. Schulz, Ms. S. Fischer, and Ms. U. Freund.


    Footnotes
 
This work was supported by grants from Eli Lilly International Foundation and Forschungsfoerderungsprogramm 2000 of the University of Goettingen (to V.V.) and from the Deutsche Forschungsgemeinschaft (Ho 1875/2-1) and the Deutsche Krebshilfe (10-1697-Ho 1, to L.C.H.). Raloxifene was kindly provided by Lilly Research Laboratories, Indianapolis, Indiana.

Abbreviations: AP, Alkaline phosphatase; cs-FCS, charcoal-stripped fetal calf serum; CV, coefficient(s) of variation; ER, estrogen receptor(s); GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hOB, human osteoblasts; OPG, osteoprotegerin; PICP, carboxy-terminal peptide of procollagen I; PR, progesterone receptor; RANK, receptor activator of nuclear factor-{kappa}B; RANKL, RANK ligand; SERM, selective estrogen receptor modulator; TBS, Tris-buffered saline.

Received November 27, 2002.

Accepted June 5, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Eastell R 1998 Treatment of postmenopausal osteoporosis. N Engl J Med 338:736–746[Free Full Text]
  2. Writing Group for the Women’s Health Initiative Investigators 2002 Risks and benefits of estrogen plus progestin in healthy postmenopausal women. Principal results from the Women’s Health Initiative randomized controlled trial. JAMA 288:321–333[Abstract/Free Full Text]
  3. Ettinger B, Black DM, Mitlak BH, Knickerbocker RK, Nickelsen T, Genant HK, Christiansen C, Delmas PD, Zanchetta JR, Stakkestad J, Gluer CC, Krueger K, Cohen FJ, Eckert S, Ensrud KE, Avioli LV, Lips P, Cummings SR 1999 Reduction of vertebral fracture risk in postmenopausal women with osteoporosis treated with raloxifene: results from a 3-year randomized clinical trial. Multiple Outcomes of Raloxifene Evaluation (MORE) Investigators. JAMA 282:637–645[Abstract/Free Full Text]
  4. Riggs BL, Melton LJ 2002 Bone turnover matters: the raloxifene treatment paradox of dramatic decreases in vertebral fractures without commensurate increases in bone density. J Bone Miner Res 171:11–14
  5. Compston JE 2001 Sex steroids and bone. Physiol Rev 81:419–447[Abstract/Free Full Text]
  6. Lacey DL, Timms E, Tan H-L, Kelley MJ, Dunstan CR, Burgess T, Elliott R, Colombero A, Elliott G, Scully S, Hsu H, Sullivan J, Hawkins N, Davy E, Capparelli C, Eli A, Qian Y-X, Kaufman S, Sarosi I, Shalhoub V, Senaldi G, Guo J, Delaney J, Boyle WJ 1998 Osteoprotegerin (OPG) ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 93:165–176[CrossRef][Medline]
  7. Li J, Sarosi I, Yan XQ, Morony S, Capparelli C, Tan HL, McCabe S, Elliott R, Scully S, Van G, Kaufman S, Juan SC, Sun Y, Tarpley J, Martin L, Christensen K, McCabe J, Kostenuik P, Hsu H, Fletcher F, Dunstan CR, Lacey DL, Boyle WJ 2000 RANK is the intrinsic hematopoietic cell surface receptor that controls osteoclastogenesis and regulation of bone mass and calcium metabolism. Proc Natl Acad Sci USA 97:1566–1571[Abstract/Free Full Text]
  8. Simonet WS, Lacey DL, Dunstan CR, Kelley M, Chang M-S, Lüthy R, Nguyen HQ, Wooden S, Bennett L, Boone T, Shimamoto G, DeRose M, Eliott R, Colombero A, Tan H-L, Trail G, Sullivan J, Davy E, Bucay N, Renshaw-Gegg L, Hughes TM, Hill D, Pattison W, Campbell P, Sander S, Van G, Tarpley J, Derby P, Lee R, Amgen EST Program, Boyle WJ 1997 Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell 89:309–319[CrossRef][Medline]
  9. Khosla S 2001 The OPG/RANKL/RANK system. Endocrinology 142:5050–5055[Abstract/Free Full Text]
  10. Teitelbaum SL 2000 Bone resorption by osteoclasts. Science 289:1504–1508[Abstract/Free Full Text]
  11. Hofbauer LC, Khosla S, Dunstan CR, Lacey DL, Spelsberg TC, Riggs BL 1999 Estrogen stimulates gene expression and protein production of osteoprotegerin in human osteoblastic cells. Endocrinology 140:4367–4370[Abstract/Free Full Text]
  12. Saika M, Inoue D, Kido S, Matsumoto T 2001 17ß-estradiol stimulates expression of osteoprotegerin by a mouse stromal cell line, ST-2, via estrogen receptor-{alpha}. Endocrinology 142:2205–2212[Abstract/Free Full Text]
  13. Lindberg MK, Erlandsson M, Alatalo SL, Windahl S, Andersson G, Halleen JM, Carlsten H, Gustafsson JA, Ohlsson C 2001 Estrogen receptor-{alpha}, but not estrogen receptor-ß, is involved in the regulation of the OPG/RANKL (osteoprotegerin/receptor activator of NF-{kappa}B ligand) ratio and serum interleukin-6 in male mice. J Endocrinol 171:425–433[Abstract]
  14. Viereck V, Gründker C, Blaschke S, Siggelkow H, Emons G, Hofbauer LC 2002 The phytoestrogen genistein stimulates the production of osteoprotegerin by human trabecular osteoblasts. J Cell Biochem 84:725–735[CrossRef][Medline]
  15. Siggelkow H, Rebenstorff K, Kurre W, Niedhart C, Engel I, Schulz H, Atkinson MJ, Hüfner M 1999 Development of the osteoblast phenotype in primary human osteoblasts in culture: comparison with rat calvarial cells in osteoblast differentiation. J Cell Biochem 75:22–35[CrossRef][Medline]
  16. Siggelkow H, Schenck M, Rohde M, Viereck V, Tauber S, Atkinson MJ, Hüfner M 2002 Prolonged culture of HOS 58 human osteosarcoma cells with 1, 25-(OH)2-D3, TGF-ß, and dexamethasone reveals physiological regulation of alkaline phosphatase, dissociated osteocalcin gene expression and protein synthesis and lack of mineralization. J Cell Biochem 85:279–294[CrossRef][Medline]
  17. Harlow E, Lane D 1988 Antibodies: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Publications; 139–243
  18. Ireland DC, Bord S, Beavan SR, Compston JE 2002 Effects of estrogen on collagen synthesis by cultured human osteoblasts depend on the rate of cellular differentiation. J Cell Biochem 86:251–257[CrossRef][Medline]
  19. Viereck V, Emons G, Lauck V, Frosch KH, Blaschke S, Gründker C, Hofbauer LC 2002 Bisphosphonates pamidronate and zoledronic acid stimulate osteoprotegerin production by primary human osteoblasts. Biochem Biophys Res Commun 291:680–686[CrossRef][Medline]
  20. Hofbauer LC, Gori F, Riggs BL, Lacey DL, Dunstan CR, Spelsberg TC, Khosla S 1999 Stimulation of osteoprotegerin ligand and inhibition of osteoprotegerin production by glucocorticoids in human osteoblastic lineage cells: potential paracrine mechanisms of glucocorticoid-induced osteoporosis. Endocrinology 140:4382–4389[Abstract/Free Full Text]
  21. Cummings SR, Eckert S, Krueger KA, Grady D, Powles TJ, Cauley JA, Norton L, Nickelsen T, Bjarnason NH, Morrow M, Lippman ME, Black D, Glusman JE, Costa A, Jordan VC 1999 The effect of raloxifene on risk of breast cancer in postmenopausal women: results from the MORE randomized trial. Multiple Outcomes of Raloxifene Evaluation. JAMA 281:2189–2197[Abstract/Free Full Text]
  22. Taranta A, Brama M, Teti A, De Luca V, Scandurra R, Spera G, Agnusdei D, Termine JD, Migliaccio S 2002 The selective estrogen receptor modulator raloxifene regulates osteoclast and osteoblast activity in vitro. Bone 30:368–376[Medline]
  23. Quinn JM, Itoh K, Udagawa N, Hausler K, Yasuda H, Shima N, Mizuno A, Higashio K, Takahashi N, Suda T, Martin TJ, Gillespie MT 2001 Transforming growth factor-ß affects osteoclast differentiation via direct and indirect actions. J Bone Miner Res 16:1787–1794[CrossRef][Medline]
  24. Kassem M, Harris SA, Spelsberg TC, Riggs BL 1996 Estrogen inhibits interleukin-6 production and gene expression in a human osteoblastic cell line with high levels of estrogen receptors. J Bone Miner Res 11:193–199[Medline]
  25. Shevde NK, Bendixen AC, Dienger KM, Pike JW 2000 Estrogens suppress RANK ligand-induced osteoclast differentiation via a stromal cell independent mechanism involving c-Jun repression. Proc Natl Acad Sci USA 97:7829–7834[Abstract/Free Full Text]
  26. Fournier B, Gutzwiller S, Dittmar T, Matthias G, Steenbergh P, Matthias P 2001 Estrogen receptor (ER)-{alpha}, but not ER-ß, mediates regulation of the insulin-like growth factor I gene by antiestrogens. J Biol Chem 276:35444–35449[Abstract/Free Full Text]
  27. Yang NN, Bryant HU, Hardikar S, Sato M, Galvin RJ, Glasebrook AL, Termine JD 1996 Estrogen and raloxifene stimulate transforming growth factor-ß3 gene expression in rat bone: a potential mechanism for estrogen- or raloxifene-mediated bone maintenance. Endocrinology 137:2075–2084[Abstract]
  28. van den Wijngaard A, Mulder WR, Dijkema R, Boersma CJ, Mosselman S, van Zoelen EJ, Olijve W 2000 Antiestrogens specifically up-regulate bone morphogenetic protein-4 promoter activity in human osteoblastic cells. Mol Endocrinol 14:623–633[Abstract/Free Full Text]
  29. Zhou S, Zilberman Y, Wassermann K, Bain SD, Sadovsky Y, Gazit D 2001 Estrogen modulates estrogen receptor {alpha} and ß expression, osteogenic activity, and apoptosis in mesenchymal stem cells (MSCs) of osteoporotic mice. J Cell Biochem 81(S36):144–155
  30. Gori F, Hofbauer LC, Dunstan CR, Spelsberg TC, Khosla S, Riggs BL 2000 The expression of osteoprotegerin and RANK ligand and the support of osteoclast formation by stromal-osteoblast lineage cells is developmentally regulated. Endocrinology 141:4768–4776[Abstract/Free Full Text]
  31. Tou L, Quibria N, Alexander JM 2001 Regulation of human cbfa1 gene transcription in osteoblasts by selective estrogen receptor modulators (SERMs). Mol Cell Endocrinol 183:71–79[CrossRef][Medline]
  32. Qu Q, Harkonen PL, Vaananen HK 1999 Comparative effects of estrogen and antiestrogens on differentiation of osteoblasts in mouse bone marrow culture. J Cell Biochem 73:500–507[CrossRef][Medline]
  33. Thirunavukkarasu K, Halladay DL, Miles RR, Yang X, Galvin RJ, Chandrasekhar S, Martin TJ, Onyia JE 2000 The osteoblast-specific transcription factor Cbfa1 contributes to the expression of osteoprotegerin, a potent inhibitor of osteoclast differentiation and function. J Biol Chem 275:25163–25172[Abstract/Free Full Text]
  34. Thirunavukkarasu K, Miles RR, Halladay DL, Yang X, Galvin RJ, Chandrasekhar S, Martin TJ, Onyia JE 2001 Stimulation of osteoprotegerin (OPG) gene expression by transforming growth factor-ß (TGF-ß): mapping of the OPG promoter region that mediates TGF-ß effects. J Biol Chem 276:36241–36250[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J EndocrinolHome page
C. Engdahl, C. Jochems, J.-A. Gustafsson, P. T van der Saag, H. Carlsten, and M. K Lagerquist
In vivo activation of gene transcription via oestrogen response elements by a raloxifene analogue
J. Endocrinol., December 1, 2009; 203(3): 349 - 356.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. E. Kearns, S. Khosla, and P. J. Kostenuik
Receptor Activator of Nuclear Factor {kappa}B Ligand and Osteoprotegerin Regulation of Bone Remodeling in Health and Disease
Endocr. Rev., April 1, 2008; 29(2): 155 - 192.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. Schumacher, R. Guennoun, A. Ghoumari, C. Massaad, F. Robert, M. El-Etr, Y. Akwa, K. Rajkowski, and E.-E. Baulieu
Novel Perspectives for Progesterone in Hormone Replacement Therapy, with Special Reference to the Nervous System
Endocr. Rev., June 1, 2007; 28(4): 387 - 439.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
U.H. Lerner
Bone Remodeling in Post-menopausal Osteoporosis
Journal of Dental Research, July 1, 2006; 85(7): 584 - 595.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Esposito, A. Iacono, G. M. Raso, M. Pacilio, A. Coppola, R. Di Carlo, and R. Meli
Raloxifene, a Selective Estrogen Receptor Modulator, Reduces Carrageenan-Induced Acute Inflammation in Normal and Ovariectomized Rats
Endocrinology, August 1, 2005; 146(8): 3301 - 3308.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. Rzewuska-Lech, M. Jayachandran, L. A. Fitzpatrick, and V. M. Miller
Differential effects of 17{beta}-estradiol and raloxifene on VSMC phenotype and expression of osteoblast-associated proteins
Am J Physiol Endocrinol Metab, July 1, 2005; 289(1): E105 - E112.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
L. C. Hofbauer and M. Schoppet
Clinical Implications of the Osteoprotegerin/RANKL/RANK System for Bone and Vascular Diseases
JAMA, July 28, 2004; 292(4): 490 - 495.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
S.-Y. Tsang, X. Yao, K. Essin, C.-M. Wong, F. L. Chan, M. Gollasch, and Y. Huang
Raloxifene Relaxes Rat Cerebral Arteries In Vitro and Inhibits L-Type Voltage-Sensitive Ca2+ Channels
Stroke, July 1, 2004; 35(7): 1709 - 1714.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Viereck, V.
Right arrow Articles by Hofbauer, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Viereck, V.
Right arrow Articles by Hofbauer, L. C.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*DEXAMETHASONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals