help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nelson, A. E.
Right arrow Articles by Bligh, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nelson, A. E.
Right arrow Articles by Bligh, P. C.
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 9 4088-4094
Copyright © 2003 by The Endocrine Society

CLINICAL CASE SEMINAR

Fibroblast Growth Factor 23: A New Clinical Marker for Oncogenic Osteomalacia

Anne E. Nelson, Roderick Clifton Bligh, Michiko Mirams, Anthony Gill, Amy Au, Adele Clarkson, Harald Jüppner, Stephen Ruff, Paul Stalley, Richard A. Scolyer, Bruce G. Robinson, Rebecca S. Mason and Phillip Clifton Bligh

Cancer Genetics, Kolling Institute of Medical Research, University of Sydney and Royal North Shore Hospital (A.E.N., R.C.B., M.M., A.A., B.G.R.), and Endocrinology Department (R.C.B., B.G.R., P.C.B.), Department of Surgery (S.R.), and Anatomical Pathology Department, PaLMS (A.G., A.C.), Royal North Shore Hospital, St. Leonards, Sydney 2065, Australia; Physiology Department, Institute of Biomedical Research, University of Sydney (A.E.N., M.M., A.A., R.S.M.), Sydney 2006, Australia; Endocrine Unit, Departments of Medicine and Pediatrics, Massachusetts General Hospital and Harvard Medical School (H.J.), Boston, Massachusetts 02114; and Department of Surgery (P.S.) and Anatomical Pathology Department (R.A.S.), Royal Prince Alfred Hospital, Sydney 2050, Australia

Address all correspondence and requests for reprints to: Dr. Anne E. Nelson, Cancer Genetics Department, Kolling Institute of Medical Research, Royal North Shore Hospital, St. Leonards, Sydney 2065, Australia. E-mail: annen{at}med.usyd.edu.au.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The phosphate-wasting condition, oncogenic osteomalacia, is problematic to diagnose and manage clinically due to difficulty in locating the causative tumor. Fibroblast growth factor 23 (FGF23) has recently been implicated in the pathogenesis of oncogenic osteomalacia. In this case the patient presented with clinical features typical of oncogenic osteomalacia. Removal of an angiolipoma from the thigh did not correct the clinical or biochemical abnormalities. Subsequent identification and removal of a benign giant cell tumor in the pubic ramus, however, did result in normalization of his symptoms and signs. Positive staining for FGF23 protein by immunohistochemistry was demonstrated in the giant cell tumor, but not in the angiolipoma. The serum concentration of FGF23 was elevated in preoperative serum, then normalized after removal of the giant cell tumor. Expression of both FGF23 mRNA and protein was demonstrated in the giant cell tumor tissue, and FGF23 mRNA expression and renal phosphate uptake inhibitory activity were also detected in cultured giant cell tumor cells. This case provides further evidence for the involvement of FGF23 in the pathogenesis of oncogenic osteomalacia and for the utility of serum FGF23 measurement and immunohistochemical detection of FGF23 in the diagnosis and clinical management of this condition.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
ONCOGENIC OSTEOMALACIA IS a condition that commonly presents clinical difficulties in diagnosis and management. The condition is characterized by osteomalacia due to renal phosphate wasting and low serum concentration of 1,25-dihydroxyvitamin D occurring in the presence of a tumor that, if located and completely removed, results in rapid resolution of the symptoms and signs (reviewed in Ref. 1). The causative tumor may be small, slow growing, and clinically unapparent. Furthermore, these tumors have occurred in many different locations, often making their detection difficult. This clinical problem may now be assisted by investigations for the recently described fibroblast growth factor 23 (FGF23).

FGF23 was originally identified as the gene mutated in autosomal dominant hypophosphatemic rickets (ADHR) (2) and was also independently isolated by homology searching as a novel FGF expressed in the thalamus (3). ADHR is characterized by defective bone mineralization caused by renal phosphate wasting that results in hypophosphatemia and by inappropriately normal 1,25-dihydroxyvitamin D serum concentrations (4). The identification of mutations in FGF23 that segregated with the disease in affected individuals with ADHR suggested a role for this gene in phosphate homeostasis (2). The mutations identified in ADHR occur in a consensus proteolytic cleavage site and result in a mutant FGF23 protein that is resistant to degradation (5).

The biochemical phenotype of ADHR is similar to that of the sporadic condition oncogenic osteomalacia (OOM). There is evidence that the tumors responsible for OOM secrete circulating factor(s) that results in renal phosphate wasting and abnormal vitamin D metabolism (reviewed in Ref. 1). Inhibition of renal phosphate reabsorption has been demonstrated in vitro by ourselves and other groups using conditioned medium from cultured OOM tumor cells (6, 7, 8, 9, 10). Several genes have recently been reported that are overexpressed by tumors responsible for OOM including FGF23 (11, 12, 13), thereby implicating FGF23 in the pathogenesis of this phosphate-wasting condition.

In this study FGF23 was examined in a patient who presented with symptoms and signs typical of OOM. The causative tumor was finally located and surgically removed, resulting in rapid resolution of both the patient’s symptoms and biochemical abnormalities, which is characteristic of OOM. FGF23 was measured in pre- and postoperative serum, and expression of FGF23 mRNA and protein was examined in the tumor and in cultured tumor cells. The results support the proposal that FGF23 is expressed by OOM tumors and that elevated circulating concentrations of FGF23 may be responsible for the renal phosphate wasting and abnormal vitamin D metabolism in OOM. Furthermore, the detection of elevated FGF23 in preoperative serum and of FGF23 expression in the causative tumor demonstrates the clinical utility of these tests in the diagnosis of patients with oncogenic osteomalacia.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials

The OK 3B2 cells were provided by Prof. Heini Murer (Zurich, Switzerland). Tissue culture media and additives were obtained from Life Technologies, Inc. (Gaithersburg, MD) and Trace Biosciences (Melbourne, Australia). The isotope [32P]orthophosphoric acid was obtained from PerkinElmer (Rowville, Australia). Primers for PCR were synthesized by Sigma Genosys (Castle Hill, Australia). Antibodies used for immunohistochemistry and Western analysis were rabbit polyclonal antibodies raised against human [Tyr224]FGF-23225–244 amide (14). For immunohistochemistry, target retrieval solution S1699 for antigen retrieval and a biotin-free detection system (EnVision Plus and diaminobenzidene plus chromogen) were obtained from DAKO (Carpenteria, CA).

Cell culture

Cultures of cells from the giant cell tumor (designated FR cells) were established from minced tissue pieces immediately postoperatively and grown in low calcium DMEM as previously described (9). Serum-free conditioned medium was collected from the cells. Serum-free medium collected from cultured skin fibroblasts and unconditioned medium were used as controls.

Phosphate uptake bioassay

The measurement of phosphate uptake was carried out using OK 3B2 cells as previously described (10). The response to conditioned medium was measured after preincubation with confluent OK cells for 20 h and was determined as the percent inhibition of the uptake by cells incubated with control unconditioned medium. Serum was tested in the assay at concentrations from 5–20% (vol/vol) compared with serum from two age- and sex-matched controls at the same concentration, as previously described (15). Statistical analysis was performed using a two-sample t test. As there were four possible comparisons, and to avoid the possible false positive significant results, each P value from the t test was adjusted by dividing it by 4 according to the Bonferroni’s procedure of multiple comparisons.

Amplification of FGF23 from genomic DNA

Genomic DNA was extracted from cultured tumor cells using the Puregene DNA Purification System (Gentra Systems, Minneapolis, MN). Primers that spanned the intron/exon boundaries were used to amplify the three exons of FGF23 with the 5'-3' sequences: FGF23 1F, aatctcagcaccagccactc; FGF23 1R, agatggacaacaagggtgct; FGF23 2F, ggaattggatggcaatgagt, FGF23 2R: cagggtacactgcaaatgga, FGF23 3.1F: ctcaacgccctaagaactgc; FGF23 3.1R, ggtatgggggtgttgaagtg; FGF23 3.2F, tcacttcctggtcagtctgg; FGF23 3.2R, tgctgagggatgggttaaag.

Expression of FGF23 mRNA by RT-PCR

Total RNA was extracted by Tri-Reagent (Sigma-Aldrich Corp., St. Louis, MO). The RNA was reverse transcribed to cDNA using Superscript II RNase H reverse transcriptase (Invitrogen, Groningen, The Netherlands) and oligo(deoxythymidine) primer following the manufacturer’s protocol. FGF23 was amplified from cDNA using the forward primer 5'-TACCACCTGCAGATCCACAA-3' and the reverse primer 5'-GTTTGCTGAGGGATGGTTA-3'. Automated sequencing was carried out by the Australian Genome Research Facility (Brisbane, Australia).

Immunohistochemistry

Immunohistochemistry was performed on paraffin-embedded sections using the rabbit polyclonal anti-FGF-23 antibody. Formalin-fixed (and not decalcified) paraffin-embedded blocks were used. The tissues were sectioned onto positively charged slides (SuperFrost Plus, Menzel-Glaser, Freiburg, Germany) and deparaffinized with xylene and alcohol. Nonpressurized water bath antigen retrieval at 97 C for 55 min was employed using target retrieval solution S1699, pH 6. Slides were incubated with the primary antibody for 60 min at a dilution of 1:200. The EnVision Plus, rabbit nonbiotin, detection system, and diaminobenzidene plus chromogen were used according to the manufacturer’s protocol for immune complex detection. Strong granular cytoplasmic staining was interpreted as positive, whereas a weak diffuse cytoplasmic blush or nuclear staining was interpreted as negative. The slides, including four negative tissue controls (two meningiomas and two schwannomas) and a negative control of the tumor without incubation with the primary antibody, were interpreted by a pathologist blinded to other data.

Western blotting

Tumor lysate was prepared by homogenization in lysis buffer containing Nonidet P-40 and protease inhibitor (Sigma-Aldrich Corp.). The protein concentration was determined using the Bradford protein assay (Bio-Rad, Inc., Hercules, CA); 25–50 µg protein were electrophoresed on 8–16% sodium dodecyl sulfate-polyacrylamide gel (Gradipore, Frenchs Forest, Australia) and electroblotted onto a nitrocellulose membrane (Amersham Pharmacia Biotech, Little Chalfont, UK). Membranes were probed using the rabbit anti-FGF23 antibody, then incubated with antirabbit immunoglobulin horseradish peroxidase antibody (Amersham Pharmacia Biotech,) and visualized using ECL Plus (Amersham Pharmacia Biotech).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Case reports

A 52-yr-old man was first evaluated when he developed fracture of the right third metatarsal after prolonged walking and multiple rib fractures after gym exercise. His past medical history was unremarkable. He was a nonsmoker, with no relevant family history of illness, and he worked as a physiotherapist. Clinical examination was consistent with the symptomatic fractures, and a 2-cm soft lump was noted in the lateral aspect of the left thigh. Whole body bone scintigraphy confirmed multiple rib fractures as well as increased tracer uptake in both sacroiliac joints and the right superior pubic ramus. Plain radiography of the pelvis demonstrated a small area of lucency in the right superior pubic ramus.

Initial biochemical evaluation revealed hypophosphatemia and inappropriately low normal 1,25-dihydroxyvitamin D concentrations (Table 1Go). Hyperphosphatasia, hyperparathyroidism, hypocalcemia, and low serum 25- hydroxyvitamin D concentrations were also noted (Table 1Go). Osteodensitometry by DEXA (XR26, Norland, Fort Atkinson, WI) showed reduced bone density in both lumbar spine (0.92 g/cm2; T-score, -1.14) and left femoral neck (0.73 g/cm2; T-score, -2.22). Whole body scintigraphy with octreotide was negative. Excision biopsy in November 2000 of the soft tissue lesion in the left thigh showed a benign angiolipoma. Computed tomography-guided biopsy of the lucent area within the right superior pubic ramus was paucicellular and nondiagnostic. There were no subsequent changes in the patient’s biochemistry after removal of the angiolipoma. The patient declined further surgical intervention at that time.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Biochemical measurements in the patient after various treatments

 
After 1-month treatment with ergocalciferol (vitamin D2, 1000 U daily), he remained symptomatic with left chest wall pain, and no significant change in his biochemical parameters occurred other than an increase in 25-hydroxyvitamin D to 100 nmol/liter (Table 1Go). However, 2 months after commencing calcitriol (1,25-dihydroxyvitamin D3, 0.25 µg twice daily), his bone pain had improved, serum phosphate increased, and serum intact PTH had fallen to be within the normal range (Table 1Go). Eight months after commencement of calcitriol, the tubular transport maximum for phosphate/glomerular filtration rate was calculated as approximately 0.38 mmol/liter (normal range, 0.8–1.35 mmol/liter).

A magnetic resonance imaging scan of the pelvis performed 18 months after his initial clinical presentation showed growth of the lesion in the right superior pubic ramus, then measuring 2.7 x 2.7 x 4 cm and extending medially within the pelvic cavity to abut the bladder wall (Fig. 1Go). The tumor was surgically removed en bloc with the entire superior ramus. A trephine biopsy obtained from the left iliac crest at the time of surgery, doubly labeled with tetracycline, had features of osteomalacia, including increased osteoid area, surface, and seam width; mineralization lag time could not be calculated due to smearing of the tetracycline label. The patient made an uneventful recovery and was discharged on no medication. Calcitriol had been discontinued preoperatively, and within 5 d postoperatively serum 1,25-dihydroxyvitamin D had risen to a peak of 408 pmol/liter (normal range, 38–162 pmol/liter), whereas 16 d postoperatively serum phosphate rose to a peak value of 1.71 mmol/liter (normal range, 0.78–1.43 mmol/liter; Fig. 2Go). Serum 1,25-dihydroxyvitamin D and phosphate concentrations declined into the normal range thereafter. The clinical outcome for the patient after removal of the giant cell tumor has been excellent. At follow-up 6 months after surgery, he had no fractures and no pain even with vigorous exercise, and his serum biochemistry was normal (Table 1Go). At 12 months follow-up, he remained well, with tubular transport maximum for phosphate/glomerular filtration rate calculated as approximately 1.17 mmol/liter (normal range, 0.8–1.35 mmol/liter).



View larger version (204K):
[in this window]
[in a new window]
  		FIG. 1. Magnetic resonance image from patient FR, showing tumor in the right superior pubic ramus. T1-weighted magnetic resonance imaging scan of the pelvis, showing a tumor involving the right superior pubic ramus (white arrow) measuring 2.7 x 4 cm. The bulk of the tumor lies on the posterior aspect of the superior pubic ramus, and its medial portion bulged posteriorly and superiorly.

 


View larger version (23K):
[in this window]
[in a new window]
  		FIG. 2. Time course of perioperative biochemical changes. Perioperative serum concentrations of 1,25-dihydroxyvitamin D ({blacksquare}), phosphate ({blacktriangleup}), and PTH ({diamond}). After surgical excision of the giant cell tumor on March 21, 2002 (arrow), serum 1,25-dihydroxyvitamin D and then phosphate concentrations increased within days. Normal ranges: 1,25-dihydroxyvitamin D, 38–162 pmol/liter; phosphate, 0.78–1.43 mmol/liter; PTH, 12–72 pg/ml.

 
Histology

The tumor was composed of closely packed oval to plump spindled cells with scattered osteoclast-like giant cells. In some areas an open staghorn (hemangiopericytomatous) vascular pattern was evident. Some osteoid was present and there was focal infiltration of extraskeletal adipose tissue. The mitotic rate was 2–3/10 high power fields. Areas of secondary aneurysmal bone cyst formation were noted. After review by multiple pathologists and radiological correlation, the preferred diagnosis was fibrohistiocytic variant of giant cell tumor of bone. Electron microscopy supported the impression of fibrohistiocytic differentiation.

Measurement of FGF23 and bioactivity in patient serum

FGF23 was measured by C-terminal ELISA (Immutopics, Inc., San Clemente, CA). In preoperative serum, FGF23 was elevated at 477 reference units (RU)/ml (normal range, 21 ± 11SD RU/ml). The day following surgery to remove the giant cell tumor, the FGF23 serum concentration fell to 40 RU/ml, and 5 d postoperatively it was 22 RU/ml. Serum from the patient was tested in the renal phosphate uptake assay and compared with age- and sex-matched controls. At a 20% concentration, significant inhibition of renal phosphate uptake by about 30% was detected compared with control serum in response to prelipoma removal serum (November 2000) and in response to pre-giant cell removal serum, and was not significantly detected in serum 5 d post-giant cell tumor removal. Inhibition of phosphate uptake by diluted preoperative serum is shown in Fig. 3Go, which is representative of four separate experiments.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 3. Inhibition of phosphate uptake by renal OK 3B2 cells by preoperative serum from patient FR. Phosphate uptake was measured in triplicate in OK 3B2 cells after preincubation of confluent cells for 20 h with heat-inactivated prelipoma removal serum (November 2000) at a 5–20% (vol/vol) concentration and was corrected for total protein content per well. Inhibition in response to FR serum was calculated as the percent inhibition of uptake by cells incubated with the same concentration of control serum. The response to PTH (100 ng/ml) is shown as the control. *, Significantly different from vehicle control or control medium (P < 0.05).

 
Genomic sequence of FGF23 and cytogenetic analysis of cultured tumor cells

The three exons of FGF23 were amplified from genomic DNA extracted from cultured FR giant cell tumor cells, and the products were sequenced. No mutations were detected in FGF23 amplified from FR tumor cells; specifically, those mutations previously described in ADHR (involving nucleotides encoding arginines at codons 176 and 179) were absent. A polymorphism previously reported (2) was found in FGF23 exon 3 from both the tumor DNA and genomic DNA extracted from peripheral blood leukocytes. This C to T nucleotide variation is predicted to change threonine to methionine at codon 239 (T239M) in the coding sequence of FGF23.

The three exons of FGF23 were amplified from cultured OOM tumor cells from two other patients we have previously reported (9, 15), and the sequence of FGF23 was identical to the wild-type sequence (GenBank accession no. AF262537). Specifically, no mutations were detected in FGF23 amplified from OOM tumor cells in the 176RHTR179 sequence.

Cytogenetic analysis of metaphase spreads prepared from cultured FR cells detected no structural or numerical chromosome abnormalities.

Expression of FGF23 mRNA in FR tumor and detection of FGF23 protein by Western blotting and immunohistochemistry

RNA was extracted from fresh-frozen FR giant cell tumor. FGF23 mRNA expression was demonstrated by RT-PCR (Fig. 4AGo). A product of the predicted size of 649 bp was amplified by PCR from cDNA reverse transcribed from the RNA, and the identity of the product was confirmed by sequencing.



View larger version (65K):
[in this window]
[in a new window]
  		FIG. 4. Expression of FGF23 mRNA and protein in FR tumor. A, FGF23 was amplified by RT-PCR from RNA extracted from FR tumor tissue using primers that spanned from exons 1–3 of FGF23. Controls without reverse transcriptase (RT-) and no cDNA (H2O) were negative. B, Western analysis of FR tumor lysate using anti-FGF23 antibody. Analysis of 25 and 50 µg FR tumor lysate showed an immunoreactive band of approximately 32 kDa. Media from HEK 293 cells transiently transfected with FGF23 or vector were used as controls.

 
Western blotting analysis of FR tumor extract using anti-FGF23 antibody detected an immunoreactive protein of approximately 32 kDa (Fig. 4BGo). The tumor showed widespread positivity for FGF-23 by immunohistochemistry (Fig. 5AGo). Anti-FGF23 staining was cytoplasmic and distinctly granular, with some perinuclear accentuation. Numerous positive cells were found in every high powered field. In experiments using an antibody raised in a different animal, positive staining was markedly reduced by preincubation of the antibody with peptide. Staining of the tumor with secondary antibody alone was negative. Anti-FGF23 staining was absent in four control tumor samples (two meningiomas and two schwannomas). The angiolipoma removed from the patient 18 months earlier did not stain with the anti-FGF23 antibody, although the high percentage of fat cells made interpretation difficult.



View larger version (83K):
[in this window]
[in a new window]
  		FIG. 5. Immunohistochemistry of FR tumor and negative control using anti-FGF23 antibody. Formalin-fixed paraffin-embedded sections were used, deparaffinized, then incubated with primary antibody. EnVision plus and diaminobenzidene plus chromogen were used for immune complex detection. A, Positive staining of FR tumor with anti-FGF23 antibody under high power. Staining was cytoplasmic and granular, with some perinuclear accentuation. B, Negative staining of FR tumor incubated without primary anti-FGF23 antibody under high power. C, Negative staining of control meningioma tumor with anti-FGF23 antibody under high power.

 
Expression of FGF23 mRNA in cultured tumor cells

Expression of FGF23 mRNA was detected in RNA extracted from cultured FR tumor cells (Fig. 6Go) that had been maintained for up to 6 wk and up to two passages in culture. RNA from HEK293 cells was used as a positive control for FGF23 mRNA expression (16). The identity of the 649-bp product was confirmed by sequencing.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 6. Expression of FGF23 mRNA in cultured FR tumor cells. FGF23 was amplified by RT-PCR from RNA extracted from cultured FR tumor cells using primers that spanned from exons 1–3 of FGF23. cDNA from HEK 293 cells was used a positive control. Controls without cDNA (H2O) and without reverse transcriptase (RT-) were negative.

 
Bioactivity of conditioned media from cultured tumor cells

Serum-free conditioned media from cultured FR cells significantly inhibited renal phosphate uptake by OK 3B2 cells compared with control unconditioned medium (Fig. 7Go), whereas there was no significant inhibition in response to serum-free fibroblast conditioned medium. Immunoassays for PTH and PTHrP detected no significant immunoreactivity in FR cell-conditioned medium that inhibited phosphate uptake by renal OK 3B2 cells.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 7. Inhibition of phosphate uptake by renal OK 3B2 cells by conditioned media from FR tumor cultured cells. Phosphate uptake was measured in triplicate in OK 3B2 cells after preincubation of confluent cells for 20 h with serum-free conditioned medium collected from three different subcultures of FR tumor cells (FR1–FR3). Inhibition in response to FR-conditioned media was calculated as the percent inhibition of uptake by cells incubated with control unconditioned medium. The response to PTH (100 ng/ml) is shown as a positive control. *, Significantly different from control (P < 0.05).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The clinical management and confirmation of the diagnosis of oncogenic osteomalacia in this case presented difficulties that commonly occur in patients with this phosphate-wasting disorder (15, 17, 18). Although the clinical presentation was suggestive of oncogenic osteomalacia, the removal of the initial tumor located, a benign angiolipoma in the left thigh, did not correct the clinical or biochemical abnormalities in this patient. A second tumor was identified within the right superior pubic ramus 18 months after initial presentation. Removal of this benign giant cell tumor resulted in rapid normalization of the patient’s symptoms and signs. In this case, as reported previously (15, 19, 20), magnetic resonance imaging assisted in localization of the giant cell tumor. Somatostatin receptor imaging, which has been reported to locate tumors causing oncogenic osteomalacia (21, 22, 23) and which identified the tumor in five of seven patients in a series recently reported (24), failed to locate the tumor in this case. The detection of FGF23 by immunohistochemistry in the causative giant cell tumor, but not in the angiolipoma first suspected, emphasizes that FGF23 expression may be a useful tumor marker in oncogenic osteomalacia.

The initial clinical presentation of our case was accompanied by biochemical abnormalities typical of oncogenic osteomalacia, namely hypophosphatemia and low normal serum 1,25-dihydroxyvitamin D concentrations. Consistent with previous reports (reviewed in Ref. 25), remission of clinical and biochemical abnormalities occurred after replacement with 1,25-dihydroxyvitamin D, but not with ergocalciferol alone. Notably, despite near-normal serum phosphate concentrations for 12 months during treatment with calcitriol, transiliac bone biopsy showed features consistent with osteomalacia.

Hyperparathyroidism was a feature of this case, which was apparent at presentation in the presence of subnormal serum 25-hydroxyvitamin D concentrations. There was no particular history of low sun exposure, but generalized bone pain and muscle weakness may have limited outdoor activities. In view of the hyperparathyroidism, treatment was commenced with calcitriol only, with no phosphate supplements. Hyperparathyroidism has been reported in other oncogenic osteomalacia cases commonly after treatment (17, 24) and in one case after removal of the oncogenic osteomalacia tumor (26). The mechanism of hyperparathyroidism, which is not always a feature of oncogenic osteomalacia, is not well understood.

The demonstration of FGF23 expression in the giant cell tumor of this patient provides further support for the involvement of FGF23 in the pathogenesis of oncogenic osteomalacia as suggested by previous reports of FGF23 expression in this condition (12, 27). Our results extend the findings of these previous studies by showing not only FGF23 mRNA expression, but also protein expression, by immunohistochemistry in the giant cell tumor. Western analysis of tumor tissue also demonstrated an immunoreactive protein of approximately 32 kDa, but not the smaller band detected in transfected cell conditioned medium, which was consistent with previous findings in an oncogenic osteomalacia tumor (12). Preoperative serum from our patient significantly inhibited phosphate uptake in a renal cell bioassay, consistent with the presence of a circulating phosphaturic factor. Moreover, the FGF23 concentration was elevated in preoperative serum and then returned to normal after tumor removal, in parallel with resolution of the clinical and biochemical abnormalities and consistent with a recent report (28). Finally, both renal phosphate uptake inhibitory activity and FGF23 expression remained detectable in cultured tumor cells.

Of particular interest was the rapid increase in serum 1,25-dihydroxyvitamin D concentrations that preceded a parallel increase in serum phosphate levels after removal of the giant cell tumor. This phenomenon has been noted previously (17, 29, 30) and suggests that the humoral factor(s) produced by the tumor independently regulates both phosphate transport and 1,25-dihydroxyvitamin D metabolism. In a recent study in which mice were injected with purified FGF23, serum 1,25-dihydroxyvitamin D concentrations declined before a corresponding fall in serum phosphate (31). The clinical data from our case would be consistent with a role for FGF23 in suppressing 1,25-dihydroxyvitamin D levels in a manner independent of its phosphaturic effect.

It is not clear that FGF23 is the only (or even the major) mediator of reduced renal phosphate transport in oncogenic osteomalacia. Overexpression of other genes has been reported in oncogenic osteomalacia tumors (13). These include the genes encoding matrix extracellular phosphoglycoprotein and frizzled related protein 4, and some evidence has been reported that these proteins affect renal phosphate transport (32, 33). It is possible that the phenotype of oncogenic osteomalacia may be due to a multiplicity of factors that alone or together inhibit phosphate reabsorption and/or 1,25-dihydroxyvitamin D production. Nevertheless, a recent preliminary report that mice homozygous for targeted FGF23 gene disruption were hyperphosphatemic and had elevated serum 1,25-dihydroxyvitamin D concentrations provides compelling evidence that FGF23 is crucial for normal phosphate homeostasis and vitamin D metabolism (34).

This case report provides further evidence for the involvement of FGF23 in oncogenic osteomalacia. The elevated FGF23 concentration in the preoperative serum that normalized after resection of the causative tumor and specific FGF23 immunostaining of the causative tumor indicate that FGF23 will be a useful clinical marker for the diagnosis and management of oncogenic osteomalacia.


   Acknowledgments
 
We thank Nisha Singh (Cytogenetics Department PaLMS) for cytogenetic studies, Margaret Wilkinson (Endocrinology Department) for PTH and PTHrP immunoassays, Erin Martin for assistance with bioassays, and Dr. Greg Briggs (Department of Radiology, Royal North Shore Hospital). Dr. Terry Diamond (Department of Endocrinology, St. George Hospital, Kogarah) is acknowledged for bone histomorphometry. Dr. Charles Chan (Central Sydney Electron Microscopy Unit and Anatomical Pathology Department, Concord Repatriation General Hospital) is acknowledged for tumor ultrastructural analysis, and Drs. Stanley McCarthy, Fiona Bonar, and Allan Palmer (Anatomical Pathology, Royal Prince Alfred Hospital) are acknowledged for reviewing the histopathology.


   Footnotes
 
This work was supported by the National Health and Medical Research Council of Australia (to A.E.N., R.S.M., and B.G.R.) and Glaxo SmithKline (to M.M.).

A.E.N. and R.C.B. are joint first authors.

Abbreviations: ADHR, Autosomal dominant hypophosphatemic rickets; FGF, fibroblast growth factor; OOM, oncogenic osteomalacia; RU, reference units.

Received December 5, 2002.

Accepted May 23, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nelson AE, Robinson BG, Mason RS 1997 Oncogenic osteomalacia: is there a new phosphate regulating hormone? Clin Endocrinol (Oxf) 47:635–642[CrossRef][Medline]
  2. White KE, Evans WE, O’Riordan JL, Speer MC, Econs MJ, Lorenz-Depiereux B, Grabowski M, Meitinger T, Strom TM 2000 Autosomal dominant hypophosphatemic rickets is associated with mutations in FGF23. Nat Genet 26:345–348[CrossRef][Medline]
  3. Yamashita T, Yoshioka M, Itoh N 2000 Identification of a novel fibroblast growth factor, FGF-23, preferentially expressed in the ventrolateral thalamic nucleus of the brain. Biochem Biophys Res Commun 277:494–498[CrossRef][Medline]
  4. Econs MJ, McEnery PT 1997 Autosomal dominant hypophosphatemic rickets/osteomalacia: clinical characterization of a novel renal phosphate-wasting disorder. J Clin Endocrinol Metab 82:674–681[Abstract/Free Full Text]
  5. White KE, Carn G, Lorenz-Depiereux B, Benet-Pages A, Strom TM, Econs MJ 2001 Autosomal-dominant hypophosphatemic rickets (ADHR) mutations stabilize FGF-23. Kidney Int 60:2079–2086[CrossRef][Medline]
  6. Cai Q, Hodgson SF, Kao PC, Lennon VA, Klee GG, Zinsmiester AR, Kumar R 1994 Brief report: inhibition of renal phosphate transport by a tumor product in a patient with oncogenic osteomalacia. N Engl J Med 330:1645–1649[Free Full Text]
  7. Rowe PSN, Ong ACM, Cockerill FJ, Goulding JN, Hewison M 1996 Candidate 56 and 58 kDa protein(s) responsible for mediating the renal defects in oncogenic hypophosphatemic osteomalacia. Bone 18:159–169[Medline]
  8. Wilkins GE, Granleese S, Hegele RG, Holden J, Anderson DW, Bondy GP 1995 Oncogenic osteomalacia: evidence for a humoral phosphaturic factor. J Clin Endocrinol Metab 80:1628–1634[Abstract/Free Full Text]
  9. Nelson AE, Namkung HJ, Patava J, Wilkinson MR, Chang AC-M, Reddel RR, Robinson BG, Mason RS 1996 Characteristics of tumor cell bioactivity in oncogenic osteomalacia. Mol Cell Endocrinol 124:17–23[CrossRef][Medline]
  10. Nelson AE, Hogan JJ, Holm IA, Robinson BG, Mason RS 2001 Phosphate wasting in oncogenic osteomalacia: PHEX is normal and the tumor-derived factor has unique properties. Bone 28:430–439[Medline]
  11. Shimada T, Mizutani S, Muto T, Yoneya T, Hino R, Takeda S, Takeuchi Y, Fujita T, Fukumoto S, Yamashita T 2001 Cloning and characterization of FGF23 as a causative factor of tumor-induced osteomalacia. Proc Natl Acad Sci USA 98:6500–6505[Abstract/Free Full Text]
  12. White KE, Jonsson KB, Carn G, Hampson G, Spector TD, Mannstadt M, Lorenz-Depiereux B, Miyauchi A, Yang IM, Ljunggren O, Meitinger T, Strom TM, Juppner H, Econs MJ 2001 The autosomal dominant hypophosphatemic rickets (ADHR) gene is a secreted polypeptide overexpressed by tumors that cause phosphate wasting. J Clin Endocrinol Metab 86:497–500[Abstract/Free Full Text]
  13. De Beur SM, Finnegan RB, Vassiliadis J, Cook B, Barberio D, Estes S, Manavalan P, Petroziello J, Madden SL, Cho JY, Kumar R, Levine MA, Schiavi SC 2002 Tumors associated with oncogenic osteomalacia express genes important in bone and mineral metabolism. J Bone Miner Res 17:1102–1110[CrossRef][Medline]
  14. Larsson T, Zahradnik R, Lavigne J, Ljunggren O, Juppner H, Jonsson KB 2003 Immunohistochemical detection of FGF-23 protein in tumors that cause oncogenic osteomalacia. Eur J Endocrinol 148:269–276[Abstract]
  15. Nelson AE, Mason RS, Robinson BG, Hogan JJ, Martin EA, Ahlstrom H, Astrom G, Larsson T, Jonsson K, Wibell L, Ljunggren O 2001 Diagnosis of a patient with oncogenic osteomalacia using a phosphate uptake bioassay of serum and magnetic resonance imaging. Eur J Endocrinol 145:469–476[Abstract]
  16. Mirams M, Robinson BG, Mason RS, Nelson AE 2002 Expression of FGF23 mRNA in human cell lines and tissues [Abstract]. J Bone Miner Res 17:S211
  17. Reid IR, Teitelbaum SL, Dusso A, Whyte MP 1987 Hypercalcemic hyperparathyroidism complicating oncogenic osteomalacia. Effect of successful tumor resection on mineral homeostasis. Am J Med 83:350–354[CrossRef][Medline]
  18. Gonzalez-Compta X, Manos-Pujol M, Foglia-Fernandez M, Peral E, Condom E, Claveguera T, Dicenta-Sousa M 1998 Oncogenic osteomalacia: case report and review of head and neck associated tumours. J Laryngol Otol 112:389–392[Medline]
  19. McGuire MH, Merenda JT, Etzkorn JR, Sundaram M 1989 Oncogenic osteomalacia. A case report. Clin Orthop 244:305–308
  20. Fukumoto S, Takeuchi Y, Nagano A, Fujita T 1999 Diagnostic utility of magnetic resonance imaging skeletal survey in a patient with oncogenic osteomalacia. Bone 25:375–377[Medline]
  21. Nguyen BD, Wang EA 1999 Indium-111 pentetreotide scintigraphy of mesenchymal tumor with oncogenic osteomalacia. Clin Nucl Med 24:130–131[CrossRef][Medline]
  22. Rhee Y, Lee JD, Shin KH, Lee HC, Huh KB, Lim SK 2001 Oncogenic osteomalacia associated with mesenchymal tumour detected by indium-111 octreotide scintigraphy. Clin Endocrinol (Oxf) 54:551–554[CrossRef][Medline]
  23. Seufert J, Ebert K, Muller J, Eulert J, Hendrich C, Werner E, Schuuze N, Schulz G, Kenn W, Richtmann H, Palitzsch KD, Jakob F 2001 Octreotide therapy for tumor-induced osteomalacia. N Engl J Med 345:1883–1888[Free Full Text]
  24. Jan de Beur SM, Streeten EA, Civelek AC, McCarthy EF, Uribe L, Marx SJ, Onobrakpeya O, Raisz LG, Watts NB, Sharon M, Levine MA 2002 Localisation of mesenchymal tumours by somatostatin receptor imaging. Lancet 359:761–763[CrossRef][Medline]
  25. Drezner MK 1999 Tumor-induced osteomalacia. In: Favus MJ, ed. Primer on the metabolic bone diseases and disorders of mineral metabolism. Philadelphia: Lippincott Williams & Wilkins; 331–337
  26. Heylen A, Dasnoy D, Hustin J, Pochet JM 1999 Tumor-related osteomalacia followed after treatment by hyperparathyroidism. Rev Rhum 66:53–57
  27. Bowe AE, Finnegan R, Jan de Beur SM, Cho J, Levine MA, Kumar R, Schiavi SC 2001 FGF-23 inhibits renal tubular phosphate transport and is a PHEX substrate. Biochem Biophys Res Commun 284:977–81[CrossRef][Medline]
  28. Yamazaki Y, Okazaki R, Shibata M, Hasegawa Y, Satoh K, Tajima T, Takeuchi Y, Fujita T, Nakahara K, Yamashita T, Fukumoto S 2002 Increased circulatory level of biologically active full-length FGF-23 in patients with hypophosphatemic rickets/osteomalacia. J Clin Endocrinol Metab 87:4957–4960[Abstract/Free Full Text]
  29. Miyauchi A, Fukase M, Tsutsumi M, Fujita T 1988 Hemangiopericytoma-induced osteomalacia: tumor transplantation in nude mice causes hypophosphatemia and tumor extracts inhibit renal 25-hydroxyvitamin D 1-hydroxylase activity. J Clin Endocrinol Metab 67:46–53[Abstract]
  30. Shane E, Parisien M, Henderson JE, Dempster DW, Feldman F, Hardy MA, Tohme JF, Karaplis AC, Clemens TL 1997 Tumor-induced osteomalacia: clinical and basic studies. J Bone Miner Res 12:1502–1511[CrossRef][Medline]
  31. Shimada T, Muto T, Hasegawa H, Yamazaki Y, Takeuchi Y, Fujita T, Fukumoto S, Yamashita T 2002 FGF-23 is a novel regulator of mineral homeostasis with unique properties controlling vitamin D metabolism and phosphate reabsorption [Abstract]. J Bone Miner Res 17:S425
  32. Rowe PSN, Kumagai Y, Garrett R, Blacher R, Escobada A, Mundy GR 2002 CHO-cells expressing MEPE, PHEX and co-expressing MEPE/PHEX cause major changes in BMD, Pi and serum alkaline phosphatase in nude mice [Abstract]. J Bone Miner Res 17:S211
  33. Berndt TJ, Vassiliadis J, Reczek D, Schiavi SC, Kumar R 2002 Effect of the acute infusion of frizzled related protein 4 (FRP-4), a protein highly expressed in tumors associated with osteomalacia, on phosphate excretion in vivo [Abstract]. J Bone Miner Res 17:S158
  34. Shimada T, Kakitani M, Hasegawa H, Yamazaki Y, Ohguma A, Takeuchi Y, Fujita T, Fukumoto S, Tomizuka K, Yamashita T 2002 Targeted ablation of FGF-23 causes hyperphosphatemia, increased 1,25-dihydroxyvitamin D level and severe growth retardation [Abstract]. J Bone Miner Res 17:S168



This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
E. A. Imel, M. Peacock, P. Pitukcheewanont, H. J. Heller, L. M. Ward, D. Shulman, M. Kassem, P. Rackoff, M. Zimering, A. Dalkin, et al.
Sensitivity of Fibroblast Growth Factor 23 Measurements in Tumor-Induced Osteomalacia
J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2055 - 2061.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
T. J. Berndt, S. Schiavi, and R. Kumar
"Phosphatonins" and the regulation of phosphorus homeostasis
Am J Physiol Renal Physiol, December 1, 2005; 289(6): F1170 - F1182.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
T. O. Carpenter, B. K. Ellis, K. L. Insogna, W. M. Philbrick, J. Sterpka, and R. Shimkets
Fibroblast Growth Factor 7: An Inhibitor of Phosphate Transport Derived from Oncogenic Osteomalacia-Causing Tumors
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1012 - 1020.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nelson, A. E.
Right arrow Articles by Bligh, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nelson, A. E.
Right arrow Articles by Bligh, P. C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals