| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Laboratory Medicine (M.O.M.) and Center for Reproductive Sciences (J.V.R., M.N., H.I., R.B.J.), Department of Obstetrics, Gynecology and Reproductive Sciences, University of California, San Francisco, San Francisco, California 94143
Address all correspondence and requests for reprints to: Marcus O. Muench, Ph.D., Department of Laboratory Medicine, University of California, San Francisco, 533 Parnassus Avenue, Room U-440, San Francisco, California 94143-0793. E-mail: muench{at}itsa.ucsf.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Our interest is in understanding the developmental processes inherent in the human fetal adrenal gland. In the early stages of organ development, some fetal organs do not recapitulate the structural or functional organization of the adult. The human adrenal gland is exceptional in that the fetal structure persists throughout gestation and its functional adult organization does not occur until after birth. The human fetal adrenal also has diverged markedly from other mammals, with only some higher primates and few other animals (armadillo, sloth) having a similar adrenal architecture. Because the fetal adrenal gland is necessary for maintenance of intrauterine homeostasis, induction of enzymes in organs essential for extrauterine life and possibly involved in the initiation of parturition, elucidating fetal adrenal developmental biology, is of particular importance.
The human fetal adrenal gland arises from the coelomic ridge. Quite rapidly, three cell types are apparent: 1) a thin layer encapsulating the gland; 2) two to three cell layers of small, tightly packed basophilic cells; and 3) a large inner portion (>80% by volume) of large cells with lipid-filled vacuoles. These layers are the capsule, definitive zone (DZ) and fetal zone (FZ), respectively. Later in gestation, the transitional zone (TZ) will become apparent between the DZ and FZ (10). From early in development (68 wk), FZ cells express P450 side-chain cleavage enzyme (P450scc) and P450 17
-hydroxylase/1720 lyase (P450c17). This complement of steroidogenic enzymes permits synthesis of large amounts of dehydroepiandrosterone and dehydroepiandrosterone sulfate. The cells lack 3-ß-hydroxysteroid dehydrogenase (3-ßHSD), however, and thus are not capable of synthesizing other steroid products independently. Rather, the dehydroepiandrosterone and dehydroepiandrosterone sulfate are converted to estrogens by the placenta in a unique cooperative effort between the placenta and fetus, the fetoplacental unit. In addition to P450c17 and P450scc, 3-ßHSD and P450c11 are expressed during the latter part of gestation in the TZ and DZ, and aldosterone synthase is expressed in the DZ close to term.
In contrast to the FZ, before the third trimester, the DZ cells express only P450scc and do not have the capacity to produce steroids (11). This has led to the hypothesis that this thin rim of cells may represent a progenitor population in the human fetal adrenal gland. We believe that these cells proliferate and differentiate first into cells of the FZ and later in gestation into cells of the TZ and FZ. Finally, just before birth some DZ cells take on characteristics of the adult zona glomerulosa and produce aldosterone. This hypothesis of DZ cells serving as progenitors is generally accepted yet lacks direct evidence. Recently, we used laser capture microdissection to isolate DZ cells (11). The cDNA library prepared from this relatively pure population of cells was used for subtractive hybridization to identify new markers unique to DZ and FZ cells. Expression of nephroblastoma overexpressed gene (NovH) and the gene for the ribosomal protein metallopanstimulin-1 (Mps-1) was found among DZ cells, whereas the low-density lipoprotein receptor gene (LDLR) was enriched among FZ cells (12). In the present study, we describe CD56 (neural cell adhesion molecule) to be a cell-surface marker on DZ cells, which can be used to isolate DZ cells by fluorescence-activated cell sorting (FACS). Expression of CD56 is extensive in developing neuronal and endocrine tissues, including the rat adrenal (13, 14, 15, 16) and also is expressed by NK cells and some T cells (17, 18). CD56 belongs to the Ig superfamily of adhesion molecules and plays a role in the morphogenesis of several organ systems including the liver (19, 20), pancreas (21, 22), and neuromuscular junction (23). Expression of CD56 has been noted in both developing fetal organ systems (20) and physiologic and regenerative processes in adults (24, 25). Its role in these processes has been suggested to range from altering migration to initiating differentiation and stimulation of signaling cascades. The use of this and other cell surface markers has allowed us to greatly enrich DZ cells for in vitro studies of adrenocortical cell differentiation.
| Materials and Methods |
|---|
|
|
|---|
Adrenals glands were obtained from human fetuses after therapeutic termination of pregnancy. This study was approved by the Committee on Human Research, University of California, San Francisco (UCSF). The gestational ages ranged from 15 to 24 wk. Adrenal glands were obtained and placed in PBS without Ca2+ or Mg2+ with 2% fetal bovine serum for cell separation experiments or placed in 4% paraformaldehyde when intended only for histological examination. Adrenals were kept on ice for transport to the laboratory.
Antibodies
The following fluorescein isothiocyanate (FITC) and phycoerythrin (PE) labeled monoclonal antibodies (mAbs) were purchased from BD Biosciences (San Jose, CA): CD31-FITC (WM59), CD56-PE (MY31), mouse IgG1-FITC, mouse IgG2a-FITC, and mouse IgM-FITC. CD56-FITC and CD56-PE (C5.9) were purchased from Exalpha Corp. (Boston, MA). CD45-PE (HI30), mouse IgG1-FITC, mouse IgG1-PE, mouse IgG2a-PE, mouse IgG2b-FITC, and mouse IgM-FITC were purchased from Caltag (Burlingame, CA). The following conjugated mAbs were purchased from Beckman-Coulter (Miami, FL): CD31-PE (1F11), CD34-FITC (581), CD36-FITC (FA6.152), CD45-FITC (KC56), CD235a-FITC (11E4B-76), and CD235a-PE (11E4B-76). Polyclonal rabbit anticytochrome P450c17 antibody was kindly provided by Dr. Walter Miller (UCSF) (26). Polyclonal sheep antihuman CD31 was obtained from Research and Diagnostic Systems Inc. (Minneapolis, MN) and used for the confocal microscopy experiments.
Immunohistochemistry
Fetal adrenal glands were placed in 4% paraformaldehyde overnight, followed by incubation in 30% sucrose in PBS at 4 C overnight. Tissues were then embedded in Tissue-Tek OCT compound from Sakura Finetek (Torrance, CA) and frozen in a dry ice ethanol bath. Samples were stored at -80 C until use. Ten-micrometer sections were prepared and used for immunofluorescence.
Tissue sections were processed according to the method of Basora et al. (27). Autofluorescence was prevented by incubating sections in 0.02 M glycine in PBS with or without 0.10.3% Triton X-100, 10% nonfat milk for 30 min, and 10% goat or donkey serum for 30 min. Primary antibody incubation was performed with 1:10 dilutions of FITC-conjugated CD31, CD34, CD36, or CD56 mAbs or a 1:300 dilution of anti-P450c17 for 1 h at room temperature. After washing, incubation with a fluorochrome-labeled secondary antibody was performed at room temperature for 30 min with either Cy3-conjugated goat antimouse or goat antirabbit antibody (Jackson Laboratories, West Grove, PA) for single color immunohistochemical studies. For the confocal microscopy experiments, FITC-conjugated goat antimouse antibody (Jackson Laboratories) was used to detect CD56 staining, and Cy3-conjugated goat antirabbit was used to detect anti-P450c17 antibody. Cy5-conjugated donkey antisheep antibody (Jackson Laboratories) was used in the confocal microscopy experiments to detect antibody bound to CD31. After washing, slides were mounted with Vectorshield (Vector Laboratories, Inc., Burlingame, CA) and examined with a DMR fluorescent microscope (Leica, Quèbec, Canada) and a HQ-TRITC filter (Chroma, Brattleboro, VT). Pictures were taken with a DCS 430 digital camera (Eastman Kodak Co., Rochester, NY) and transferred to Adobe Photoshop software (Adobe Systems Inc., San Jose, CA). Confocal microscopy was performed using a 510 META laser-scanning microscope (Carl Zeiss Inc., Jena, Germany). Control sections were stained with unconjugated mouse or rabbit IgG or with FITC-conjugated mouse IgG. Background staining using these controls under the conditions described was minimal.
Laser capture microdissection
Laser capture microdissection was performed as described previously (12), using the Pixcell II (Arcturus Engineering, Mountain View, CA).
Preparation of RNA, RT-PCR, and real-time quantitative RT-PCR
RNA was prepared by one of two methods chosen by estimating the amount of RNA to be extracted. For quantities of approximately 5 µg, Mini RNeasy (QIAGEN, Valencia, CA) was used according to the manufacturers instructions, followed by use of DNA-Free from Ambion (Woodward, TX). For quantities less than 5 µg, a mini-RNA isolation kit (Zymo Research, Orange, CA) was used as instructed, followed by their DNA-Free RNA kit. Before RT of the RNA, samples were shown to be free of DNA by a RT-PCR reaction using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) oligonucleotides. RT with random primers was carried out with M-MLV reverse transcriptase (Invitrogen Corp., Carlsbad, CA).
The following sense (antisense) oligonucleotides were used: GAPDH, GATGACATCAAGAAGGTGGTG (CTCCTTGGAGGCCATGTGGGCCAT); NovH, CTAAGTGGACTGGTGTCATAAC (ATTTGAAACAGCTATCAGAGGG); Mps-1, GATCTCCTTCATCCCTCTCC (GTTTCCCACTCATCTTGACTC); P450c17, CTTCAAGCTGCAGAAAAAATATGG (CAATGTACTGATTTCCTGACAAAT); 3-ßHSD, CCTCACCAAAGCTATGATAACC (TCCTAACAATACCCACATGCAC); LDLR, TCTAAGCCAAACCCCTAAACTC (CAACACACACGACAGAAAACAG); CD31, TCACCATCCAGAAGGAAGATAC (ACCCTCAGAACCTCACTTAAC); CD56, TATTTGCCTATCCCAGTGCC (CATACTTCTTCACCAACTGCTC); CD90, GCTGCTTCTGTCTGGTTTATTTAG (CCTCATCCTTTACCTCCTTCTC); and Chromogranin A (Chr-A) CATCTCCGACACACTTTCCAAG (TCCTCTCTTTTCTCCATAACATCC). All oligonucleotides were purchased from Sigma-Genosys (The Woodlands, TX), and each oligonucleotide was used at 10 pm/µl in conjunction with Ready-To-Go PCR beads (Amersham Biosciences Corp. Piscataway, NJ) for 35 cycles as recommended. RT-PCR was performed on a Gene Amp PCR System 9600 (Perkin-Elmer, Boston, MA).
Expression of 3-ßHSD CD56-lin-, CD56+lin- cells was further analyzed using the 5' nuclease assay (real-time TaqMan RT-PCR) as we have described previously (28). Relative expression levels were calculated as 2-(Ct 3-ßHSD - Ct GAPDH) using GAPDH as an endogenous control gene. Sequences for the PCR primers and TaqMan probes were: 3-ßHSD forward, TCACAGAGAGTCCATCATGAATGTC; reverse, CGGCTACCTCTATGCTACTGGTGTA; TaqMan probe, FAM(6-carboxy-fluorescein)-TGAAAGGTACCCAGCTACTGTTGGAGGC-TAMRA(6-carboxy-tetramethyl-rhodamine) (Integrated DNA Technologies, Coralville, IA); GAPDH forward, ATTCCACCCATGGCAAATTC; reverse, TGGGATTTCCATTGATGACAAG; TaqMan probe, FAM-ATGGCACCGTCAAGGCTGAGAACG-TAMRA (Integrated DNA Technologies).
Isolation of human fetal adrenal cells
Fetal adrenals were mechanically dispersed and then treated with 3 µg/ml Liberase Blendzyme 2 (Roche Molecular Biochemicals, Indianapolis, IN) at 37 C for 20 min. Cells were filtered into media containing 10% fetal bovine serum to remove aggregates and then concentrated by centrifugation. The cells were then suspended in 3 ml PBS supplemented with 0.3% BSA and 0.01% NaN3 and overlaid on 7 ml NycoPrep 1.077 (Greiner-Bio-One, Inc., Longwood, FL), centrifuged for 25 min at 600 x g at room temperature. The light-density fraction on top of the NycoPrep solution was collected and washed twice in PBS with 0.3% BSA and 0.01% NaN3 (PBS/BSA) and then held overnight in PBS with 10% goat serum and 0.01% NaN3 at 4 C.
Flow cytometric analysis of cell surface markers
Approximately 2 x 105 cells suspended in up to 200 µl blocking buffer were incubated in 96-well Costar V-bottom plates (Corning Inc., Corning, NY) with saturating amounts of mAbs on ice for at least 30 min. Cells were washed twice with 250 µl PBS/BSA. The washed cells were suspended in PBS/BSA containing 2 µg/ml propidium iodide (PI), purchased from Molecular Probes (Eugene, OR). PI was used to stain dead cells so that they could be excluded from the FACS analysis. Flow cytometric analyses were performed using either a FACScan or FACSCalibur flow cytometer (BD Biosciences). Analyses of results were performed using CellQuest software (BD Biosciences).
| Results |
|---|
|
|
|---|
CD56 was expressed on cells from human fetal adrenal glands ranging in gestational age from 10 to 24 wk. In all cases, the pattern of CD56 expression was as a band of cells immediately below the capsule of the adrenal (Fig. 1
, A and B) corresponding to the DZ (Fig. 2A
). Human P450c17, which is highly expressed in the FZ (10, 29), was analyzed as a positive marker of FZ cells using an anti-P450c17 antibody kindly provided by Dr. Walter Miller (Fig. 1C
) (26). DZ cells reacted minimally with anti-P450c17 antibody, although some isolated cells in the DZ demonstrated staining. Additionally, isolated pockets of bright CD56 staining were observed within the FZ (Fig. 1A
).
|
|
To confirm the expression of CD56 by DZ cells, CD56 mRNA expression was assessed in DZ and FZ cells. Laser microdissection was used to isolate cells from the FZ and DZ (Fig. 2A
), and RT-PCR was then used to assess CD56 mRNA expression. In two experiments, CD56 mRNA was found expressed in DZ cells but not in FZ cells (Fig. 2B
). A similar pattern of expression was observed for mRNA encoding the genes Mps-1, the growth regulatory protein NovH, and CD90 (Thy-1). Mps-1 and NovH are expressed primarily by DZ cells (30). CD90 expression is found on a variety of cell types including neurons, chromaffin cells, hematopoietic stem cells, and connective tissue (16, 31, 32, 33, 34). Interestingly, P450c17 mRNA was detected among DZ cells.
Analysis of CD56 and P450c17 expression by confocal microscopy
The expression of P450c17 by some DZ cells was confirmed by dual staining of fetal adrenal sections for CD56 and P450c17, followed by confocal microscopy. Consistent with the results in Fig. 1
, low-power examination of the fetal adrenal reveals that most staining for CD56 and P450c17 is mutually exclusive and serves to demarcate the DZ and FZ, respectively (Fig. 3A
). However, examination at higher magnification revealed that some cells coexpress CD56 and P450c17 (Fig. 3
, BE). These cells typically were observed bordering the FZ and not the capsule. The intensity of the cell-surface CD56 staining and the cytoplasmic P450c17 staining also appeared to be reduced in some of these cells, suggesting that they have an intermediate phenotype between the CD56+P450c17- DZ cells and the CD56-P450c17+ FZ cells.
|
CD56 expression on the surface of adrenal cells was analyzed in fetal specimens ranging in age from 15 to 24 wk of gestation. Background fluorescence indicated the presence of diverse cell populations in the adrenal cell preparations (Fig. 4A
). This also was apparent in the analysis of forward and side light scatter, which indicated the presence of a large number of small- to medium-sized cells of moderate complexity (Fig. 4B
). Larger and more complex cells, with higher forward and side light scatters, also were observed. These cells were also responsible for the population of cells with the high background fluorescence (>101 fluorescence) seen in Fig. 4A
. Because CD56 is expressed on NK cells found in peripheral blood (35), the adrenal samples also were stained for CD45 and CD235a (Fig. 4C
), markers found exclusively on leukocytes and erythrocytes, respectively (36, 37). Together, CD45 and CD235a stained 66% of the isolated adrenal cells and accounted for the majority of small- to medium-sized cells with low side light scatter (Fig. 4D
).
|
Flow cytometric and immunohistochemical analysis of endothelial cell markers in the fetal adrenal gland
We speculated that our adrenal cell preparation also was likely to contain endothelial cells in addition to the other cell types present. Three markers associated with endothelial cells were analyzed to determine their pattern of expression on hematopoietic and CD56+ cells in the fetal adrenal. The following markers were analyzed: CD31 (platelet endothelial cell adhesion molecule-1), CD34, and CD36 (thrombospondin receptor). Flow cytometric analyses identified CD31+, CD34+, and CD36+ populations in the adrenal cell preparations that were not of hematopoietic origin and, thus, likely represented endothelial cells (Fig. 5
, A, D, and G). Note that each of these markers is expressed by some hematopoietic cells and that such expression was evident in our analyses. The indicated CD31+, CD34+, and CD36+ populations (arrows in Fig. 5
, A, D, and G) represented 6%, 8%, and 19% of all cells, respectively. Analyses of CD31, CD34, and CD36 expression on CD56+ cells indicated that most CD56+ cells were negative for these markers although some CD34+CD56+ and CD36+CD56+ cells may exist (Fig. 5
, B, E, and H). There was no overlap, however, between the CD31+ and the CD56+ cell populations. The patterns of expression by immunohistochemistry of each of these markers were similar to those seen in Fig. 5
, C, F, and I. These markers stained cells and vessels in the capsule as well as cells dispersed in the DZ. However, the pattern of expression was consistent with staining of the vasculature, in particular the circular patterns associated with vessel cross-sections. There was no pattern of expression suggesting that DZ cells bound CD31, CD34, or CD36. This was further confirmed by a three-color analysis of adrenals stained for CD56, P450c17, and CD31 and analyzed by confocal microscopy (Fig. 3A
). CD31 expression (white color) did not overlap with cells that expressed CD56 or P450c17. These data, therefore, indicated that CD31 can be used to deplete adrenal cell preparations of endothelial cells without depletion of the CD56+ DZ cells.
|
Discontinuous-gradient centrifugation was tested to determine whether CD56+ adrenal cells could be enriched by this technique. Dissociated adrenal cells were centrifuged over a 1.077 g/ml layer of NycoPrep and the light-density cells recovered. From 4.2 x 106 to 7.8 x 106 cells were recovered per gland by the dissociation procedure in three experiments using 23- and 24-wk gestation tissues. The light-density fraction recovered represented 0.6% to 3.6% of starting cell population. The discarded high-density fraction contained the majority of erythrocytes as well as other cell types and debris. The light-density fraction contained 48% CD56+ cells, which was an approximate 5-fold enrichment over the total cell population (data not shown). Because density separation was an effective means of enriching CD56+ adrenal cells, this technique was used to enrich for DZ cells before staining with mAbs and FACS.
To isolate an enriched population of DZ cells, light-density adrenal cells were stained with CD56-PE, CD31-FITC, CD45-FITC, and CD235a-FITC. Live cells, based on the lack of PI staining, were isolated as shown in Fig. 6
. These live cells were further depleted of CD31+CD45+CD235a+ cells, resulting in a population collectively called lineage- (lin-) cells. Two cell populations were isolated based on the presence of absence of CD56 expression. The recovery of CD56+lin- cells from 23- and 24-wk gestation tissues ranged from 1.3 x 104 to 4.1 x 104 cells/adrenal gland (n = 3). The recovery of CD56-lin- cells was similar. There was no apparent contamination of the CD56-lin- cell population by CD56+ cells based on CD56 mRNA expression (Fig. 7
). However, a low level of CD31 gene expression was detected in both sorted populations likely caused by either modest contamination of the sorted cell populations or CD31 gene expression in the sorted cell populations without cell-surface expression of the CD31 protein.
|
|
| Discussion |
|---|
|
|
|---|
To date, DZ cells in the human fetal adrenal gland have been identified only by their location within the gland or by their lack of expression of steroidogenic enzymes. Our ongoing aim has been to identify unique markers for these cells to use as tools for the purification and characterization of the DZ cells. Recently, we used subtractive hybridization of RNA from cells prepared by laser capture microdissection to define novel markers unique to DZ cells in the fetal adrenal gland (12). The present study extends this effort by describing CD56 as a cell surface marker for DZ cells. We identified this marker through an extensive series of phenotyping experiments using FACS. We have shown that CD56 is expressed on a cell population of small, dense, low side scatter cells that lack markers of hematopoietic origin (CD31, CD34 and CD235a). This cell population is enriched for cells expressing known markers of DZ cells, NovH and Mps-1. Thus, we believe we have isolated a highly enriched DZ cell population.
The CD56+lin- cell pool also contains mRNA for P450c17, which is a steroid enzyme abundantly expressed in TZ and FZ cells (10, 29). However, RT-PCR, as was employed in our study, is a very sensitive but minimally quantitative technique and can detect very low levels of mRNA. Therefore, we quantified the percentage of P450c17+ cells in the purified cell pool by immunofluorescence. P450c17 protein was detected in 1113% of the sorted cell population, which accounts for the strong signal in the RT-PCR experiments. Moreover, using confocal microscopy some cells expressing P450c17 were visible among the CD56+ DZ cells. The pattern of expression observed suggests that these cells may represent a differentiating cell population that has not yet migrated centripetally. The presence of these cells lends credence to the concept of the DZ cells serving as a progenitor population. If one cell truly is the progenitor of another, an intermediate cell likely exists that expresses some markers from both the progenitor and mature cell types. Further investigation of human fetal adrenocortical cells likely will lead to the description of other markers that can be used to further purify and subdivide the DZ population. These CD56+P450c17+ cells can then be better characterized regarding their status as maturing FZ cells.
Some CD56+lin- cells also express Chr-A, a marker for chromaffin cells. Previous studies have indicated CD56 expression on chromaffin cells in the developing rat adrenal (43, 44). Chromaffin cells are a major component of the adrenal medulla and produce catecholamines. Traditionally, the adrenal medulla and cortex are thought of as two functionally and structurally distinct entities coexisting within the adrenal capsule. However, data have accumulated indicating that glucocorticoids produced by adrenal cortical cells can influence medullary function (45). Cortisol is known to stimulate phenylethanolamine-N-methyltransferase, the enzyme that catalyzes the conversion of norepinephrine to epinephrine in the adrenal medulla. Teleologically, it may not be coincidence that the adrenal cortex, the site of cortisol synthesis, envelops the adrenal medulla, as suggested by Wurtman and Axelrod (46). Neuronal processes have been noted that extend from medullary neurons to cells within all three zones of the cortex (47). During human intrauterine life, we found that a well-formed medulla is not present before birth (48). Rather, there are scattered chromaffin cells throughout the fetal adrenal gland that express phenylethanolamine-N-methyltransferase, the enzyme that converts norepinephrine to epinephrine. Furthermore, close apposition of adrenocortical and medullary cells was noted by others. Nests of chromaffin cells have been found throughout the human adrenal cortex, particularly in subcapsular locations, in both the adult (49) and fetus (50). In fact, chromaffin cells are scattered in clusters, or nests, in the fetal adrenal gland because a more structurally distinct medulla does not form until after birth (51). These findings are consistent with the pattern of CD56 expression we observed in this study, which indicated islands of CD56+ cells found within the FZ. Thus, it is not surprising to find some evidence of similar gene expression in adrenocortical and medullary cells. Experiments are underway to identify cell surface molecules that can be used to separate chromaffin cells from the DZ cells. Alternatively, chromaffin cells are not adherent to tissue culture plates and, thus, may be eliminated from cultures by washing (52).
CD56 (neural cell adhesion molecule) is an adhesion molecule that has been extensively studied in diverse tissues. Its role in axonal growth, migration, and guidance has been examined in detail (15, 53). In vitro antibody perturbation and mutational studies have established the role of CD56 as a regulator of neuronal growth, and it is essential for proper neuronal patterning. CD56 expression was originally thought to be confined to neuronal and neuroendocrine tissues. However, when multiple alternatively spliced isoforms of CD56 were recognized and new antibodies generated, expression was noted in other tissues, most notably endocrine organs (54, 55). Rat pituitary cells (54), human thyrocytes (56), and human adrenocortical cells (57) all express CD56. Interestingly, the adult adrenal gland expresses CD56 primarily in the zona glomerulosa (57). Late in gestation, the DZ, which also is immediately beneath the capsule, is analogous to the zona glomerulosa in that it begins to express steroidogenic enzymes and produce aldosterone (10).
CD56 is expressed by cells in as many as 2030 different forms. Alternate splicing from a single gene accounts for most of this variability, but posttranslational modification plays a lesser role (58). Several groups have noted the 140-kDa isoform in endocrine tissues, but the 180-kDa isoform is more common in neuronal tissue (59, 60, 61). The 140-kDa isoform, when expressed in glioma cells, decreased cell motility to a greater extent than the 180-kDa isoform (62). Further investigation into CD56 isoform expression in the fetal adrenal and its potential role in cell migration is warranted. It is possible that cells in the DZ express the 140-kDa isoform of CD56 until differentiation has progressed to the point at which migration into other zones is necessary. Then, as CD56 expression is altered or decreases, the cells begin to migrate inward and differentiate into cells of the TZ or FZ.
In conclusion, the method developed in this study for the isolation of DZ cells is an important step toward the detailed molecular analysis of the events involved in the cellular development of the human fetal adrenal. The development of a reproducible, rapid isolation method is critical to obtain highly pure cells, which can now be studied in vitro. We plan to use this method to explore the role of CD56+ DZ cells in the development of the human fetal adrenal gland.
| Acknowledgments |
|---|
| Footnotes |
|---|
M.O.M. and J.V.R. contributed equally to this work.
Abbreviations: Chr-A, Chromogranin A; DZ, definitive zone; FACS, fluorescence-activated cell sorting; FITC, fluorescein isothiocyanate; FZ, fetal zone; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; 3-ßHSD, 3-ß-hydroxysteroid dehydrogenase; LDLR low-density lipoprotein receptor; lin-, lineage-; mAb, monoclonal antibody; Mps-1, metallopanstimulin-1; NovH, nephroblastoma overexpressed gene; PE, phycoerythrin; PI, propidium iodide; P450scc, P450 side-chain cleavage enzyme; TZ, transitional zone.
Received January 30, 2003.
Accepted April 25, 2003.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Matsumoto, K. Minegishi, H. Ishimoto, M. Tanaka, J. D. Hennebold, T. Teranishi, Y. Hattori, M. Furuya, T. Higuchi, S. Asai, et al. Expression of Ovary-Specific Acidic Protein in Steroidogenic Tissues: A Possible Role in Steroidogenesis Endocrinology, July 1, 2009; 150(7): 3353 - 3359. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ishimoto, K. Minegishi, T. Higuchi, M. Furuya, S. Asai, S. H. Kim, M. Tanaka, Y. Yoshimura, and R. B. Jaffe The Periphery of the Human Fetal Adrenal Gland Is a Site of Angiogenesis: Zonal Differential Expression and Regulation of Angiogenic Factors J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2402 - 2408. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Haase, M. Schott, S. R Bornstein, L. K Malendowicz, W. A Scherbaum, and H. S Willenberg CITED2 is expressed in human adrenocortical cells and regulated by basic fibroblast growth factor J. Endocrinol., February 1, 2007; 192(2): 459 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dumitrescu, G. W Aberdeen, G. J Pepe, and E. D Albrecht Developmental expression of cell cycle regulators in the baboon fetal adrenal gland J. Endocrinol., January 1, 2007; 192(1): 237 - 247. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Miles, N. M. Andronicos, N. Baik, and R. J. Parmer Cell-Surface Actin Binds Plasminogen and Modulates Neurotransmitter Release from Catecholaminergic Cells J. Neurosci., December 13, 2006; 26(50): 13017 - 13024. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ishimoto, M. O. Muench, T. Higuchi, K. Minegishi, M. Tanaka, Y. Yoshimura, and R. B. Jaffe Midkine, a Heparin-Binding Growth Factor, Selectively Stimulates Proliferation of Definitive Zone Cells of the Human Fetal Adrenal Gland J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4050 - 4056. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ishimoto, D. G. Ginzinger, T. Matsumoto, Y. Hattori, M. Furuya, K. Minegishi, M. Tanaka, Y. Yoshimura, and R. B. Jaffe Differential Zonal Expression and Adrenocorticotropin Regulation of Secreted Protein Acidic and Rich in Cysteine (SPARC), a Matricellular Protein, in the Midgestation Human Fetal Adrenal Gland: Implications for Adrenal Development J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3208 - 3214. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ishimoto, D. G. Ginzinger, and R. B. Jaffe Adrenocorticotropin Preferentially Up-Regulates Angiopoietin 2 in the Human Fetal Adrenal Gland: Implications for Coordinated Adrenal Organ Growth and Angiogenesis J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1909 - 1915. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |