help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muench, M. O.
Right arrow Articles by Jaffe, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muench, M. O.
Right arrow Articles by Jaffe, R. B.
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 8 3921-3930
Copyright © 2003 by The Endocrine Society

Isolation of Definitive Zone and Chromaffin Cells Based upon Expression of CD56 (Neural Cell Adhesion Molecule) in the Human Fetal Adrenal Gland

Marcus O. Muench, Jennifer V. Ratcliffe, Mikiye Nakanishi, Hitoshi Ishimoto and Robert B. Jaffe

Department of Laboratory Medicine (M.O.M.) and Center for Reproductive Sciences (J.V.R., M.N., H.I., R.B.J.), Department of Obstetrics, Gynecology and Reproductive Sciences, University of California, San Francisco, San Francisco, California 94143

Address all correspondence and requests for reprints to: Marcus O. Muench, Ph.D., Department of Laboratory Medicine, University of California, San Francisco, 533 Parnassus Avenue, Room U-440, San Francisco, California 94143-0793. E-mail: muench{at}itsa.ucsf.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The cortex of the human midgestation adrenals comprises a thin layer of cells, the definitive zone (DZ) that surrounds the larger, inner fetal zone (FZ). CD56 expression was observed by immunohistochemistry on DZ cells and isolated groups of cells within the FZ. CD56 mRNA expression also was detected among DZ cells but not selected sections of FZ cells isolated by laser capture microdissection. Flow cytometric analysis of dispersed adrenal cells indicated CD56 expression on a subset of adrenal cells lacking expression of hematopoietic (CD45+ and CD235a+) and endothelial (CD31+) cell markers. The CD56+CD31-CD45-CD235a- cells were isolated by discontinuous-gradient centrifugation and fluorescence-activated cell sorting. The purified cells were enriched for DZ cells based on expression of mRNA for metallopanstimulin-1, nephroblastoma overexpressed gene, and 3-ß-hydroxysteroid dehydrogenase. P450c17 mRNA expression also was detected among a subset of CD56+ cells consistent with expression of low levels of this protein in some DZ cells. The presence of a subpopulation of chromaffin cells among the CD56+ population also was shown by the expression of chromogranin A mRNA. These findings indicate that CD56 expression can be used to isolate DZ and chromaffin cells to further study their functional and developmental properties.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
HUMAN TISSUES COMPRISE a large number of differentiated cell types that are integrated to form the structure and perform the specialized functions required of each tissue. Because many mature cells have lost the capacity to grow, replacement of mature cells that have died occurs in most tissues in response to developmental changes, the normal aging process, disease, or damage. Progenitors have been characterized in most tissues that have a limited capacity for growth and differentiation but are capable of renewal of specific cell types within tissues (1, 2, 3, 4, 5, 6). Stem cells, long known to exist for tissues such as the hematopoietic system, have been recently identified in many tissues (7, 8, 9). Stem cells are characterized by an extensive proliferative capacity and capable of differentiating into many cell types including, in some cases, cells foreign to their tissue of origin. Molecular and cytogenetic techniques are now revealing the processes that occur as stem cells and progenitors become specialized, fully differentiated cells. To characterize these events, markers for each cell type in the system are necessary.

Our interest is in understanding the developmental processes inherent in the human fetal adrenal gland. In the early stages of organ development, some fetal organs do not recapitulate the structural or functional organization of the adult. The human adrenal gland is exceptional in that the fetal structure persists throughout gestation and its functional adult organization does not occur until after birth. The human fetal adrenal also has diverged markedly from other mammals, with only some higher primates and few other animals (armadillo, sloth) having a similar adrenal architecture. Because the fetal adrenal gland is necessary for maintenance of intrauterine homeostasis, induction of enzymes in organs essential for extrauterine life and possibly involved in the initiation of parturition, elucidating fetal adrenal developmental biology, is of particular importance.

The human fetal adrenal gland arises from the coelomic ridge. Quite rapidly, three cell types are apparent: 1) a thin layer encapsulating the gland; 2) two to three cell layers of small, tightly packed basophilic cells; and 3) a large inner portion (>80% by volume) of large cells with lipid-filled vacuoles. These layers are the capsule, definitive zone (DZ) and fetal zone (FZ), respectively. Later in gestation, the transitional zone (TZ) will become apparent between the DZ and FZ (10). From early in development (6–8 wk), FZ cells express P450 side-chain cleavage enzyme (P450scc) and P450 17{alpha}-hydroxylase/17–20 lyase (P450c17). This complement of steroidogenic enzymes permits synthesis of large amounts of dehydroepiandrosterone and dehydroepiandrosterone sulfate. The cells lack 3-ß-hydroxysteroid dehydrogenase (3-ßHSD), however, and thus are not capable of synthesizing other steroid products independently. Rather, the dehydroepiandrosterone and dehydroepiandrosterone sulfate are converted to estrogens by the placenta in a unique cooperative effort between the placenta and fetus, the fetoplacental unit. In addition to P450c17 and P450scc, 3-ßHSD and P450c11 are expressed during the latter part of gestation in the TZ and DZ, and aldosterone synthase is expressed in the DZ close to term.

In contrast to the FZ, before the third trimester, the DZ cells express only P450scc and do not have the capacity to produce steroids (11). This has led to the hypothesis that this thin rim of cells may represent a progenitor population in the human fetal adrenal gland. We believe that these cells proliferate and differentiate first into cells of the FZ and later in gestation into cells of the TZ and FZ. Finally, just before birth some DZ cells take on characteristics of the adult zona glomerulosa and produce aldosterone. This hypothesis of DZ cells serving as progenitors is generally accepted yet lacks direct evidence. Recently, we used laser capture microdissection to isolate DZ cells (11). The cDNA library prepared from this relatively pure population of cells was used for subtractive hybridization to identify new markers unique to DZ and FZ cells. Expression of nephroblastoma overexpressed gene (NovH) and the gene for the ribosomal protein metallopanstimulin-1 (Mps-1) was found among DZ cells, whereas the low-density lipoprotein receptor gene (LDLR) was enriched among FZ cells (12). In the present study, we describe CD56 (neural cell adhesion molecule) to be a cell-surface marker on DZ cells, which can be used to isolate DZ cells by fluorescence-activated cell sorting (FACS). Expression of CD56 is extensive in developing neuronal and endocrine tissues, including the rat adrenal (13, 14, 15, 16) and also is expressed by NK cells and some T cells (17, 18). CD56 belongs to the Ig superfamily of adhesion molecules and plays a role in the morphogenesis of several organ systems including the liver (19, 20), pancreas (21, 22), and neuromuscular junction (23). Expression of CD56 has been noted in both developing fetal organ systems (20) and physiologic and regenerative processes in adults (24, 25). Its role in these processes has been suggested to range from altering migration to initiating differentiation and stimulation of signaling cascades. The use of this and other cell surface markers has allowed us to greatly enrich DZ cells for in vitro studies of adrenocortical cell differentiation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissues

Adrenals glands were obtained from human fetuses after therapeutic termination of pregnancy. This study was approved by the Committee on Human Research, University of California, San Francisco (UCSF). The gestational ages ranged from 15 to 24 wk. Adrenal glands were obtained and placed in PBS without Ca2+ or Mg2+ with 2% fetal bovine serum for cell separation experiments or placed in 4% paraformaldehyde when intended only for histological examination. Adrenals were kept on ice for transport to the laboratory.

Antibodies

The following fluorescein isothiocyanate (FITC) and phycoerythrin (PE) labeled monoclonal antibodies (mAbs) were purchased from BD Biosciences (San Jose, CA): CD31-FITC (WM59), CD56-PE (MY31), mouse IgG1-FITC, mouse IgG2a-FITC, and mouse IgM-FITC. CD56-FITC and CD56-PE (C5.9) were purchased from Exalpha Corp. (Boston, MA). CD45-PE (HI30), mouse IgG1-FITC, mouse IgG1-PE, mouse IgG2a-PE, mouse IgG2b-FITC, and mouse IgM-FITC were purchased from Caltag (Burlingame, CA). The following conjugated mAbs were purchased from Beckman-Coulter (Miami, FL): CD31-PE (1F11), CD34-FITC (581), CD36-FITC (FA6.152), CD45-FITC (KC56), CD235a-FITC (11E4B-7–6), and CD235a-PE (11E4B-7–6). Polyclonal rabbit anticytochrome P450c17 antibody was kindly provided by Dr. Walter Miller (UCSF) (26). Polyclonal sheep antihuman CD31 was obtained from Research and Diagnostic Systems Inc. (Minneapolis, MN) and used for the confocal microscopy experiments.

Immunohistochemistry

Fetal adrenal glands were placed in 4% paraformaldehyde overnight, followed by incubation in 30% sucrose in PBS at 4 C overnight. Tissues were then embedded in Tissue-Tek OCT compound from Sakura Finetek (Torrance, CA) and frozen in a dry ice ethanol bath. Samples were stored at -80 C until use. Ten-micrometer sections were prepared and used for immunofluorescence.

Tissue sections were processed according to the method of Basora et al. (27). Autofluorescence was prevented by incubating sections in 0.02 M glycine in PBS with or without 0.1–0.3% Triton X-100, 10% nonfat milk for 30 min, and 10% goat or donkey serum for 30 min. Primary antibody incubation was performed with 1:10 dilutions of FITC-conjugated CD31, CD34, CD36, or CD56 mAbs or a 1:300 dilution of anti-P450c17 for 1 h at room temperature. After washing, incubation with a fluorochrome-labeled secondary antibody was performed at room temperature for 30 min with either Cy3-conjugated goat antimouse or goat antirabbit antibody (Jackson Laboratories, West Grove, PA) for single color immunohistochemical studies. For the confocal microscopy experiments, FITC-conjugated goat antimouse antibody (Jackson Laboratories) was used to detect CD56 staining, and Cy3-conjugated goat antirabbit was used to detect anti-P450c17 antibody. Cy5-conjugated donkey antisheep antibody (Jackson Laboratories) was used in the confocal microscopy experiments to detect antibody bound to CD31. After washing, slides were mounted with Vectorshield (Vector Laboratories, Inc., Burlingame, CA) and examined with a DMR fluorescent microscope (Leica, Quèbec, Canada) and a HQ-TRITC filter (Chroma, Brattleboro, VT). Pictures were taken with a DCS 430 digital camera (Eastman Kodak Co., Rochester, NY) and transferred to Adobe Photoshop software (Adobe Systems Inc., San Jose, CA). Confocal microscopy was performed using a 510 META laser-scanning microscope (Carl Zeiss Inc., Jena, Germany). Control sections were stained with unconjugated mouse or rabbit IgG or with FITC-conjugated mouse IgG. Background staining using these controls under the conditions described was minimal.

Laser capture microdissection

Laser capture microdissection was performed as described previously (12), using the Pixcell II (Arcturus Engineering, Mountain View, CA).

Preparation of RNA, RT-PCR, and real-time quantitative RT-PCR

RNA was prepared by one of two methods chosen by estimating the amount of RNA to be extracted. For quantities of approximately 5 µg, Mini RNeasy (QIAGEN, Valencia, CA) was used according to the manufacturer’s instructions, followed by use of DNA-Free from Ambion (Woodward, TX). For quantities less than 5 µg, a mini-RNA isolation kit (Zymo Research, Orange, CA) was used as instructed, followed by their DNA-Free RNA kit. Before RT of the RNA, samples were shown to be free of DNA by a RT-PCR reaction using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) oligonucleotides. RT with random primers was carried out with M-MLV reverse transcriptase (Invitrogen Corp., Carlsbad, CA).

The following sense (antisense) oligonucleotides were used: GAPDH, GATGACATCAAGAAGGTGGTG (CTCCTTGGAGGCCATGTGGGCCAT); NovH, CTAAGTGGACTGGTGTCATAAC (ATTTGAAACAGCTATCAGAGGG); Mps-1, GATCTCCTTCATCCCTCTCC (GTTTCCCACTCATCTTGACTC); P450c17, CTTCAAGCTGCAGAAAAAATATGG (CAATGTACTGATTTCCTGACAAAT); 3-ßHSD, CCTCACCAAAGCTATGATAACC (TCCTAACAATACCCACATGCAC); LDLR, TCTAAGCCAAACCCCTAAACTC (CAACACACACGACAGAAAACAG); CD31, TCACCATCCAGAAGGAAGATAC (ACCCTCAGAACCTCACTTAAC); CD56, TATTTGCCTATCCCAGTGCC (CATACTTCTTCACCAACTGCTC); CD90, GCTGCTTCTGTCTGGTTTATTTAG (CCTCATCCTTTACCTCCTTCTC); and Chromogranin A (Chr-A) CATCTCCGACACACTTTCCAAG (TCCTCTCTTTTCTCCATAACATCC). All oligonucleotides were purchased from Sigma-Genosys (The Woodlands, TX), and each oligonucleotide was used at 10 pm/µl in conjunction with Ready-To-Go PCR beads (Amersham Biosciences Corp. Piscataway, NJ) for 35 cycles as recommended. RT-PCR was performed on a Gene Amp PCR System 9600 (Perkin-Elmer, Boston, MA).

Expression of 3-ßHSD CD56-lin-, CD56+lin- cells was further analyzed using the 5' nuclease assay (real-time TaqMan RT-PCR) as we have described previously (28). Relative expression levels were calculated as 2-(Ct 3-ßHSD - Ct GAPDH) using GAPDH as an endogenous control gene. Sequences for the PCR primers and TaqMan probes were: 3-ßHSD forward, TCACAGAGAGTCCATCATGAATGTC; reverse, CGGCTACCTCTATGCTACTGGTGTA; TaqMan probe, FAM(6-carboxy-fluorescein)-TGAAAGGTACCCAGCTACTGTTGGAGGC-TAMRA(6-carboxy-tetramethyl-rhodamine) (Integrated DNA Technologies, Coralville, IA); GAPDH forward, ATTCCACCCATGGCAAATTC; reverse, TGGGATTTCCATTGATGACAAG; TaqMan probe, FAM-ATGGCACCGTCAAGGCTGAGAACG-TAMRA (Integrated DNA Technologies).

Isolation of human fetal adrenal cells

Fetal adrenals were mechanically dispersed and then treated with 3 µg/ml Liberase Blendzyme 2 (Roche Molecular Biochemicals, Indianapolis, IN) at 37 C for 20 min. Cells were filtered into media containing 10% fetal bovine serum to remove aggregates and then concentrated by centrifugation. The cells were then suspended in 3 ml PBS supplemented with 0.3% BSA and 0.01% NaN3 and overlaid on 7 ml NycoPrep 1.077 (Greiner-Bio-One, Inc., Longwood, FL), centrifuged for 25 min at 600 x g at room temperature. The light-density fraction on top of the NycoPrep solution was collected and washed twice in PBS with 0.3% BSA and 0.01% NaN3 (PBS/BSA) and then held overnight in PBS with 10% goat serum and 0.01% NaN3 at 4 C.

Flow cytometric analysis of cell surface markers

Approximately 2 x 105 cells suspended in up to 200 µl blocking buffer were incubated in 96-well Costar V-bottom plates (Corning Inc., Corning, NY) with saturating amounts of mAbs on ice for at least 30 min. Cells were washed twice with 250 µl PBS/BSA. The washed cells were suspended in PBS/BSA containing 2 µg/ml propidium iodide (PI), purchased from Molecular Probes (Eugene, OR). PI was used to stain dead cells so that they could be excluded from the FACS analysis. Flow cytometric analyses were performed using either a FACScan or FACSCalibur flow cytometer (BD Biosciences). Analyses of results were performed using CellQuest software (BD Biosciences).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunohistochemical analysis of CD56 expression in the human fetal adrenal gland

CD56 was expressed on cells from human fetal adrenal glands ranging in gestational age from 10 to 24 wk. In all cases, the pattern of CD56 expression was as a band of cells immediately below the capsule of the adrenal (Fig. 1Go, A and B) corresponding to the DZ (Fig. 2AGo). Human P450c17, which is highly expressed in the FZ (10, 29), was analyzed as a positive marker of FZ cells using an anti-P450c17 antibody kindly provided by Dr. Walter Miller (Fig. 1CGo) (26). DZ cells reacted minimally with anti-P450c17 antibody, although some isolated cells in the DZ demonstrated staining. Additionally, isolated pockets of bright CD56 staining were observed within the FZ (Fig. 1AGo).



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 1. CD56 and P450c17 protein expression in the human fetal adrenal. Immunofluorescence of a 17-wk gestation human fetal adrenal showing CD56 staining of a complete section of fetal adrenal (A). Note the band of staining corresponding to the DZ and islands of expression within the FZ (B). The FZ is demarked using P450c17 immunofluorescence in a 19-wk gestation fetal adrenal (C).

 


View larger version (46K):
[in this window]
[in a new window]
 
FIG. 2. Gene expression in the DZ and FZ. A schematic illustration of the morphology of the human fetal adrenal is shown in A. Cells from the DZ and FZ of a 22-wk gestation fetal adrenal were captured using laser microscopy, and RT-PCR was used to determine the presence of mRNA for CD56 and a panel of genes expressed in fetal adrenal tissue (B).

 
Analysis of gene expression on definitive and fetal zone cells isolated by laser capture microdissection

To confirm the expression of CD56 by DZ cells, CD56 mRNA expression was assessed in DZ and FZ cells. Laser microdissection was used to isolate cells from the FZ and DZ (Fig. 2AGo), and RT-PCR was then used to assess CD56 mRNA expression. In two experiments, CD56 mRNA was found expressed in DZ cells but not in FZ cells (Fig. 2BGo). A similar pattern of expression was observed for mRNA encoding the genes Mps-1, the growth regulatory protein NovH, and CD90 (Thy-1). Mps-1 and NovH are expressed primarily by DZ cells (30). CD90 expression is found on a variety of cell types including neurons, chromaffin cells, hematopoietic stem cells, and connective tissue (16, 31, 32, 33, 34). Interestingly, P450c17 mRNA was detected among DZ cells.

Analysis of CD56 and P450c17 expression by confocal microscopy

The expression of P450c17 by some DZ cells was confirmed by dual staining of fetal adrenal sections for CD56 and P450c17, followed by confocal microscopy. Consistent with the results in Fig. 1Go, low-power examination of the fetal adrenal reveals that most staining for CD56 and P450c17 is mutually exclusive and serves to demarcate the DZ and FZ, respectively (Fig. 3AGo). However, examination at higher magnification revealed that some cells coexpress CD56 and P450c17 (Fig. 3Go, B–E). These cells typically were observed bordering the FZ and not the capsule. The intensity of the cell-surface CD56 staining and the cytoplasmic P450c17 staining also appeared to be reduced in some of these cells, suggesting that they have an intermediate phenotype between the CD56+P450c17- DZ cells and the CD56-P450c17+ FZ cells.



View larger version (146K):
[in this window]
[in a new window]
 
FIG. 3. Expression of both CD56 and P450c17 proteins by DZ cells bordering the FZ. Confocal microscopy was used to view sections of fetal adrenals stained for CD56 (green) and P450c17 (red) protein (all panels). A low-power view spanning the DZ and FZ is shown (A). CD31 expression was also stained in this one sample indicating the presence of endothelial cells lacking CD56 or P450c17 protein expression (white, arrowhead). Higher-magnification pictures reveal costaining for CD56 on the membrane (green) and P450c17 protein in the cytoplasm (red) of cells in three separate experiments (B–E, arrowheads). CD31 staining was not performed in B–E.

 
Flow cytometric analysis of CD56 expression on fetal adrenal cells

CD56 expression on the surface of adrenal cells was analyzed in fetal specimens ranging in age from 15 to 24 wk of gestation. Background fluorescence indicated the presence of diverse cell populations in the adrenal cell preparations (Fig. 4AGo). This also was apparent in the analysis of forward and side light scatter, which indicated the presence of a large number of small- to medium-sized cells of moderate complexity (Fig. 4BGo). Larger and more complex cells, with higher forward and side light scatters, also were observed. These cells were also responsible for the population of cells with the high background fluorescence (>101 fluorescence) seen in Fig. 4AGo. Because CD56 is expressed on NK cells found in peripheral blood (35), the adrenal samples also were stained for CD45 and CD235a (Fig. 4CGo), markers found exclusively on leukocytes and erythrocytes, respectively (36, 37). Together, CD45 and CD235a stained 66% of the isolated adrenal cells and accounted for the majority of small- to medium-sized cells with low side light scatter (Fig. 4DGo).



View larger version (56K):
[in this window]
[in a new window]
 
FIG. 4. Flow cytometric analysis of CD56 expression by human fetal adrenal cells. Representative results from the analysis of a 19-wk gestation fetus are shown. Background fluorescence obtained with staining using the nonspecific mAb indicated is shown (A). The forward and side light scatter profile of the entire adrenal cell preparation is shown (B). Hematopoietic cells are stained with CD45 and CD235a (C), and the forward and side light scatter profile of these gated cells is shown (D). CD56 expression by nonhematopoietic cells is shown (E), and the forward and side light scatter profiles of the gated regions are shown (F–H).

 
CD56 expression was detected on 14% of the nonhematopoietic cells as seen in Fig. 4EGo. These CD56+ cells varied in size and complexity, as indicated in Fig. 4Go, F and G. Accordingly, the gated CD56+ population in Fig. 2EGo appears to represent a mixture of small cells with low background fluorescence (Fig. 4GGo) and larger cells with high background fluorescence (Fig. 4FGo). The smaller CD56+ cells represent 0.9% of the total cell population, whereas the larger cells comprised the remaining 13% of nonhematopoietic CD56+ cells. The larger gated population does not appear to be of hematopoietic origin because its levels of CD45/CD235a expression are below those of hematopoietic cells, as seen in Fig. 4CGo, and the presence of these large CD56+ cells corresponds to a decrease in the CD56-CD45-CD235a- cells, indicated by the elliptical region seen in Fig. 4EGo. Because DZ cells are smaller than FZ cells, we focused on isolating DZ cells on small CD56+CD45-CD235a- cells.

Flow cytometric and immunohistochemical analysis of endothelial cell markers in the fetal adrenal gland

We speculated that our adrenal cell preparation also was likely to contain endothelial cells in addition to the other cell types present. Three markers associated with endothelial cells were analyzed to determine their pattern of expression on hematopoietic and CD56+ cells in the fetal adrenal. The following markers were analyzed: CD31 (platelet endothelial cell adhesion molecule-1), CD34, and CD36 (thrombospondin receptor). Flow cytometric analyses identified CD31+, CD34+, and CD36+ populations in the adrenal cell preparations that were not of hematopoietic origin and, thus, likely represented endothelial cells (Fig. 5Go, A, D, and G). Note that each of these markers is expressed by some hematopoietic cells and that such expression was evident in our analyses. The indicated CD31+, CD34+, and CD36+ populations (arrows in Fig. 5Go, A, D, and G) represented 6%, 8%, and 19% of all cells, respectively. Analyses of CD31, CD34, and CD36 expression on CD56+ cells indicated that most CD56+ cells were negative for these markers although some CD34+CD56+ and CD36+CD56+ cells may exist (Fig. 5Go, B, E, and H). There was no overlap, however, between the CD31+ and the CD56+ cell populations. The patterns of expression by immunohistochemistry of each of these markers were similar to those seen in Fig. 5Go, C, F, and I. These markers stained cells and vessels in the capsule as well as cells dispersed in the DZ. However, the pattern of expression was consistent with staining of the vasculature, in particular the circular patterns associated with vessel cross-sections. There was no pattern of expression suggesting that DZ cells bound CD31, CD34, or CD36. This was further confirmed by a three-color analysis of adrenals stained for CD56, P450c17, and CD31 and analyzed by confocal microscopy (Fig. 3AGo). CD31 expression (white color) did not overlap with cells that expressed CD56 or P450c17. These data, therefore, indicated that CD31 can be used to deplete adrenal cell preparations of endothelial cells without depletion of the CD56+ DZ cells.



View larger version (103K):
[in this window]
[in a new window]
 
FIG. 5. Expression of endothelial cell markers by human fetal adrenal cells. Flow cytometric analysis of a 19-wk gestation adrenal indicated the presence of CD31+, CD34+, and CD36+ cells that were not of hematopoietic origin (arrows, A, D, and G). Staining with CD56 and CD31, CD34, or CD36 indicated the existence of distinct populations of CD56+ cells and the three endothelial cell populations (B, E, and H). However, possible CD34+CD56+ and CD36+CD56+ cells were also observed (arrows, E and H). Immunohistochemical staining with the three endothelial cell markers, CD31, CD34, and CD36, reveals similar patterns of expression on a 21-wk gestation adrenal (C, F, and I). The adrenal capsule is at the top of these three panels, with an intensely stained vessel in cross-section (C and F but less so for I). A section of DZ with intermittent staining is shown below the capsule in the lower portion of the pictures.

 
Isolation of an enriched population of DZ cells by flow cytometry

Discontinuous-gradient centrifugation was tested to determine whether CD56+ adrenal cells could be enriched by this technique. Dissociated adrenal cells were centrifuged over a 1.077 g/ml layer of NycoPrep and the light-density cells recovered. From 4.2 x 106 to 7.8 x 106 cells were recovered per gland by the dissociation procedure in three experiments using 23- and 24-wk gestation tissues. The light-density fraction recovered represented 0.6% to 3.6% of starting cell population. The discarded high-density fraction contained the majority of erythrocytes as well as other cell types and debris. The light-density fraction contained 48% CD56+ cells, which was an approximate 5-fold enrichment over the total cell population (data not shown). Because density separation was an effective means of enriching CD56+ adrenal cells, this technique was used to enrich for DZ cells before staining with mAbs and FACS.

To isolate an enriched population of DZ cells, light-density adrenal cells were stained with CD56-PE, CD31-FITC, CD45-FITC, and CD235a-FITC. Live cells, based on the lack of PI staining, were isolated as shown in Fig. 6Go. These live cells were further depleted of CD31+CD45+CD235a+ cells, resulting in a population collectively called lineage- (lin-) cells. Two cell populations were isolated based on the presence of absence of CD56 expression. The recovery of CD56+lin- cells from 23- and 24-wk gestation tissues ranged from 1.3 x 104 to 4.1 x 104 cells/adrenal gland (n = 3). The recovery of CD56-lin- cells was similar. There was no apparent contamination of the CD56-lin- cell population by CD56+ cells based on CD56 mRNA expression (Fig. 7Go). However, a low level of CD31 gene expression was detected in both sorted populations likely caused by either modest contamination of the sorted cell populations or CD31 gene expression in the sorted cell populations without cell-surface expression of the CD31 protein.



View larger version (57K):
[in this window]
[in a new window]
 
FIG. 6. Isolation of subpopulations of human fetal adrenal cells by FACS. Representative examples of the regions used to isolate CD56+lin- and CD56-lin- cells from a 24-wk gestation adrenal are shown. First, live cells were selected by their lack of staining with PI as shown (A). CD56+lin- cells were isolated using a region 1 (R1), which selected cells expressing high levels of CD56 and a complete lack of lin antigens (CD31, CD45, and CD235a). A second subpopulation of adrenal cells was also isolated based on the lack of staining of all four markers (region 2, R2) (B). The light-scatter profiles of cells in regions 1 and 2 are shown (C and D, respectively).

 


View larger version (34K):
[in this window]
[in a new window]
 
FIG. 7. Analysis of mRNA expression by CD56+lin- and CD56-lin- human fetal adrenal cells. RT-PCR products of nycoll-treated presort and two sorted fractions, CD56+lin- and CD56-lin-, are shown.

 
The profile of gene expression by the sorted cell populations was consistent with the contention that the CD56+lin- population is enriched for DZ cells. The CD56+lin- cell population contained mRNA for the DZ markers NovH, Mps-1, and 3-ßHSD (Fig. 7Go). The levels of 3-ßHSD mRNA were also quantified using real-time RT-PCR (data not shown). Before FACS, 3-ßHSD expression was at 2.9% of the levels of GAPDH expression. Relative 3-ßHSD expression was 3.4-fold higher (9.9% of GAPDH expression) in the isolated CD56+lin- cells. Relative 3-ßHSD expression in the CD56-lin- fraction was reduced to 0.2% of GAPDH expression. In addition, a lower level of NovH and Mps-1 was also observed in the CD56-lin- fraction, which is consistent with this cell population likely being enriched for FZ cells (Fig. 7Go). Chr-A mRNA, associated with fetal chromaffin cells (38, 39), also was detected in the CD56+lin- fraction. P450c17 and LDLR gene expression was detected in both sorted fractions. The expression of P450c17 was studied further by analyzing protein expression by immunohistochemistry. CD56+lin- cells were tested for P450c17 protein expression in three experiments. In situ staining of CD56+lin- cells indicated 11–13% of these cells bound anti-P450c17 antibody (n = 3; data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have hypothesized that DZ cells represent a progenitor population of the human fetal adrenal gland. Our eventual goal is to provide direct evidence for the centripetal migration of DZ adrenal cells to populate the remainder of the cortex, i.e. to demonstrate that cells from the outer DZ differentiate into cells of the underlying zones as they migrate inward. Studies support this hypothesis indirectly. Chimeric gene expression analysis in the rat and mouse revealed clonal bands of cells extending from the innermost cell layers to the capsule (40, 41). Furthermore, in the adult rat, a zone of cells was identified that lacked steroid enzyme expression and presumably is a progenitor cell population (42). The strongest evidence for the DZ cell population functioning as progenitors would be the demonstration that these cells can grow and differentiate, either in vivo or in vitro, into mature FZ cells. This requires that the DZ cells can be isolated, with a high degree of purity, for such studies to be undertaken.

To date, DZ cells in the human fetal adrenal gland have been identified only by their location within the gland or by their lack of expression of steroidogenic enzymes. Our ongoing aim has been to identify unique markers for these cells to use as tools for the purification and characterization of the DZ cells. Recently, we used subtractive hybridization of RNA from cells prepared by laser capture microdissection to define novel markers unique to DZ cells in the fetal adrenal gland (12). The present study extends this effort by describing CD56 as a cell surface marker for DZ cells. We identified this marker through an extensive series of phenotyping experiments using FACS. We have shown that CD56 is expressed on a cell population of small, dense, low side scatter cells that lack markers of hematopoietic origin (CD31, CD34 and CD235a). This cell population is enriched for cells expressing known markers of DZ cells, NovH and Mps-1. Thus, we believe we have isolated a highly enriched DZ cell population.

The CD56+lin- cell pool also contains mRNA for P450c17, which is a steroid enzyme abundantly expressed in TZ and FZ cells (10, 29). However, RT-PCR, as was employed in our study, is a very sensitive but minimally quantitative technique and can detect very low levels of mRNA. Therefore, we quantified the percentage of P450c17+ cells in the purified cell pool by immunofluorescence. P450c17 protein was detected in 11–13% of the sorted cell population, which accounts for the strong signal in the RT-PCR experiments. Moreover, using confocal microscopy some cells expressing P450c17 were visible among the CD56+ DZ cells. The pattern of expression observed suggests that these cells may represent a differentiating cell population that has not yet migrated centripetally. The presence of these cells lends credence to the concept of the DZ cells serving as a progenitor population. If one cell truly is the progenitor of another, an intermediate cell likely exists that expresses some markers from both the progenitor and mature cell types. Further investigation of human fetal adrenocortical cells likely will lead to the description of other markers that can be used to further purify and subdivide the DZ population. These CD56+P450c17+ cells can then be better characterized regarding their status as maturing FZ cells.

Some CD56+lin- cells also express Chr-A, a marker for chromaffin cells. Previous studies have indicated CD56 expression on chromaffin cells in the developing rat adrenal (43, 44). Chromaffin cells are a major component of the adrenal medulla and produce catecholamines. Traditionally, the adrenal medulla and cortex are thought of as two functionally and structurally distinct entities coexisting within the adrenal capsule. However, data have accumulated indicating that glucocorticoids produced by adrenal cortical cells can influence medullary function (45). Cortisol is known to stimulate phenylethanolamine-N-methyltransferase, the enzyme that catalyzes the conversion of norepinephrine to epinephrine in the adrenal medulla. Teleologically, it may not be coincidence that the adrenal cortex, the site of cortisol synthesis, envelops the adrenal medulla, as suggested by Wurtman and Axelrod (46). Neuronal processes have been noted that extend from medullary neurons to cells within all three zones of the cortex (47). During human intrauterine life, we found that a well-formed medulla is not present before birth (48). Rather, there are scattered chromaffin cells throughout the fetal adrenal gland that express phenylethanolamine-N-methyltransferase, the enzyme that converts norepinephrine to epinephrine. Furthermore, close apposition of adrenocortical and medullary cells was noted by others. Nests of chromaffin cells have been found throughout the human adrenal cortex, particularly in subcapsular locations, in both the adult (49) and fetus (50). In fact, chromaffin cells are scattered in clusters, or nests, in the fetal adrenal gland because a more structurally distinct medulla does not form until after birth (51). These findings are consistent with the pattern of CD56 expression we observed in this study, which indicated islands of CD56+ cells found within the FZ. Thus, it is not surprising to find some evidence of similar gene expression in adrenocortical and medullary cells. Experiments are underway to identify cell surface molecules that can be used to separate chromaffin cells from the DZ cells. Alternatively, chromaffin cells are not adherent to tissue culture plates and, thus, may be eliminated from cultures by washing (52).

CD56 (neural cell adhesion molecule) is an adhesion molecule that has been extensively studied in diverse tissues. Its role in axonal growth, migration, and guidance has been examined in detail (15, 53). In vitro antibody perturbation and mutational studies have established the role of CD56 as a regulator of neuronal growth, and it is essential for proper neuronal patterning. CD56 expression was originally thought to be confined to neuronal and neuroendocrine tissues. However, when multiple alternatively spliced isoforms of CD56 were recognized and new antibodies generated, expression was noted in other tissues, most notably endocrine organs (54, 55). Rat pituitary cells (54), human thyrocytes (56), and human adrenocortical cells (57) all express CD56. Interestingly, the adult adrenal gland expresses CD56 primarily in the zona glomerulosa (57). Late in gestation, the DZ, which also is immediately beneath the capsule, is analogous to the zona glomerulosa in that it begins to express steroidogenic enzymes and produce aldosterone (10).

CD56 is expressed by cells in as many as 20–30 different forms. Alternate splicing from a single gene accounts for most of this variability, but posttranslational modification plays a lesser role (58). Several groups have noted the 140-kDa isoform in endocrine tissues, but the 180-kDa isoform is more common in neuronal tissue (59, 60, 61). The 140-kDa isoform, when expressed in glioma cells, decreased cell motility to a greater extent than the 180-kDa isoform (62). Further investigation into CD56 isoform expression in the fetal adrenal and its potential role in cell migration is warranted. It is possible that cells in the DZ express the 140-kDa isoform of CD56 until differentiation has progressed to the point at which migration into other zones is necessary. Then, as CD56 expression is altered or decreases, the cells begin to migrate inward and differentiate into cells of the TZ or FZ.

In conclusion, the method developed in this study for the isolation of DZ cells is an important step toward the detailed molecular analysis of the events involved in the cellular development of the human fetal adrenal. The development of a reproducible, rapid isolation method is critical to obtain highly pure cells, which can now be studied in vitro. We plan to use this method to explore the role of CD56+ DZ cells in the development of the human fetal adrenal gland.


    Acknowledgments
 
We are indebted to Dr. Walter Miller for providing antibody recognizing P450c17 and Dr. Yuet Wai Kan for his generous support. We also thank Paul Dazin (Howard Hughes Medical Institute, UCSF) and Jane Gordon (Laboratory for Cell Analysis, UCSF) for assistance with cell sorting and confocal microscopy.


    Footnotes
 
This work was supported in part by NIH Grants DK59301 (to M.O.M.) and HD08478 (to R.B.J.). J.R. is the recipient of a fellowship from the Endocrine Fellows Foundation.

M.O.M. and J.V.R. contributed equally to this work.

Abbreviations: Chr-A, Chromogranin A; DZ, definitive zone; FACS, fluorescence-activated cell sorting; FITC, fluorescein isothiocyanate; FZ, fetal zone; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; 3-ßHSD, 3-ß-hydroxysteroid dehydrogenase; LDLR low-density lipoprotein receptor; lin-, lineage-; mAb, monoclonal antibody; Mps-1, metallopanstimulin-1; NovH, nephroblastoma overexpressed gene; PE, phycoerythrin; PI, propidium iodide; P450scc, P450 side-chain cleavage enzyme; TZ, transitional zone.

Received January 30, 2003.

Accepted April 25, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Moore MAS, Muench MO, Warren DJ, Laver J 1990 Cytokine networks involved in the regulation of haemopoietic stem cell proliferation and differentiation. In: Molecular control of haemopoiesis. Chichester, UK: John Wiley and Sons; 43–58
  2. Risbud MV, Bhonde RR 2002 Models of pancreatic regeneration in diabetes. Diabetes Res Clin Pract 58:155–165[CrossRef][Medline]
  3. Marshman E, Booth C, Potten CS 2002 The intestinal epithelial stem cell. Bioessays 24:91–98[CrossRef][Medline]
  4. Oh SH, Hatch HM, Petersen BE 2002 Hepatic oval ‘stem’ cell in liver regeneration. Semin Cell Dev Biol 13:405–409[CrossRef][Medline]
  5. Chmielnicki E, Goldman SA 2002 Induced neurogenesis by endogenous progenitor cells in the adult mammalian brain. Prog Brain Res 138:451–464[Medline]
  6. Laywell ED, Steindler DA 2002 Glial stem-like cells: implications for ontogeny, phylogeny, and CNS regeneration. Prog Brain Res 138:435–450[Medline]
  7. Verfaillie CM 2002 Adult stem cells: assessing the case for pluripotency. Trends Cell Biol 12:502–508[CrossRef][Medline]
  8. Shafritz DA, Dabeva MD 2002 Liver stem cells and model systems for liver repopulation. J Hepatol 36:552–564[CrossRef][Medline]
  9. Bonner-Weir S, Sharma A 2002 Pancreatic stem cells. J Pathol 197:519–526[CrossRef][Medline]
  10. Mesiano S, Coulter CL, Jaffe RB 1993 Localization of cytochrome P450 cholesterol side-chain cleavage, cytochrome P450 17 alpha-hydroxylase/17, 20-lyase, and 3 beta-hydroxysteroid dehydrogenase isomerase steroidogenic enzymes in human and rhesus monkey fetal adrenal glands: reappraisal of functional zonation. J Clin Endocrinol Metab 77:1184–1189[Abstract]
  11. Coulter CL, Goldsmith PC, Mesiano S, Voytek CC, Martin MC, Mason JI, Jaffe RB 1996 Functional maturation of the primate fetal adrenal in vivo. II. Ontogeny of corticosteroid synthesis is dependent upon specific zonal expression of 3 beta-hydroxysteroid dehydrogenase/isomerase. Endocrinology 137:4953–4959[Abstract]
  12. Ratcliffe JV, Nakanishi M, Jaffe RB 2003 Identification of definitive and fetal zone markers in the human fetal adrenal gland reveals putative developmental genes. J Clin Endocrinol Metab, 88:3272–3277
  13. Thiery JP, Duband JL, Rutisauser U, Edelman GM 1982 Cell adhesion molecules in early chicken embryogenesis. Proc Natl Acad Sci USA 79:6737–6741[Abstract/Free Full Text]
  14. Rutishauser U 1984 Developmental biology of a neural cell adhesion molecule. Nature 310:549–554[CrossRef][Medline]
  15. Ronn LC, Hartz BP, Bock E 1998 The neural cell adhesion molecule (NCAM) in development and plasticity of the nervous system. Exp Gerontol 33:853–864[CrossRef][Medline]
  16. Poltorak M, Shimoda K, Freed WJ 1990 Cell adhesion molecules (CAMs) in adrenal medulla in situ and in vitro: enhancement of chromaffin cell L1/Ng-CAM expression by NGF. Exp Neurol 110:52–72[CrossRef][Medline]
  17. Hercend T, Griffin JD, Bensussan A, Schmidt RE, Edson MA, Brennan A, Murray C, Daley JF, Schlossman SF, Ritz J 1985 Generation of monoclonal antibodies to a human natural killer clone. Characterization of two natural killer-associated antigens, NKH1A and NKH2, expressed on subsets of large granular lymphocytes. J Clin Invest 75:932–943
  18. Lanier LL, Testi R, Bindl J, Phillips JH 1989 Identity of Leu-19 (CD56) leukocyte differentiation antigen and neural cell adhesion molecule. J Exp Med 169:2233–2238[Abstract/Free Full Text]
  19. Fabris L, Strazzabosco M, Crosby HA, Ballardini G, Hubscher SG, Kelly DA, Neuberger JM, Strain AJ, Joplin R 2000 Characterization and isolation of ductular cells coexpressing neural cell adhesion molecule and Bcl-2 from primary cholangiopathies and ductal plate malformations. Am J Pathol 156:1599–1612[Abstract/Free Full Text]
  20. Libbrecht L, Cassiman D, Desmet V, Roskams T 2001 Expression of neural cell adhesion molecule in human liver development and in congenital and acquired liver diseases. Histochem Cell Biol 116:233–239[Medline]
  21. Gaidar YA, Lepekhin EA, Sheichetova GA, Witt M 1998 Distribution of N-cadherin and NCAM in neurons and endocrine cells of the human embryonic and fetal gastroenteropancreatic system. Acta Histochem 100:83–97[Medline]
  22. Esni F, Taljedal IB, Perl AK, Cremer H, Christofori G, Semb H 1999 Neural cell adhesion molecule (N-CAM) is required for cell type segregation and normal ultrastructure in pancreatic islets. J Cell Biol 144:325–337[Abstract/Free Full Text]
  23. Walsh FS, Hobbs C, Wells DJ, Slater CR, Fazeli S 2000 Ectopic expression of NCAM in skeletal muscle of transgenic mice results in terminal sprouting at the neuromuscular junction and altered structure but not function. Mol Cell Neurosci 15:244–261[CrossRef][Medline]
  24. Perl AK, Dahl U, Wilgenbus P, Cremer H, Semb H, Christofori G 1999 Reduced expression of neural cell adhesion molecule induces metastatic dissemination of pancreatic beta tumor cells. Nat Med 5:286–291[CrossRef][Medline]
  25. Libbrecht L, De Vos R, Cassiman D, Desmet V, Aerts R, Roskams T 2001 Hepatic progenitor cells in hepatocellular adenomas. Am J Surg Pathol 25:1388–1396[CrossRef][Medline]
  26. Lin D, Black SM, Nagahama Y, Miller WL 1993 Steroid 17 alpha-hydroxylase and 17, 20-lyase activities of P450c17: contributions of serine106 and P450 reductase. Endocrinology 132:2498–2506[Abstract/Free Full Text]
  27. Basora N, Vachon PH, Herring-Gillam FE, Perreault N, Beaulieu JF 1997 Relation between integrin alpha7Bbeta1 expression in human intestinal cells and enterocytic differentiation. Gastroenterology 113:1510–1521[CrossRef][Medline]
  28. Geva E, Ginzinger DG, Zaloudek CJ, Moore DH, Byrne A, Jaffe RB 2002 Human placental vascular development: vasculogenic and angiogenic (branching and nonbranching) transformation is regulated by vascular endothelial growth factor-A, angiopoietin-1, and angiopoietin-2. J Clin Endocrinol Metab 87:4213–4224[Abstract/Free Full Text]
  29. Hanley NA, Rainey WE, Wilson DI, Ball SG, Parker KL 2001 Expression profiles of SF-1, DAX1, and CYP17 in the human fetal adrenal gland: potential interactions in gene regulation. Mol Endocrinol 15:57–68[Abstract/Free Full Text]
  30. Martinerie C, Gicquel C, Louvel A, Laurent M, Schofield PN, Le Bouc Y 2001 Altered expression of novH is associated with human adrenocortical tumorigenesis. J Clin Endocrinol Metab 86:3929–3940[Abstract/Free Full Text]
  31. Morris R 1985 Thy-1 in developing nervous tissue. Dev Neurosci 7:133–160[Medline]
  32. Craig W, Kay R, Cutler RL, Lansdorp PM 1993 Expression of Thy-1 on human hematopoietic progenitor cells. J Exp Med 177:1331–1342[Abstract/Free Full Text]
  33. Kennedy PG, Lisak RP, Raff MC 1980 Cell type-specific markers for human glial and neuronal cells in culture. Lab Invest 43:342–351[Medline]
  34. Muench MO, Cupp J, Polakoff J, Roncarolo MG 1994 Expression of CD33, CD38 and HLA-DR on CD34+ human fetal liver progenitors with a high proliferative potential. Blood 83:3170–3181[Abstract/Free Full Text]
  35. Lanier LL, Chang C, Azuma M, Ruitenberg JJ, Hemperly JJ, Phillips JH 1991 Molecular and functional analysis of human natural killer cell-associated neural cell adhesion molecule (N-CAM/CD56). J Immunol 146:4421–4426[Abstract]
  36. Woodford-Thomas T, Thomas ML 1993 The leukocyte common antigen, CD45 and other protein tyrosine phosphatases in hematopoietic cells. Semin Cell Biol 4:409–418[CrossRef][Medline]
  37. Robinson J, Sieff C, Delia D, Edwards PAW, Greaves M 1981 Expression of cell-surface HLA-DR, HLA-ABC and glycophorin during erythroid differentiation. Nature 289:68–71[CrossRef][Medline]
  38. Molenaar WM, Lee VM, Trojanowski JQ 1990 Early fetal acquisition of the chromaffin and neuronal immunophenotype by human adrenal medullary cells. An immunohistological study using monoclonal antibodies to chromogranin A, synaptophysin, tyrosine hydroxylase, and neuronal cytoskeletal proteins. Exp Neurol 108:1–9[CrossRef][Medline]
  39. Bocian-Sobkowska J, Wozniak W, Malendowicz LK, Ginda W 1996 Stereology of human fetal adrenal medulla. Histol Histopathol 11:389–393[Medline]
  40. Iannaccone PM, Weinberg WC 1987 The histogenesis of the rat adrenal cortex: a study based on histologic analysis of mosaic pattern in chimeras. J Exp Zool 243:217–223[CrossRef][Medline]
  41. Morley SD, Viard I, Chung BC, Ikeda Y, Parker KL, Mullins JJ 1996 Variegated expression of a mouse steroid 21-hydroxylase/beta-galactosidase transgene suggests centripetal migration of adrenocortical cells. Mol Endocrinol 10:585–598[Abstract/Free Full Text]
  42. Mitani F, Suzuki H, Hata J, Ogishima T, Shimada H, Ishimura Y 1994 A novel cell layer without corticosteroid-synthesizing enzymes in rat adrenal cortex: histochemical detection and possible physiological role. Endocrinology 135:431–438[Abstract]
  43. Leon C, Grant NJ, Aunis D, Langley K 1992 Expression of cell adhesion molecules and catecholamine synthesizing enzymes in the developing rat adrenal gland. Brain Res Dev Brain Res 70:109–121[CrossRef][Medline]
  44. Grant NJ, Leon C, Aunis D, Langley K 1992 Cellular localization of the neural cell adhesion molecule L1 in adult rat neuroendocrine and endocrine tissues: comparisons with NCAM. J Comp Neurol 325:548–558[CrossRef][Medline]
  45. Carballeira A, Fishman LM 1980 The adrenal functional unit: a hypothesis. Perspect Biol Med 23:573–597[Medline]
  46. Wurtman RJ, Axelrod J 1966 Control of enzymatic synthesis of adrenaline in the adrenal medulla by adrenal cortical steroids. J Biol Chem 241:2301–2305[Abstract/Free Full Text]
  47. McNicol AM, Richmond J, Charlton BG 1994 A study of general innervation of the human adrenal cortex using PGP 9.5 immunohistochemistry. Acta Anat (Basel) 151:120–123[Medline]
  48. Wilburn LA, Jaffe RB 1988 Quantitative assessment of the ontogeny of met-enkephalin, norepinephrine and epinephrine in the human fetal adrenal medulla. Acta Endocrinol (Copenh) 118:453–459
  49. Bornstein S, Gonzalez-Hernandez J, Ehrhart-Bornstein M, Adler G, Scherbaum W 1994 Intimate contact of chromaffin and cortical cells within the human adrenal gland forms the cellular basis for important intraadrenal interactions. J Clin Endocrinol Metab 78:225–232[Abstract]
  50. Yon L, Breault L, Contesse V, Bellancourt G, Delarue C, Fournier A, Lehoux J-G, Vaudry H, Gallo-Payet N 1998 Localization, characterization, and second messenger coupling of pituitary adenylate cyclase-activating polypeptide receptors in the fetal human adrenal gland during the second trimester of gestation. J Clin Endocrinol Metab 83:1299–1305[Abstract/Free Full Text]
  51. Wilburn LA, Goldsmith PC, Chang KJ, Jaffe RB 1986 Ontogeny of enkephalin and catecholamine-synthesizing enzymes in the primate fetal adrenal medulla. J Clin Endocrinol Metab 63:974–980[Abstract/Free Full Text]
  52. Crickard K, Ill CR, Jaffe RB 1981 Control of proliferation of human fetal adrenal cells in vitro. J Clin Endocrinol Metab 53:790–796[Abstract/Free Full Text]
  53. Walsh FS, Doherty P 1997 Neural cell adhesion molecules of the immunoglobulin superfamily: role in axon growth and guidance. Annu Rev Cell Dev Biol 13:425–456[CrossRef][Medline]
  54. Langley OK, Aletsee-Ufrecht MC, Grant NJ, Gratzl M 1989 Expression of the neural cell adhesion molecule NCAM in endocrine cells. J Histochem Cytochem 37:781–791[Abstract]
  55. Jin L, Hemperly J, Lloyd R 1991 Expression of neural cell adhesion molecule in normal and neoplastic human neuroendocrine tissues. Am J Pathol 138:961–969[Abstract]
  56. Zeromski J, Lawniczak M, Galbas K, Jenek R, Golusinski P 1998 Expression of CD56/N-CAM antigen and some other adhesion molecules in various human endocrine glands. Folia Histochem Cytobiol 36:119–125[Medline]
  57. Ehrhart-Bornstein M, Hilbers U 1998 Neuroendocrine properties of adrenocortical cells. Horm Metab Res 30:436–439[Medline]
  58. Cunningham BA, Hemperly JJ, Murray BA, Prediger EA, Brackenbury R, Edelman GM 1987 Neural cell adhesion molecule: structure, immunoglobulin-like domains, cell surface modulation, and alternative RNA splicing. Science 236:799–806[Abstract/Free Full Text]
  59. Langley OK, Aletsee-Ufrecht MC, Grant NJ, Gratzl M 1989 Expression of the neural cell adhesion molecule NCAM in endocrine cells. J Histochem Cytochem 37:781–791
  60. Lahr G, Mayerhofer A, Bucher S, Barthels D, Wille W, Gratzl M 1993 Neural cell adhesion molecules in rat endocrine tissues and tumor cells: distribution and molecular analysis. Endocrinology 132:1207–1217[Abstract/Free Full Text]
  61. Mayerhofer A, Lahr G, Gratzl M 1991 Expression of the neural cell adhesion molecule in endocrine cells of the ovary. Endocrinology 129:792–800[Abstract/Free Full Text]
  62. Prag S, Lepekhin EA, Kolkova K, Hartmann-Petersen R, Kawa A, Walmod PS, Belman V, Gallagher HC, Berezin V, Bock E, Pedersen N 2002 NCAM regulates cell motility. J Cell Sci 115:283–292[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
T. Matsumoto, K. Minegishi, H. Ishimoto, M. Tanaka, J. D. Hennebold, T. Teranishi, Y. Hattori, M. Furuya, T. Higuchi, S. Asai, et al.
Expression of Ovary-Specific Acidic Protein in Steroidogenic Tissues: A Possible Role in Steroidogenesis
Endocrinology, July 1, 2009; 150(7): 3353 - 3359.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Ishimoto, K. Minegishi, T. Higuchi, M. Furuya, S. Asai, S. H. Kim, M. Tanaka, Y. Yoshimura, and R. B. Jaffe
The Periphery of the Human Fetal Adrenal Gland Is a Site of Angiogenesis: Zonal Differential Expression and Regulation of Angiogenic Factors
J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2402 - 2408.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. Haase, M. Schott, S. R Bornstein, L. K Malendowicz, W. A Scherbaum, and H. S Willenberg
CITED2 is expressed in human adrenocortical cells and regulated by basic fibroblast growth factor
J. Endocrinol., February 1, 2007; 192(2): 459 - 465.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
A. Dumitrescu, G. W Aberdeen, G. J Pepe, and E. D Albrecht
Developmental expression of cell cycle regulators in the baboon fetal adrenal gland
J. Endocrinol., January 1, 2007; 192(1): 237 - 247.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
L. A. Miles, N. M. Andronicos, N. Baik, and R. J. Parmer
Cell-Surface Actin Binds Plasminogen and Modulates Neurotransmitter Release from Catecholaminergic Cells
J. Neurosci., December 13, 2006; 26(50): 13017 - 13024.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Ishimoto, M. O. Muench, T. Higuchi, K. Minegishi, M. Tanaka, Y. Yoshimura, and R. B. Jaffe
Midkine, a Heparin-Binding Growth Factor, Selectively Stimulates Proliferation of Definitive Zone Cells of the Human Fetal Adrenal Gland
J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4050 - 4056.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Ishimoto, D. G. Ginzinger, T. Matsumoto, Y. Hattori, M. Furuya, K. Minegishi, M. Tanaka, Y. Yoshimura, and R. B. Jaffe
Differential Zonal Expression and Adrenocorticotropin Regulation of Secreted Protein Acidic and Rich in Cysteine (SPARC), a Matricellular Protein, in the Midgestation Human Fetal Adrenal Gland: Implications for Adrenal Development
J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3208 - 3214.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Ishimoto, D. G. Ginzinger, and R. B. Jaffe
Adrenocorticotropin Preferentially Up-Regulates Angiopoietin 2 in the Human Fetal Adrenal Gland: Implications for Coordinated Adrenal Organ Growth and Angiogenesis
J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1909 - 1915.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muench, M. O.
Right arrow Articles by Jaffe, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muench, M. O.
Right arrow Articles by Jaffe, R. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals