help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jovanovic, L.
Right arrow Articles by Grebe, S. K. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jovanovic, L.
Right arrow Articles by Grebe, S. K. G.
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 7 3284-3291
Copyright © 2003 by The Endocrine Society

Thyroid Gland Clonality Revisited: The Embryonal Patch Size of the Normal Human Thyroid Gland Is Very Large, Suggesting X-Chromosome Inactivation Tumor Clonality Studies of Thyroid Tumors Have to Be Interpreted with Caution

Lidija Jovanovic, Brett Delahunt, Bryan McIver, Norman L. Eberhardt and Stefan K. G. Grebe

Department of Pathology and Molecular Medicine (L.J., B.D.), Wellington School of Medicine and Health Sciences, Wellington 6002, New Zealand; Departments of Medicine (B.M., N.L.E., S.K.G.G.), Biochemistry and Molecular Biology (N.L.E.), and Laboratory Medicine and Pathology (S.K.G.G.), Mayo Foundation and Clinic, Rochester, Minnesota 55905

Address all correspondence and requests for reprints to: Stefan K. G. Grebe, M.D., Endocrine Lab, Hilton 730, Department of Laboratory Medicine and Pathology, Mayo Foundation and Clinic, 200 First Street SW, Rochester, Minnesota 55905 E-mail: grebe.stefan{at}mayo.edu.


   Abstract
Top
 Abstract
Introduction
 Patients and Methods
 Results
 Discussion
 References
 
It is widely assumed thyroid carcinomas, adenomas, and many hyperplastic nodules are monoclonal. This belief is based on X-chromosome inactivation analyses of thyroid tumors. However, X-chromosome inactivation studies of tumors are informative only when interpreted in the context of the clonal composition of the surrounding normal tissue, and in the case of thyroid tissue, such analyses have never been systematically performed in humans. The aim of this study was to determine the embryonal patch size of the human thyroid gland. We performed human androgen receptor (HUMARA) assay-based X-chromosome inactivation analysis on 20 microdissected normal thyroid specimens from 16 female subjects. Monoclonality was observed in 70% of tested specimens, and polyclonal X-inactivation patterns were present in only 30% of specimens. According to our results the monoclonal patch size of normal human thyroid tissue is between 48 mm2 and 128 mm2 (1–4 x 105 thyrocytes). Our data indicate that normal thyroid epithelium is organized into large stem cell-derived monoclonal patches. Therefore, monoclonality in neoplastic and hyperplastic lesions may just be a reflection of normal thyroid epithelium clonal composition.


   Introduction
Top
 Abstract
 Introduction
Patients and Methods
 Results
 Discussion
 References
 
THE MAJORITY OF human tumors are thought to arise and evolve as the progeny of a single genetically altered cell (1). Consequently, information on clonality can be used to distinguish neoplastic from hyperplastic lesions because hyperplasias are considered to be polyclonal. In the case of endocrine neoplasias, the question of clonality is also intertwined with a long-standing debate regarding the initial pathogenetic factors involved in endocrine tumorigenesis. Given that endocrine neoplasms are very common, with incidental adrenal adenomas, pituitary adenomas, thyroid adenomas, and microcarcinomas, each affecting at least 5% of the population (2, 3, 4, 5, 6), it has been proposed that the constant stimulus of trophic factors, to which most endocrine glands are exposed, could eventually lead to neoplastic transformation. Although once widely held, this hypothesis has been displaced on the basis of tumor clonality studies reported over the last decade. These studies indicate that most endocrine neoplasms are monoclonal (7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19).

To be convincing, tumor clonality studies should ideally demonstrate tumor monoclonality by showing concordant somatic genetic changes in all tumor cells. However, because of technical limitations, the majority (but not all) of human tumor clonality studies, including those addressing endocrine tumor clonality, have instead been based on X-chromosome inactivation analysis. During early embryonic development of mammalian female embryos, one of the two X-chromosomes in each cell is randomly deactivated by the methylation of deoxycytosine residues. Once established, genetic imprinting retains X-chromosome inactivation through all subsequent cell divisions. This allows investigators to distinguish active and inactive X-chromosomes in tissues derived from female subjects by combining selective restriction digestion of genomic DNA with methylation sensitive enzymes and subsequent PCR of polymorphic microsatellite loci in proximity of these restriction sites. In a polyclonal tissue such an experiment results in PCR products from both alleles being detectable because some cells will have inactivated one X-chromosome, and other cells will have inactivated the other. By contrast, in a monoclonal tissue, all the cells will be descendent from a single progenitor cell; therefore, all will have inactivated the same X-chromosome, resulting in the finding of the PCR product from only one allele after methylation-sensitive restriction digestion. Based on these principles, monoclonal origins have been confirmed for most human tumors studied (20, 21, 22), including thyroid tumors (8, 12, 15, 16, 19).

However, clonality can be interpreted correctly only as a marker of neoplastic transformation in relation to the clonality of surrounding normal tissue of the same embryological origin. It has been reported that normal epithelial tissues are often organized in monoclonal patches, with all cells within a patch having inactivated the same X-chromosome (23, 24, 25, 26, 27). This makes X-chromosome inactivation-based analysis of lesions arising within such a patch unsuitable for determining whether the lesion is neoplastic or hyperplastic (28, 29). If the embryonic patch is particularly large, then several separate tumors can arise within the patch and appear as a single monoclonal or multifocal tumor, when in fact they are multicentric and have arisen independently from quite distinct portions of the patch (Fig. 1Go). Essentially the probability that a tumor is of monoclonal origin is inversely proportional to the number of cells in the embryonal patch. Consequently, as the patch size increases and the number of cells in the patch increases, the probability that a tumor is truly of monoclonal origin decreases because of the uncertainty that more than one cell within the patch contributed to tumorigenesis. Unfortunately, most X-chromosome inactivation studies of human tumors have not included an assessment of the patch size of the surrounding tissues. The few studies that have examined this question have often demonstrated a large patch size, raising questions about the validity of the conclusions of most published tumor clonality studies (23, 24, 25, 26).



View larger version (102K):
[in this window]
[in a new window]
  		FIG. 1. Schematic depiction of different X-chromosome inactivation patterns in normal female tissues. A, A polyclonal tissue with random distribution of cells, which have inactivated maternal (open circles) or paternal (dark circles) X-chromosomes. B, Another polyclonal tissue with nonrandom distribution of cells, which have inactivated the same X-chromosome in large monoclonal patches. The cells marked with "T" represent tumor cells. X-chromosome inactivation-based tumor clonality assessment is meaningful only for tissues like those depicted in (A), which do not contain large monoclonal patches.

 
In the case of the thyroid gland, none of the published clonality studies have addressed the question of the patch size of the surrounding normal thyroid epithelium in humans. In addition, other methodological problems have plagued some of these reports. Many of these have been summarized in two recent reviews (28, 29). Examples of the identified methodological problems include that thyroid epithelium used as polyclonal control tissue was not microdissected to remove stromal elements, which are of different embryonic origin (30), whereas in another study (12), DNA from blood served as a normal control tissue. Despite such shortcomings the authors of various clonality studies have generally concluded that virtually all thyroid carcinomas and adenomas as well as a substantial proportion of hyperplastic nodules are monoclonal (8, 12, 15, 16, 19). Given that the thyroid gland is a small organ, arising from a tiny submandibular anlage, such conclusions may not be warranted, and it is possible that the thyroid embryonic patch size could be quite large. We therefore assessed the clonal architecture of microdissected normal thyroid epithelium to gain an understanding of the morphogenesis of the normal human thyroid and obtain a framework for interpreting published X-chromosome inactivation-based tumor clonality data.


   Patients and Methods
Top
 Abstract
 Introduction
 Patients and Methods
Results
 Discussion
 References
 
Patients and tissues

We obtained 26 archival thyroid specimens from 22 female subjects. Of these, DNA samples from two subjects could not be PCR amplified and were excluded (see Results). The mean age at thyroid surgery of the remaining 20 subjects was 54.1 yr (range, 19–77). The final diagnoses of the lesions were benign nonneoplastic nodule or nodular hyperplasia in 14 cases, papillary thyroid carcinoma in two cases (one unifocal and one bifocal), follicular adenoma, medullary thyroid carcinoma, and granulomatous foreign body reaction in one case each, and one sample showed no diagnostic abnormalities. All samples had been fixed in 10% phosphate-buffered formalin and embedded in paraffin by standard methods. For each case, we selected either slides that contained significant amounts of morphologically normal-appearing thyroid epithelium in addition to any lesion or, if available, slides from the contralateral thyroid lobe. For the papillary thyroid carcinoma specimens, we also selected slides containing tumor tissue.

We used six samples of archival normal large bowel tissue, in which the known patch size is a single crypt (31), from human androgen receptor (HUMARA)-repeat heterozygote females (see below) as polyclonal controls. Two normal archival male thyroid samples, with their single unmethylated X-chromosome, served as hemizygous/digestion controls.

Microdissection, DNA extraction, and cell counting

We sectioned paraffin-embedded blocks of formalin-fixed tissues at 6- to 8-µm thickness and mounted several sections onto standard microscopic slides without adhesive. For each specimen one of these slides was stained with hematoxylin and eosin and the remainder were left unstained. An anatomical pathologist (B.D.) with extensive experience in microdissection manually microdissected normal follicular thyroid tissue from the unstained slides using a stereomicroscope and sterile surgical blades, avoiding any morphologically abnormal follicular epithelial structures and any regions containing significant amounts of stromal tissue. For the two papillary carcinoma specimens, tumor tissue was also selectively microdissected in the same fashion, in the case of the bifocal tumor separately for each focus. During microdissection the stained slides from the same specimens served as dissection templates. We collected the microdissected tissues into sterile microcentrifuge tubes and, without prior deparaffinization of the tissue, extracted the DNA by adding 200 µl extraction buffer [100 mM Tris-HCl and 2 mM EDTA (pH 8.0)] and 500 µg proteinase K, followed by 48 h of digestion at 55 C, with an additional 500 µg proteinase K added after the initial 12 h of incubation.

Following microdissection the remaining tissues on the unstained slides were stained with hematoxylin and eosin. We then compared these slides with the matching stained dissection-template slides to estimate the microdissected surface areas and numbers of normal follicular cells that had been microdissected. Using an integration grid of 5 x 5 = 25 boxes measuring 0.828 mm2 at x100 magnification, we counted 5 x 0.828 mm2 areas and calculated average cell n per square millimeter. The number of normal follicular cells in a sample was then calculated by multiplying the cells per square millimeter with the measured microdissected area.

Raw DNA purification

Crude archival male control DNA failed to be digested to completion with the methylation-sensitive restriction enzymes (HpaII and HhaI) used in our study, suggesting that the crude archival DNA samples contained restriction enzyme inhibitors. To remove these putative inhibitors, we purified the raw DNA samples after the proteinase K digestion. We extracted the crude DNA samples three times with Tris-buffer saturated phenol-chloroform (1:1, pH 8.0) and once with chloroform. Phase divider gel tubes (Sigma-Aldrich Corp., St. Louis, MO) were used during organic extraction to facilitate the recovery of samples without contamination by solvents or denatured proteins. After organic extraction, we added a 10% volume of 25% Chelex 100 resin (Bio-Rad Laboratories, Inc., Hercules, CA) in water to the samples and incubated them for 15 min at room temperature. The Chelex beads were removed by centrifugation, and we added one third volume of 7.5 M ammonium acetate and 2.5 volumes of ice-cold absolute ethanol to the supernatant of each tube and precipitated the DNA at -20 C for 24 h. Ten micrograms nuclease free glycogen (Roche, Basel, Switzerland) were added to each sample as a carrier, and the samples were centrifuged at 4 C at 21,000 x g for 60 min. The resulting precipitates were washed with 70% ethanol, air dried, and resuspended in ultrapure water. Finally, we determined the DNA concentration of the purified samples fluorometrically (PicoGreen assay, Molecular Probes, Inc., Eugene, OR) and stored them in sterile, sealed tubes at 4 C. The organic extraction and Chelex treatment allowed complete digestion of male archival control DNA samples.

HUMARA X-chromosome inactivation assay

The majority of recent work relating to assessment of clonality has been performed using the HUMARA (human androgen receptor gene, Xq13) assay (32). In the first exon of the X-linked HUMARA gene, there are two HhaI and two HpaII restriction sites, which are located less than 100 bp 5' to a highly polymorphic CAG microsatellite repeat. X-chromosome inactivation is associated with methylation of these restriction sites. Digestion with methylation-sensitive endonucleases followed by PCR amplification with primers flanking these restriction sites, and the repeat can be used to distinguish between transcriptionally active and inactive X-chromosomes in tissues of heterozygous female subjects.

We used a modified HUMARA assay similar to that described by Kopp et al. (33). We incubated 600–800 ng purified DNA in a final volume of 40 µl with 40 U of HhaI (Amersham Pharmacia Biotech AB, Uppsala, Sweden) in potassium acetate digestion buffer [50 mM K-acetate, 10 mM Mg-acetate, 20 mM Tris-acetate, 1 mM dithiothreitol, and 1 µg/ml BSA (pH 7.9)] at 37 C for 12 h. Heating to 70 C for 20 min terminated the reactions. For each sample we included a positive control reaction using MspI, a nonmethylation-sensitive isoschizomer of HhaI, and a negative control reaction, containing only DNA but no enzyme. In addition, each set of experiments also included both a polyclonal (female bowel) and a hemizygous (male thyroid) control sample.

We PCR amplified paired digested and control samples using 5'-hexachlorofluorescein phosphoaramidite-labeled primers. The PCR reactions contained 2.5 µl of digested or undigested DNA in a 25-µl PCR mix of sterile distilled H2O containing 50 mM KCl, 10 mM Tris-HCl, 1.5 mM MgCl2 (pH 8.3), 250 µM deoxynucleotide triphosphates, 500 nM of each primer, and 0.2 µl (1 U) Taq polymerase (Roche). The primer sequences were (32): TCCAGAATCTGTTCCAGAGCGTGC (sense, labeled with 5'-hexachlorofluorescein phosphoaramidite) and GCTGTGAAGGTTGCTGTTCCTCAT (antisense; all primers were synthesized by the Mayo Clinic Oligo-Nucleotide Core Facility). The cycling conditions were: hold at 95 C for 5 min; seven cycles 95 C (45 sec), 67 C (30 sec), 72 C (30 sec); five cycles 95 C (45 sec), 65 C (30 sec), 72 C (30 sec); 28 cycles 95 C (45 sec), 63 C (30 sec), 72 C (30 sec); and hold at 72 C for 15 min. We amplified all samples in duplicate.

We size separated the PCR products on an automated DNA sequencer (ABI-377, Applied Biosystems, Foster City, CA) and analyzed the results using GeneScan 3.1.2 software (Applied Biosystems), with the allele peak heights serving as a semiquantitative measure of the amount of PCR product amplified from each allele. To correct for possible preferential amplification of one allele, we calculated a corrected allele ratio for each HhaI digested and negative control sample pair. This corrected ratio was derived by dividing the ratio of the undigested allele1 and the digested allele1 by the ratio of the undigested allele2 and the digested allele2. We defined samples as monoclonal if this corrected ratio was less than 0.33 or above 3 (33). Polyclonal tissues with random X-inactivation patterns would be expected to have ratios equal or close to 1.0.


   Results
Top
 Abstract
 Introduction
 Patients and Methods
 Results
Discussion
 References
 
We obtained 26 archival thyroid specimens from 22 female subjects for this study (Table 1Go). First, we assessed DNA samples from all subjects for heterozygosity at the HUMARA locus. Samples from two subjects failed to amplify and were excluded from further studies. Four subjects were homozygous and noninformative (20%), and the remaining 16 (80%) were heterozygous and informative. For two of these 16 patients, we examined multiple sections representing different, physically distinct regions of the thyroid gland, so 20 heterozygous specimens in total were tested for clonality.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Summary of specimens characteristics

 
Of 20 specimens tested, six (30%) from six patients (37.5%) had a random pattern of X-chromosome inactivation, but in the remaining 14 specimens (70%) from 10 patients (62.5%), nonrandom patterns of X-chromosome inactivation were observed (Table 2Go and Fig. 2Go). Moreover, only one of the samples with random inactivation patterns displayed a corrected allele ratio of close to 1.0; the other five samples displayed corrected allele ratios of between 0.3 and 0.5 or between 2.33 and 3. Previous studies have sometimes considered ratios of less than 0.5 or greater than 2 as indicative of monoclonality (34).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Detailed HUMARA assay results

 


View larger version (23K):
[in this window]
[in a new window]
  		FIG. 2. Examples of HUMARA assay of monoclonal (panels I, sample ID 13) and polyclonal (panels II, sample ID 8) heterozygous normal female thyroid samples. Panels Ia and IIa show the two alleles of the HUMARA locus amplified without predigestion with restriction endonuclease HhaI. Panel Ib shows that following HhaI digestion of the specimen depicted in panel Ia, PCR fails to amplify the shorter of the two HUMARA alleles, indicating that the sample is monoclonal. By contrast, panel IIb shows that both HUMARA alleles, which are present in panel IIa, can still be amplified following HhaI digestion, suggesting polyclonality. Allele sizes are indicated at the top in base pairs, alleles and allele stutter in black outlines, size markers in gray outlines.

 
The shorter allele was inactivated in 3 of 14 samples with nonrandom X-inactivation, but in 11 of 14 samples, the longer allele was present after digestion. For the monoclonal samples, the areas on slides containing analyzed tissue were between 48 and 128 mm2 (mean, 88 mm2; SD, 22 mm2) corresponding to between 1 and 4 x 105 thyrocytes. For the six polyclonal samples, the sizes of the microdissected areas ranged from 79 mm2 to 123 mm2 (mean, 102 mm2; SD, 17 mm2), not significantly different from the monoclonal samples (Table 2Go).

For one subject, normal thyroid epithelium from four separate tissue blocks removed from both lobes of the gland was assessed, and nonrandom X-inactivation patterns were observed in all of them (Table 2Go); in all four samples, the longer allele was amplified following digestion with HhaI. Two separate samples taken from the left and right lobes of the thyroid were available for another subject. Both samples had nonrandom X-chromosome inactivation patterns, but different alleles were inactivated in the two sections; in the sample taken from the left lobe, the longer allele was inactivated, but in the right-lobe sample, the smaller allele was present after HhaI digestion (Fig. 3Go).



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 3. Preferential inactivation of different parental X-chromosomes in the left (panels I, sample ID 19A) and right (panels II, sample ID 19B) thyroid lobes of the same patient. Panels Ia and IIa show HUMARA PCR amplification of undigested samples; panels Ib and IIb show results of amplification after HhaI digestion. Allele sizes are indicated at the top in base pairs, alleles and allele stutter in black outlines, size markers in gray outlines.

 
The unifocal papillary thyroid carcinoma appeared polyclonal. The bifocal tumor was monoclonal, but both foci had inactivated a different X-chromosome from the surrounding, also monoclonal, nontumorous tissues (Fig. 4Go).



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 4. Different monoclonal X-chromosome inactivation patterns in normal thyroid epithelium (panels I, sample ID 18) and two physically distinct portions of a bifocal papillary thyroid carcinoma (panels II, sample ID 18 T1, and panels III, sample ID 18 T2) in the same female patient. Panels Ia, IIa, and IIIa show HUMARA PCR amplification of undigested samples; panels Ib, IIb, and IIIb show results of amplification after HhaI digestion. Allele sizes are indicated at the top in base pairs, alleles and allele stutter in black outlines, size markers in gray outlines.

 
In five specimens of normal large bowel samples, a random pattern of X-chromosome inactivation was present as expected. However, in one bowel sample, a nonrandom pattern of X-chromosome inactivation was observed, with complete disappearance of a longer allele after the digestion.


   Discussion
Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
References
 
In this study, X-chromosome inactivation analysis revealed that in the majority of informative cases, normal thyroid follicular epithelium displayed nonrandom patterns of X-chromosome inactivation (Fig. 1BGo). These results indicate that monoclonality in thyroid epithelium is not restricted to neoplastic processes but that large portions of normal tissue are also monoclonally derived. It is unlikely that these results are chance findings or related to experimental methodology (e.g. the use of paraffin-embedded specimens). The majority of previous clonality studies of tumors have also used such specimens, and the methodology has proved robust. Random allele dropout can occur in microsatellite PCR analysis of DNA derived from formalin-fixed, paraffin-embedded specimens, a potential problem we are well aware of (35). However, allele dropout occurs mainly with low amplifiable DNA inputs, which we avoided, and affects preferentially the longer allele, the reverse of what we observed in our study (36). Also, one would expect this to affect negative controls, which were treated exactly the same way as the digested samples. Finally and most compellingly, we had some initial problems with achieving complete digestion of samples, rather than spurious allele loss, and in fact had to optimize the published HUMARA assay to overcome this limitation (37).

From this perspective it is interesting to speculate whether incomplete digestion may have been an unrecognized problem in some previous tumor clonality studies using the HUMARA assay and might have contributed to erroneous clonality assessment. We therefore believe that our data are reliable and the human thyroid gland exhibits a large embryonal patch size. Consequently, X-inactivation analysis may not be the appropriate tool to study clonal composition of thyroid tumors or distinguish thyroid hyperplasias from neoplasms.

This may call into question the relevance of thyroid tumor clonality studies with regard to the mechanisms of thyroid tumorigenesis, at least as far as studies of paraffin-embedded specimens are concerned (8). In particular, unless there is direct evidence of concordant tumor somatic genetic changes, suggestions that somatic mutations in unknown genes are the reason for the apparent frequent monoclonal origin of benign solitary thyroid nodules (38, 39, 40) may need to be reconsidered because the monoclonality in these lesions may simply reflect the clonal architecture of normal thyroid epithelium from which they have arisen. To truly demonstrate monoclonality, postulated somatic genetic changes have to be directly demonstrated, rather than inferred on the basis of apparent X-inactivation monoclonality, a gold standard that has not often been achieved in tumor clonality studies. It may well be that in endocrine glands the tissue context and variant abilities of individual cells to interpret growth-regulating signals derived from neighboring cells and through trophic hormones are more important factors in tumorigenesis than acquisition of a series of defined tumorigenic somatic genetic changes. X-chromosome inactivation assays have long been used to study clonal composition of human tumors. Unfortunately, the fact that epithelial tissues are often organized in patches consisting of groups of cells inactivating the same X-chromosome has largely been ignored. Erroneous interpretation of tumor clonality assessments will result if the question of patch size is not considered or if normal control tissue is derived from a sample that is significantly larger than a single patch, consists of several mixed tissues, or is derived from a completely different tissue. Previous studies performed on human thyroids have not been an exception to these methodological shortcomings, and although this has been discussed in some detail in two recent reviews (28, 29), it is not appreciated by most thyroidologists.

Our results are not surprising when taken in the context of the known embryonic development of the human thyroid gland. The thyroid is a small organ, arising from a small, tightly clustered group of submandibular embryonic thyroid stem cells, which migrate caudally along the thyroglossal duct early in embryogenesis. Given the small pool of cells present at the time of X-inactivation and restricted cell mixing, there is a high probability that large portions of follicular tissue will have the same X-chromosome inactivated. The exact size of the thyroid epithelial patch size is difficult to estimate because, unlike other epithelial tissues, thyroid follicular tissue does not form epithelial sheets. In cross-bred animals with X-chromosome-encoded enzyme polymorphisms, histochemistry can nonetheless directly delineate the two-dimensional boundaries of a thyroid epithelial patch (19, 41). Unfortunately, this is usually not possible in humans, but occasionally the patch boundaries can be inferred. One example is when normal tissue abutting a tumor has inactivated a different HUMARA allele than the tumor tissue. We identified one such case when we examined a small number of thyroid tumors along with matching normal thyroid epithelium, with one allele being inactivated in the normal gland, while the bifocal tumor had inactivated the other (Fig. 4Go). However, even in this case completely accurate assessment of patch size is impossible.

Follicles are three-dimensional structures, formed by the budding of new follicles in different directions from preexisting ones. With the lack of microanatomical structures to guide the direction that tissue is cut during pathological sectioning and microdissection, distant portions of the thyroid may be included on a single slide and consequently in a microdissected sample. As a result, a random X-chromosome inactivation pattern may be observed in a sample, despite large portions of tissue having inactivated the same X-chromosome. Bearing these limitations in mind, which will likely result in an underestimation of clonal unit size, we still detected that areas on slides containing monoclonal-derived tissue were very large, between 48 and 128 mm2, equating to approximately 1–4 x 105 thyrocytes. Of course, neighboring patches have a 50% likelihood of inactivating the same X-chromosome, and the actual patch size could be somewhat smaller. On the other hand, the thyroid gland is a three-dimensional structure and the actual number of cells in a patch may well be significantly larger. Without serial sections this cannot be estimated accurately. In any case, in combination with the fact that we observed so few cases with random X-inactivation, our data suggest that the embryonal patch size within the thyroid exceeds significantly the dimensions of embryonal patches in most other studied organs, such as cervical tissue (20), vascular smooth muscle tissue (25), urothelium (24), skin (27), and breast (23, 26).

The limited availability of archival normal human thyroid tissue did not allow us to test the clonality patterns in whole glands or narrow the thyroid patch size down more precisely. However, for two thyroid glands tested, specimens from both lobes were available. Nonrandom X-inactivation pattern was found in both cases in all sections studied. In one patient, different parental alleles were inactivated in left and right lobes, suggesting a minimum of two stem cells. In the other patient, the same allele was inactivated in all four sections examined from both lobes. The latter case implies that this thyroid gland may have been derived from a single progenitor cell or more likely represents a case of extreme skewing in X-inactivation. Preferential inactivation of one parental X-chromosome has been observed in different tissues of healthy individuals as well as a cause of human disease. Guo et al. (20) reported three patients with the same, nonrandom pattern of X-inactivation present in normal admixed cervical tissue and matched epithelium sampled from three different sites, and Gale et al. (42) found that 20% of hematologically normal subjects showed greater than 75% inactivation of the same X-chromosome in all tissues tested (granulocytes, T-lymphocytes, skin, and muscle). Such extreme preferential inactivation probably just reflects the randomness of the inactivation process; although the majority of females have relatively equal proportions of maternal and paternal X-chromosomes inactivated, a small number of individuals will, just by chance, demonstrate predominately maternal or paternal X-chromosome inactivation. Finding of extreme preferential inactivation in one of the normal bowel samples, supposed to serve as a polyclonal control, can be explained in this way.

Finally, our results should rekindle the discussion about the role of trophic hormone effects in endocrine tumor promotion. Whereas in its classical form the trophic hormone theory is most likely incorrect, trophic hormones may play a permissible and tumor-promoting role. For instance, in rodents, elevated TSH levels alone are sufficient for thyroid tumor development, and humans with chronically elevated TSH levels, as is, for example, seen in thyroid dyshormonogenesis syndromes, have a higher-than-average risk of developing thyroid neoplasms (43, 44). It is now widely acknowledged that the normal thyroid gland is characterized by a degree of somatic genetic heterogeneity (29). Constant trophic hormone stimulation may well exaggerate existing intrinsic differences in growth potential between cells and in turn lead to accumulation of further somatic genetic changes through accelerated proliferation of clones that possess slightly increased trophic hormone responsiveness or intrinsic growth potential. Eventually this may lead to tumor formation. However, despite the plausibility of this scenario, even the modified trophic hormone theories have been largely abandoned in recent years because multiple X-chromosome inactivation studies seemed to show that endocrine neoplasms are monoclonally derived.

In light of our findings of a very large patch size, at least in the thyroid gland, it appears that the relevance of these studies as to endocrine tumorigenesis needs to be questioned. It is interesting to consider that other small endocrine glands, in particular the pituitary with its several distinct cell types occurring in a very small volume, might well also have large embryonal patch sizes, raising the question of whether such tumors are monoclonal or polyclonal. This in turn opens the door for reconsidering both a cancer field effect and a modified trophic stimulus theory for the etiology of some thyroid or pituitary tumors. Such a hypothesis could account for the finding that many papillary thyroid carcinomas are multicentric. A similar hypothesis of trophic tumorigenesis could explain why many cases of functioning pituitary tumors, particularly in Cushing’s disease, show no distinct tumor and, perhaps, why recurrence occurs so frequently, despite apparent complete removal of the tumor (45, 46). In pituitary neoplasms, supportive evidence for this hypothesis exists in the form of feedback tumors, such as is observed sometimes in long-term undertreated Addison’s disease, and in thyroid neoplasia, the tumorigenic effects of trophic hormones may be at the root of the increased thyroid tumor incidence in patients with thyroid dyshormonogenesis.


   Acknowledgments
 
We thank Ann Thornton and Joan Nicoll for technical support.


   Footnotes
 
This work was supported by a grant from the Cancer Society of New Zealand (to S.K.G.G.), NIH Grant CA80117 (to N.L.E.), and funds from the Wellington School of Medicine and Health Sciences and the Mayo Foundation and Clinic.

Abbreviation: HUMARA, Human androgen receptor gene.

Received October 4, 2002.

Accepted April 4, 2003.


   References
Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 

  1. Knudson AG 1993 Antioncogenes and human cancer. Proc Natl Acad Sci USA 90:10914–10921[Abstract/Free Full Text]
  2. Bertherat J, Mosnier-Pudar H, Bertagna X 2002 Adrenal incidentalomas. Curr Opin Oncol 14:58–63[CrossRef][Medline]
  3. Bondeson L, Ljungberg O 1981 Occult thyroid carcinoma at autopsy in Malmo, Sweden. Cancer 47:319–323[CrossRef][Medline]
  4. Delides GS, Elemenoglou J, Lekkas J, Kittas C, Evthimiou C 1987 Occult thyroid carcinoma in a Greek population. Neoplasma 34:119–125[Medline]
  5. Molitch ME, Russell EJ 1990 The pituitary "incidentaloma." Ann Intern Med 112:925–931
  6. Komorowski RA, Hanson GA 1988 Occult thyroid pathology in the young adult: an autopsy study of 138 patients without clinical thyroid disease. Hum Pathol 19:689–696[CrossRef][Medline]
  7. Asa SL, Ezzat S 1998 The cytogenesis and pathogenesis of pituitary adenomas. Endocr Rev 19:798–827[Abstract/Free Full Text]
  8. Chung DH, Kang GH, Kim WH, Ro JY 1999 Clonal analysis of a solitary follicular nodule of the thyroid with the polymerase chain reaction method. Mod Pathol 12:265–271[Medline]
  9. Beuschlein F, Reincke M, Karl M, Travis WD, Jaursch-Hancke C, Abdelhamid S, Chrousos GP, Allolio B 1994 Clonal composition of human adrenocortical neoplasms. Cancer Res 54:4927–4932[Abstract/Free Full Text]
  10. Alexander JM, Biller BM, Bikkal H, Zervas NT, Arnold A, Klibanski A 1990 Clinically nonfunctioning pituitary tumors are monoclonal in origin. J Clin Invest 86:336–340
  11. Gicquel C, Le Bouc Y, Luton JP, Girard F, Bertagna X 1992 Monoclonality of corticotroph macroadenomas in Cushing’s disease. J Clin Endocrinol Metab 75:472–475[Abstract]
  12. Hicks DG, LiVolsi VA, Neidich JA, Puck JM, Kant JA 1990 Clonal analysis of solitary follicular nodules in the thyroid. Am J Pathol 137:553–562[Abstract]
  13. Herman V, Fagin J, Gonsky R, Kovacs K, Melmed S 1990 Clonal origin of pituitary adenomas. J Clin Endocrinol Metab 71:1427–1433[Abstract/Free Full Text]
  14. Farrell WE, Clayton RN 2000 Molecular pathogenesis of pituitary tumors. Front Neuroendocrinol 21:174–198[CrossRef][Medline]
  15. Kim H, Piao Z, Park C, Chung WY, Park CS 1998 Clinical significance of clonality in thyroid nodules. Br J Surg 85:1125–1128[CrossRef][Medline]
  16. Namba H, Matsuo K, Fagin JA 1990 Clonal composition of benign and malignant human thyroid tumors. J Clin Invest 86:120–125
  17. Ray D, Melmed S 1997 Pituitary cytokine and growth factor expression and action. Endocr Rev 18:206–228[Abstract/Free Full Text]
  18. Schulte HM, Oldfield EH, Allolio B, Katz DA, Berkman RA, Ali IU 1991 Clonal composition of pituitary adenomas in patients with Cushing’s disease: determination by X-chromosome inactivation analysis. J Clin Endocrinol Metab 73:1302–1308[Abstract/Free Full Text]
  19. Thomas GA, Williams D, Williams ED 1989 The clonal origin of thyroid nodules and adenomas. Am J Pathol 134:141–147[Abstract]
  20. Guo Z, Thunberg U, Sallstrom J, Wilander E, Ponten J 1998 Clonality analysis of cervical cancer on microdissected archival materials by PCR-based X-chromosome inactivation approach. Int J Oncol 12:1327–1332[Medline]
  21. Going JJ, Abd El-Monem HM, Craft JA 2001 Clonal origins of human breast cancer. J Pathol 194:406–412[Medline]
  22. Willman CL, Busque L, Griffith BB, Favara BE, McClain KL, Duncan MH, Gilliland DG 1994 Langerhans’-cell histiocytosis (histiocytosis X)—a clonal proliferative disease. N Engl J Med 331:154–160[Abstract/Free Full Text]
  23. Tsai YC, Lu Y, Nichols PW, Zlotnikov G, Jones PA, Smith HS 1996 Contiguous patches of normal human mammary epithelium derived from a single stem cell: implications for breast carcinogenesis. Cancer Res 56:402–404[Abstract/Free Full Text]
  24. Tsai YC, Simoneau AR, Spruck 3rd CH, Nichols PW, Steven K, Buckley JD, Jones PA 1995 Mosaicism in human epithelium: macroscopic monoclonal patches cover the urothelium. J Urol 153:1697–1700[CrossRef][Medline]
  25. Chung IM, Schwartz SM, Murry CE 1998 Clonal architecture of normal and atherosclerotic aorta: implications for atherogenesis and vascular development. Am J Pathol 152:913–923[Abstract]
  26. Diallo R, Schaefer KL, Poremba C, Shivazi N, Willmann V, Buerger H, Dockhorn-Dworniczak B, Boecker W 2001 Monoclonality in normal epithelium and in hyperplastic and neoplastic lesions of the breast. J Pathol 193:27–32[CrossRef][Medline]
  27. Chaturvedi V, Chu MS, Carrol BM, Brenner BJ, Nickoloff BJ 2002 Estimation of size of clonal unit for keratinocytes in normal human skin. Arch Pathol Lab Med 126:420–424[Medline]
  28. Levy A 2001 Monoclonality of endocrine tumors: what does it mean? Trends Endocrinol Metab 12:301–307[CrossRef][Medline]
  29. Derwahl M, Studer H 2002 Hyperplasia versus adenoma in different endocrine tissues: are they different? Trends Endocrinol Metab 13:23–28[CrossRef][Medline]
  30. Fey MF, Peter HJ, Hinds HL, Zimmermann A, Liechti-Gallati S, Gerber H, Studer H, Tobler A 1992 Clonal analysis of human tumors with M27 beta, a highly informative polymorphic X chromosomal probe. J Clin Invest 89:1438–1444
  31. Novelli MR, Williamson JA, Tomlinson IP, Elia G, Hodgson SV, Talbot IC, Bodmer WF, Wright NA 1996 Polyclonal origin of colonic adenomas in an XO/XY patient with FAP. Science 272:1187–1190[Abstract]
  32. Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW 1992 Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. Am J Hum Genet 51:1229–1239[Medline]
  33. Kopp P, Jaggi R, Tobler A, Borisch B, Oestreicher M, Sabacan L, Jameson JL, Fey MF 1997 Clonal X-inactivation analysis of human tumours using the human androgen receptor gene (HUMARA) polymorphism: a non-radioactive and semiquantitative strategy applicable to fresh and archival tissue. Mol Cell Probes 11:217–228[CrossRef][Medline]
  34. Moniz S, Catarino AL, Marques AR, Cavaco B, Sobrinho L, Leite V 2002 Clonal origin of non-medullary thyroid tumours assessed by non-random X-chromosome inactivation. Eur J Endocrinol 146:27–33[Abstract]
  35. Farrand K, Jovanovic L, Delahunt B, McIver B, Hay ID, Eberhardt NL, Grebe SKG 2002 Loss of heterozygosity studies revisited—prior quantification of amplifiable DNA content of archival samples improves efficiency and reliability. J Mol Diagn 4:150–158[Abstract/Free Full Text]
  36. Liu J, Zabarovska VI, Braga E, Alimov A, Klein G, Zabarovsky ER 1999 Loss of heterozygosity in tumor cells requires re-evaluation: the data are biased by the size-dependent differential sensitivity of allele detection. FEBS Lett 462:121–128[CrossRef][Medline]
  37. Jovanovic L, Delahunt B, McIver B, Eberhardt NL, Grebe SKG 2003 Optimising restriction enzyme cleavage of DNA derived from archival histopathological samples: an improved HUMARA assay. Pathology 35:70–74[CrossRef][Medline]
  38. Kopp P, Kimura ET, Aeschimann S, Oestreicher M, Tobler A, Fey MF, Studer H 1994 Polyclonal and monoclonal thyroid nodules coexist within human multinodular goiters. J Clin Endocrinol Metab 79:134–139[Abstract]
  39. Krohn K, Fuhrer D, Holzapfel HP, Paschke R 1998 Clonal origin of toxic thyroid nodules with constitutively activating thyrotropin receptor mutations. J Clin Endocrinol Metab 83:130–134[Abstract/Free Full Text]
  40. Krohn K, Reske A, Ackermann F, Muller A, Paschke R 2001 Ras mutations are rare in solitary cold and toxic thyroid nodules. Clin Endocrinol 55:241–248[CrossRef][Medline]
  41. Thomas GA, Williams D, Williams ED 1988 the demonstration of tissue clonality by X-linked enzyme histochemistry. J Pathol 155:101–108[CrossRef][Medline]
  42. Gale RE, Wheadon H, Boulos P, Linch DC 1994 Tissue specificity of X-chromosome inactivation patterns. Blood 83:2899–2905[Abstract/Free Full Text]
  43. IARC Panel 1999 Consensus report. In: Capen CC, Dybing E, Rice JM, Wilbourn JD, eds. Species differences in thyroid, kidney and urinary bladder carcinogenesis. IARC Scientific Publication No. 147. Lyon: International Agency for Research on Cancer; 1–14
  44. Thomas GA, Williams ED 1999 Thyroid stimulating hormone (TSH)-associated follicular hypertrophy and hyperplasia as a mechanism of thyroid carcinogenesis in mice and rats. In: Capen CC, Dybing E, Rice JM, Wilbourn JD, eds. Species differences in thyroid, kidney and urinary bladder carcinogenesis. IARC Scientific Publication No. 147. Lyon: International Agency for Research on Cancer; 45–59
  45. Kruse A, Klinken L, Holck S, Lindholm J 1992 Pituitary histology in Cushing’s disease. Clin Endocrinol 37:254–259[Medline]
  46. Burke CW, Adams CB, Esiri MM, Morris C, Bevan JS 1990 Transsphenoidal surgery for Cushing’s disease: does what is removed determine the endocrine outcome? Clin Endocrinol 33:525–537[Medline]



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
R. P. McCarthy, M. Wang, T. D. Jones, R. W. Strate, and L. Cheng
Molecular Evidence for the Same Clonal Origin of Multifocal Papillary Thyroid Carcinomas
Clin. Cancer Res., April 15, 2006; 12(8): 2414 - 2418.
[Abstract] [Full Text] [PDF]

Home page
 NEJMHome page
T. M. Shattuck, W. H. Westra, P. W. Ladenson, and A. Arnold
Independent Clonal Origins of Distinct Tumor Foci in Multifocal Papillary Thyroid Carcinoma
N. Engl. J. Med., June 9, 2005; 352(23): 2406 - 2412.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
K. Krohn, D. Fuhrer, Y. Bayer, M. Eszlinger, V. Brauer, S. Neumann, and R. Paschke
Molecular Pathogenesis of Euthyroid and Toxic Multinodular Goiter
Endocr. Rev., June 1, 2005; 26(4): 504 - 524.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jovanovic, L.
Right arrow Articles by Grebe, S. K. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jovanovic, L.
Right arrow Articles by Grebe, S. K. G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals