help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Albrecht, E. D.
Right arrow Articles by Pepe, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Albrecht, E. D.
Right arrow Articles by Pepe, G. J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*PROGESTERONE
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 6 2844-2852
Copyright © 2003 by The Endocrine Society

Acute Temporal Regulation of Vascular Endothelial Growth/Permeability Factor Expression and Endothelial Morphology in the Baboon Endometrium by Ovarian Steroids

Eugene D. Albrecht, Graham W. Aberdeen, Andrea L. Niklaus, Jeffery S. Babischkin, Donna L. Suresch and Gerald J. Pepe

Departments of Obstetrics, Gynecology, Reproductive Sciences and Physiology (E.D.A., G.W.A., A.L.N., J.S.B., D.L.S.), Center for Studies in Reproduction, University of Maryland School of Medicine, Baltimore, Maryland 21201; and Department of Physiological Sciences (G.J.P.), Eastern Virginia Medical School, Norfolk, Virginia 23501

Address all correspondence and requests for reprints to: Eugene D. Albrecht, Ph.D., Department of Obstetrics, Gynecology and Reproductive Sciences, The University of Maryland School of Medicine, Bressler Research Laboratories 11-019, 655 West Baltimore Street, Baltimore, Maryland 21201. E-mail: ealbrech{at}umaryland.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We recently showed that endometrial vascular endothelial growth/permeability factor (VEG/PF) mRNA expression was decreased by ovariectomy of baboons and restored by chronic administration of estrogen. However, it remains to be determined whether this effect of estrogen reflects genomic up-regulation of VEG/PF and leads to an increase in microvascular permeability, an early physiological event in angiogenesis. Therefore, we determined the temporal expression of VEG/PF mRNA in glandular epithelial and stromal cells isolated by laser capture microdissection from and width of microvascular paracellular clefts that regulate vessel permeability in the endometrium of ovariectomized baboons after acute estradiol and/or progesterone administration.

Endometrial VEG/PF mRNA levels were increased in five of five animals within 2 h of estradiol administration and remained elevated at 4 and 6 h. The net increase in glandular epithelial (7.31 ± 2.72 attomol/fmol 18S ribosomal rRNA) and stromal (3.13 ± 0.36) cell VEG/PF mRNA levels after estradiol administration was over 8-fold (P < 0.05) and 2.6-fold (P < 0.01) greater, respectively, than after vehicle (0.90 ± 0.30, glands and 1.20 ± 0.33, stroma). In contrast, endometrial VEG/PF mRNA expression was unaltered by progesterone. After estradiol treatment, endometrial paracellular cleft width was increased (P < 0.01) from a mean (±SE) of 71.6 ± 4.6 nm at 0 h to 101.1 ± 6.4 nm at 6 h, whereas vehicle or progesterone had no effect. We suggest that estrogen has a major role in regulating VEG/PF synthesis and early events in angiogenesis in the primate endometrium.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE OVARIAN STEROID hormones, estrogen and progesterone, appear to have an important role in developing the uterine endometrial vascular system during each menstrual cycle to promote growth and cellular differentiation for potential implantation (1, 2). Vascular endothelial growth/permeability factor (VEG/PF) has a well established role in angiogenesis (3), including microvascular permeability, an early step apparently critical for angiogenesis (4, 5), and possibly implantation (6). Although estrogen stimulated VEG/PF expression in vivo in the rat (7, 8) and sheep (9) uterus, relatively little is known about the regulation of VEG/PF expression and microvascular permeability in the human endometrium. The latter reflects the difficulty in conducting in vivo studies in the human to show a potential cause and effect relationship between steroid hormones and endometrial angiogenesis.

Using the baboon as a nonhuman primate model for the study of human reproductive endocrinology, we (10, 11) recently showed that endometrial glandular epithelial and stromal cell VEG/PF mRNA and protein expression was markedly decreased by ovariectomy and restored to normal by chronic administration of estrogen in levels that replicated the late proliferative/mid cycle estrogen surge phase of the menstrual cycle. Stimulatory effects of chronic estrogen administration on endometrial VEG/PF expression were also recently shown in the ovariectomized rhesus monkey by Nayak and Brenner (12). However, because long-term administration of steroid hormone may cause cellular differentiation, it remains to be determined whether the elevation in endometrial VEG/PF mRNA levels in primates treated chronically with estrogen reflected genomic up-regulation of VEG/PF. Moreover, it is not known whether an acute increase in endometrial VEG/PF expression in the primate leads to physiological events important to the process of angiogenesis, such as alteration in microvascular permeability.

In the present study, therefore, the temporal expression of VEG/PF mRNA levels was determined in glandular epithelial and stromal cells isolated by laser capture microdissection (LCM) from the endometrium of ovariectomized baboons after acute administration of estradiol and/or progesterone. Concurrently, the width of paracellular clefts between adjacent endometrial microvascular endothelial cells, which are comprised of tight junctions important in regulating vessel permeability, was also determined in baboons and correlated temporally with the expression of VEG/PF.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

Young (6–8 yr old) adult female baboons (Papio anubis) originally obtained from the Southwest Foundation for Biomedical Research (San Antonio, TX) and weighing 12–15 kg were used in this study. Primarily nulliparous and a few multiparous (i.e. one or two prior pregnancies) baboons were used in this study. However, similar results for endometrial responsivity to steroid hormone were obtained in each instance. Baboons were housed individually in large primate cages in air-conditioned rooms, 12-h light, 12-h dark cycle, and received 20% protein primate chow (2050 Primate Diet, Harlan, Madison, WI) and fresh fruit twice daily and water ad libitum. Baboons were cared for and used strictly in accordance with U.S. Department of Agriculture regulations and the NIH Guide for the Care and Use of Laboratory Animals (Publication no. 86-23, 1985). The experimental protocols used in the present study were approved by the Institutional Animal Care and Use Committee of the University of Maryland School of Medicine.

Female baboons exhibiting regular menstrual cycles (mean ± SE length of cycle = 33.0 ± 0.5 d) were anesthetized with isoflurane (1.0–1.5%): nitrous oxide (0.5 liters/min): oxygen (2.0 liters/min) and bilaterally ovariectomized to remove the principal source of estrogen and progesterone (10). Ovariectomized baboons were then left for at least 60 d before being used for acute temporal study of endometrial VEG/PF expression and microvessel endothelial morphology. During the 5 d immediately preceding the study, ovariectomized baboons were injected sc daily with the highly specific aromatase inhibitor CGS 20267 (letrozole, 4,4'-[1,2,3-triazyol-1-yl-methylene]-bis-benzonitrite; Novartis Pharma AG, Basel, Switzerland) at a dosage of 0.5 mg/0.25 cc sesame oil to suppress potential aromatization in nonovarian sites. At 0800 h on the day of experimentation, baboons were anesthetized with isoflurane, placed in a supine position on a 37 C warming pad and underlying thick sponge rubber pad on a surgical table, continuously administered physiological saline (25–30 ml/h) via a 21-gauge catheter (Intracath, 19 gauge, 24 in., Becton DickinsonVascular Access, Sandy, UT) inserted into a peripheral saphenous vein and blood pressure and level of anesthesia monitored. A midline 5- to 6-cm abdominal incision was made to expose the uterus for subsequent biopsy, and at time 0 baboons then received estradiol and/or progesterone iv and sc to elicit a rapid surge, then sustained release of hormone to study the temporal effect on endometrial VEG/PF mRNA expression and microvascular paracellular clefts. Baboons were treated with either: 1) estradiol [a bolus of 1.0 µg/kg body weight 17ß-estradiol (Sigma, St. Louis, MO) in 0.5 ml 5.0% ethanol: normal saline delivered via a 23-gauge needle into an antecubital vein plus three SILASTIC brand implants (Dow Corning, Midland, MI) sc, 4.65 mm outside diameter x 6 cm length, containing 17ß-estradiol]; 2) estradiol (as above) plus progesterone [bolus of 15.0 µg/kg body weight progesterone (Sigma) in ethanol: saline delivered via antecubital vein and four SILASTIC brand implants sc containing progesterone]; 3) progesterone (as above); or 4) ethanol: saline vehicle.

Blood samples (2 ml) were obtained via the peripheral saphenous vein catheter periodically during the study period for determination of serum estradiol and progesterone concentrations by RIA as described previously (13). Intraassay and interassay coefficients of variation were 6.9% and 7.3%, respectively, for estradiol and 7.6% and 7.9%, respectively, for progesterone RIA.

Single 5-mm diameter core biopsies (Acu-Punch, Acuderm, Inc., Ft. Lauderdale, FL) were obtained from the uterine fundus, alternating from anterior and posterior surfaces, extending transmurally from outer surface to lumen at 0, 2, 4, and 6 h after steroid hormone administration. A small piece of gelatin sponge (Surgifoam, Ferrosan Inc., Soeborg, Denmark) and single 5–0 chromic suture (Ethicon, Inc., Sommerville, NJ) were applied immediately after each biopsy to rapidly seal the site of tissue excision.

In the biopsies of the first three estradiol-treated baboons, the endometrium was macroscopically sliced from the myometrium, ensuring that a thin rim of endometrium was left behind to prevent myometrial contamination. This endometrial sample was immediately frozen and stored in liquid nitrogen for subsequent VEG/PF mRNA analysis collectively in all endometrial cells (i.e. whole endometrium). The uterine biopsies obtained from the remaining estradiol and/or progesterone-treated baboons were embedded in a cryomold filled with OCT medium (Sakura Finetek USA, Inc., Torrance, CA), frozen on dry ice, and stored at -80 C for subsequent VEG/PF mRNA analysis in glandular epithelial and stromal cells isolated by LCM. In four of the estradiol-treated baboons, two progesterone-treated baboons, and one vehicle-treated baboon approximately one quarter (sliced longitudinally) of the uterine specimen obtained at 0 and 6 h was removed before embedding in OCT, the myometrium sliced off, and the remaining endometrium containing both functionalis and basalis zones prepared for electron microscopic analysis of endothelial paracellular clefts.

LCM of endometrial cells

Glandular epithelial and stromal cells were isolated from the endometrium by LCM as described previously (10). Briefly, serial 8-µm sections of the uterine biopsy were cut longitudinally (to include endometrium and myometrium) on a Jung Frigocut 2800E cryostat at -20 C (Leica Corp., Deerfield, IL) and mounted onto Superfrost Plus glass slides (Fisher Scientific, Suwanee, CA) at room temperature. Sections were immediately fixed in 70% ethanol for 30 sec, washed with distilled water, incubated in 95% ethanol, immersed in Eosin-Y (Richard Allen, Kalamazoo, MI) for 10 sec, dehydrated in 100% ethanol, and incubated 5, 10, and 15 min in xylene. Slides were air-dried and transferred to a desiccator at room temperature, and an Arcturus PixCell II LCM system equipped with an Olympus Corp. microscope (Arcturus Engineering, Inc., Mountain View, CA) was then used to capture glandular (but not luminal) epithelial and stromal (but not observable blood vessels) cells randomly from both the basalis and functionalis zones of the endometrial sections. A single LCM cap (Capture Transfer Film TF100, Arcturus Engineering, Inc.) was used per tissue section, and optimal conditions for LCM included a laser power of 40 mW and duration of 1.5–2.5 msec, and laser spot-size of 7.5 or 15 µm for glandular epithelium (depending on gland size) and 15 or 30 µm for stroma. Captured cells were then mixed with lysis buffer (RNeasy, QIAGEN, Valencia, CA) in a single Eppendorf tube (Brinkman Instruments, Inc., Westburg, NY), microcentrifuged, stored in lysate buffer overnight at -80 C and RNA extracted within 72 h. The entire cell capture process, from tissue sectioning to tissue lysis, was rapidly completed to limit RNA degradation.

VEG/PF mRNA competitive RT-PCR

RNA isolation and oligonucleotide primers. Total RNA was isolated from whole endometrium by guanidine isothiocyanate-cesium chloride and from LCM-captured glandular epithelial and stromal cells using a RNeasy Mini Kit (QIAGEN). LCM samples were then treated with amplification grade deoxyribonuclease 1 (Invitrogen-Life Technologies, Inc., Carlsbad, CA) to eliminate any residual DNA contamination, and RNA precipitated in sodium acetate/ethanol, and resuspended in 10 µl ribonuclease (RNase)-free water.

Total RNA in whole endometrial tissue was quantified by UV absorption spectrophotometry to permit normalization of VEG/PF mRNA levels. However, because of the limited yield of total RNA from LCM samples, UV absorption could not be used to quantify total RNA. Therefore, the levels of 18S ribosomal RNA (rRNA), a cellular RNA whose expression was relatively constant during the menstrual cycle (data not shown), were quantified by competitive RT-PCR to normalize VEG/PF mRNA levels determined in uterine cells isolated by LCM.

Oligonucleotide primers were synthesized by Invitrogen-Life Technologies, Inc. and based on the human VEG/PF (14) and 18S rRNA (15) cDNA sequences, as detailed previously (10): VEG/PF primer 1: downstream, 5'-GGTGAGGTTTGATCCGCATAATCTGCGCATCAGGGGCACACAGGAT-3'; VEG/PF primer 2: upstream, 5'-AATTTAATACGACTCACTATAGGGACTGCTGTCTTGGGTGCATTGG-3'; VEG/PF primer 3: downstream, 5'-GGTTTGATCCGCATAATCTGC-3'; VEG/PF primer 4: upstream, 5'-CTGCTGTCTTGGGTGCATTGG-3'; 18S rRNA primer 5:downstream, 5'-CGGCGTAGGGTAGGCACACGCTGAGCC AGTCAGTGTAGCGCGCGTGCAGCCCCGGACATCTAAGGGCATCACA-3'; 18S rRNA primer 6: upstream, 5'-GCGGCGTAATACGACTCACTATAGGGAGAGGAGTCAAGAACGAAAGTCGGA GGGCTTCCGGGAAACCAAAGTC-3'; 18S rRNA primer 7: downstream, 5'-GGACATCTAAGGGCATCACA-3' and 18S rRNA primer 8: upstream, 5'-TCAAGAACGAAAGTCGGAGG-3'.

Competitive reference standard. Homologous RNA fragments, i.e. competitive reference standards (CRS), containing the same primer binding regions but shortened internal sequence with respect to the target RNA for VEG/PF and 18S rRNA were prepared as described previously (10, 16). Reverse transcription (RT) of total RNA (0.5–3.0 µg) from baboon placenta (VEG/PF) or uterus (18S rRNA) was performed at 42 C for 60 min in a reaction volume (20 µl) containing 1 mM each of deoxy (d)-ATP, dCTP, dGTP, and deoxythymine triphosphate (Invitrogen-Life Technologies, Inc.), 200 U SUPERSCRIPT RNase H-RT or Molony murine leukemia virus RT (Invitrogen-Life Technologies, Inc.), 1x RT buffer, 40 U RNAguard (Amersham Pharmacia Biotech, Piscataway, NJ), and 250 ng random primers (Invitrogen-Life Technologies, Inc.). The RT reaction was terminated by heat inactivation of the RT enzyme at 70 C for 15 min, cooled to 4 C and 5 µl of the RT reaction was added to separate PCR volumes (45 µl) containing 0.2 mM each of dATP, dCTP, dGTP, and deoxythymine triphosphate, 1.25 U cloned Thermus aquaticus DNA polymerase (Amplitaq, Perkin Elmer/Cetus, Norwalk, CT), 1x PCR buffer, and 10 pmol of the respective paired primers to generate cDNA templates for VEG/PF and 18S rRNA. PCR was performed in a programmable thermal cycler (MJ Research, Inc., Cambridge, MA) for 25 (VEG/PF) and 20 (18S rRNA) sequential cycles, respectively. The amplification profile consisted of denaturation at 94 C for 1 min, primer annealing at 60 C for 1 min and extension at 72 C for 2 min, with a final extension at 72 C for 5 min. An aliquot of each reaction was subjected to 2.0% agarose gel electrophoresis, amplified products visualized by ethidium bromide staining and gel purified (QIAGEN DNA extraction kit), and the CRS synthesized from cDNA template (150 ng) using the MEGAscript T7 in vitro transcription kit (Ambion, Inc., Austin, TX). The cDNA templates were removed from the transcription reaction products by treatment with RNase-free deoxyribonuclease 1 (Ambion, Inc.), extracted with chloroform: isoamyl alcohol, and aliquots of CRS quantitated via UV absorption spectrophotometry at an OD of 260 nm.

RT-PCR assay. VEG/PF and 18S rRNA mRNA levels were simultaneously quantified by competitive RT-PCR assay (16, 17). A constant amount of RNA (1.5 µl of LCM sample or 600 ng of whole endometrium) was added to an RT mixture containing 2- or 3-fold serial dilutions of both VEG/PF-CRS (5400–200 attomol for whole endometrial samples and 25–0.02 attomol for LCM samples, respectively) and 18S rRNA-CRS (5–0.02 fmol). In all experiments, the presence of possible pseudogene or genomic DNA contamination was checked by control reactions in which either the RT enzyme or RNA was omitted. At least four points of the CRS curve were used for both VEG/PF and 18S rRNA quantitation.

Five and 2 µl of the RT mixture for VEG/PF and 18S rRNA, respectively, were added to separate PCR mixtures containing 10 pmol of the respective paired primers for VEG/PF and 18S rRNA. Total endometrial and LCM VEG/PF, and LCM 18S rRNA samples were amplified for 26, 34, and 24 sequential cycles, respectively; PCR products were gel fractionated, visualized with ethidium bromide, and photographed using type 665 positive/negative film (Polaroid Corp., Cambridge, MA).

Negatives were scanned using a Gel Doc 1000 imaging system and Multi-Analyst software program (Bio-Rad Laboratories, Inc., Hercules, CA). The intensity of amplified target and CRS cDNA products was represented as the relative area under each product band. A correction factor (18) was used to account for the relative size difference between target and CRS cDNAs. The logarithm (log) of the ratio of CRS to target area was plotted as a function of the log concentration of VEG/PF or 18S rRNA CRS added to each PCR. The latter curve plotted for each sample was analyzed by linear regression to ensure linear PCR amplification, indicative that RNA from LCM cells was intact within the region spanned by our sets of primers, and that the assay was performing optimally. The sample was reassayed if PCR amplification was not linear. The concentration of VEG/PF or 18S rRNA target mRNA was determined where the ratio of the log of CRS and target area was equal to 0 (i.e. the equivalence point).

Electron microscopic analysis of paracellular clefts

Endometrial biopsies for electron microscopic analysis were dissected into 1 x 1-mm pieces and fixed for 24 h in phosphate-buffered 4% formaldehyde/1% glutaraldehyde. After washing with sucrose buffer, endometrial fragments were incubated in 1% osmium tetroxide for 1 h, processed through a graded series of alcohol, and embedded in Epon resin (Poly/Bed 812, Polysciences Inc., Warrington, PA). Thick sections ({cong}1 µm) were cut, counterstained with hematoxylin, and visualized at x100 and x200 magnification to identify vascularized areas of endometrium. Thin (80 nm) sections were then cut via a diamond knife, placed onto copper grids, stained with uranyl acetate and lead citrate, and viewed under an electron microscope (Joel JEM-100CX, Toyko, Japan) at 60 kV.

For each endometrial tissue sample, endothelial paracellular cleft widths were determined on 7–16 randomly chosen microvessels (i.e. comprised of 1–4 intact endothelial cells). Only junctional membranes that were sectioned perpendicularly at right angles (i.e. opposing parallel membranes in the section plane) were included for analysis. Paracellular cleft tight junctions were defined as the narrowest point of membrane apposition between two adjoining microvessel endothelial cells. A minimum of 4–8 electron microphotographs at x66,000 were taken for each endometrial microvessel. The final electron photomicrograph magnification (correcting for calibration and negative to print enlargement) from which paracellular cleft width measurements were made approximated x178,200. Paracellular cleft width data are presented in nanometers. The intraassay (i.e. between vessel, within animal) coefficient of variation for cleft width was relatively low (12.3%), indicating that this aspect of endothelial cell morphology was consistent across different microvessels in the endometrium.

Statistical analysis

Data were expressed as the means ± SE and analyzed either by ANOVA with post hoc comparisons of means by Newman-Keuls multiple comparison test or by Student’s paired t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Serum estradiol and progesterone

Peripheral serum estradiol concentrations were undetectable (i.e. <0.20 pg/ml) in ovariectomized baboons before acute steroid hormone administration. Within 0.25 h of bolus iv injection and sc implants of estradiol, mean ± SE serum estradiol levels increased to a maximum of 1,890 ± 247 pg/ml, and then progressively declined reaching values of 1,206 ± 313, 777 ± 223, and 441 ± 127 pg/ml at 2, 4, and 6 h after estrogen treatment (Table 1Go). The absolute levels and temporal pattern of serum estradiol levels after administration of estradiol plus progesterone were similar to those values exhibited in baboons receiving estrogen alone (Table 1Go). In contrast, serum estradiol concentrations in ovariectomized baboons treated with vehicle or progesterone remained at less than 0.20 pg/ml.


View this table:
[in this window]
[in a new window]
 
Table 1. Mean (±SE) serum estradiol and progesterone concentrations in ovariectomized baboons treated acutely with estradiol and/or progesterone

 
Serum progesterone levels also were undetectable (i.e. <0.20 ng/nl) in ovariectomized baboons before estradiol or progesterone administration. The administration of estradiol and progesterone to ovariectomized animals increased serum progesterone concentrations to 10.65 ± 0.93 ng/ml at 0.25 h, and 11.82 ± 4.62, 9.43 ± 5.72, and 8.06 ± 3.97 ng/ml at 2, 4, and 6 h, respectively (Table 1Go). Similar levels of serum progesterone were observed over the acute study period in animals treated with progesterone alone.

Endometrial VEG/PF mRNA

Figure 1Go illustrates results of a representative competitive RT-PCR analysis of VEG/PF mRNA in whole endometrial tissue of an ovariectomized baboon before (i.e. time 0) and 2 h after treatment with estradiol. Using primers upstream from the alternative splice site, PCR generated a 323-bp target product that reflected collective expression of all of the VEG/PF isoforms and a 256-bp VEG/PF CRS product (Fig. 1AGo). PCR products were not generated when RNA or RT enzyme were omitted from the reaction. The correlation coefficients for regression of the log of the ratio of CRS and target areas with the log of increasing CRS were 0.98 (P < 0.01) and 0.99 (P < 0.01) for RNA from endometrial tissue obtained at 0 h and 2 h after estradiol administration, respectively (Fig. 1BGo), indicating linear PCR amplification in both samples.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Representative competitive RT-PCR of VEG/PF mRNA in whole endometrial tissue obtained from an ovariectomized baboon 0 h and 2 h after acute administration of estradiol (E2) as detailed in Table 1Go footnote. A, The 323-bp target product from total RNA using primers upstream from the alternative splice site and serial dilutions of the 256-bp CRS separated on 2% agarose gels and stained with ethidium bromide. B, Intensities of amplified products shown in A were analyzed by densitometry, and the log of the ratio of VEG/PF CRS and target areas in tissue of ovariectomized baboons 0 h ({circ}) and 2 h (•) after estradiol treatment were plotted as a function of the log of CRS concentration added to each PCR. Lines were constructed by linear regression analysis and VEG/PF mRNA levels determined from the equivalence points (i.e. intersection of vertical with regression lines). Correlation coefficients (r2) determined by linear regression were 0.98 (P < 0.01) for 0 h and 0.99 (P < 0.01) 2 h after estradiol treatment of ovariectomized baboons.

 
Figure 2Go shows the time-course for VEG/PF mRNA levels in whole endometrial tissue obtained from ovariectomized baboons after the acute administration of estradiol. Mean (±SE) VEG/PF mRNA levels (attomoles per microgram total RNA) increased approximately 5- to 6-fold (P < 0.01) from 812 ± 135 at time 0 to 4404 ± 946 and 5091 ± 1303 at 2 h and 4 h, respectively, and remained elevated at 6 h after estradiol administration.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. Time course of VEG/PF mRNA levels (attomol/µg total RNA, means ± SE) determined by competitive RT-PCR in whole endometrium of ovariectomized baboons (n = same 3 animals consecutively biopsied at each time point except at 6 h where n = 2) after acute administration at time 0 h of estradiol as detailed in the footnote of Table 1Go. *, P < 0.01 vs. time 0 (ANOVA and Newman-Keuls multiple comparison test).

 
We have previously shown (10, 11) that homogenous populations of cytokeratin-positive glandular epithelial and vimentin-positive stromal cells were isolated by LCM from the endometrium of the baboon uterus. We also confirmed that RNA isolated from the latter cells displayed distinct 28S and 18S rRNA bands and was intact within the region spanned by our set of VEG/PF primers (10). Figure 3Go shows the time-course for VEG/PF mRNA levels in isolated glandular epithelial and stromal cells of ovariectomized baboons treated with saline vehicle or estradiol. Glandular epithelial and stromal VEG/PF mRNA levels, corrected for 18S rRNA simultaneously determined by competitive RT-PCR, at time 0 h (0.66 ± 0.20 glands and 0.46 ± 0.24 stroma), remained relatively low 2 h (1.51 ± 0.70 and 1.37 ± 0.55), 4 h (2.70 ± 0.67 and 2.12 ± 1.49), and 6 h (1.34 ± 0.40 and 1.99 ± 1.08) after injection of vehicle and repeated biopsy. In contrast, after acute administration of estradiol basal glandular epithelial and stromal VEG/PF mRNA levels (1.36 ± 0.59 glands and 1.88 ± 1.30 stroma) increased approximately 7-fold and 3-fold, respectively, in 5 of 5 animals to mean ± SE levels of 8.70 ± 5.65 and 4.68 ± 1.36, respectively, at 2 h, 5.49 ± 1.80 and 5.50 ± 1.67 at 4 h, and 12.83 ± 8.29 and 5.18 ± 1.92 at 6 h (Fig. 3Go).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Time course of VEG/PF mRNA levels (mean ± SE), determined by competitive RT-PCR and corrected for 18S rRNA (attomol/fmol), in glandular epithelial and stromal cells isolated by LCM from the endometrium of ovariectomized baboons after administration at time 0 of ethanol: saline vehicle ({square}, n = same 4 animals consecutively biopsied) or estradiol ({blacksquare}, n = same 5 animals consecutively biopsied) as detailed in the footnote of Table 1Go.

 
Figure 4Go shows the net increase in VEG/PF mRNA level collectively at 2, 4, and 6 h (i.e. difference between mean value at 2, 4, and 6 h vs. basal value at time 0) in glandular epithelial and stromal cells isolated from the endometrium of ovariectomized baboons after administration of estradiol and/or progesterone. The net increase in glandular epithelial cell VEG/PF mRNA levels after the acute administration of estradiol (7.31 ± 2.72 attomol/fmol 18S rRNA) was 8-fold greater (P < 0.05) than that obtained after administration of saline-ethanol vehicle alone (0.90 ± 0.30 attomol/fmol 18S rRNA). The net increase in VEG/PF mRNA levels in stromal cells was 2.6-fold greater (P < 0.01) in estradiol-treated (3.13 ± 0.36 attomol/fmol 18S rRNA) than in vehicle-treated (1.20 ± 0.33 attomol/fmol 18S rRNA) baboons (Fig. 4Go). However, the absolute level of and relative increase in VEG/PF mRNA achieved with estradiol treatment was not as large in stromal as in glandular epithelial cells. In contrast to the increase in endometrial VEG/PF mRNA expression observed with estradiol treatment of baboons, the increases in glandular epithelial and stromal cell VEG/PF mRNA levels were diminished or prevented by concomitant administration of estradiol and progesterone (Fig. 4Go). Moreover, glandular epithelial and stromal VEG/PF mRNA levels in baboons treated with progesterone alone appeared similar to those observed with vehicle treatment.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. Net increase in VEG/PF mRNA levels (mean ± SE) determined by RT-PCR in glandular epithelial and stromal cells isolated by LCM from the endometrium of ovariectomized baboons after administration of ethanol: saline vehicle (C, n = 4 animals), estradiol (E2, n = 5 animals), estradiol plus progesterone (E2/P4, n = 3 animals), or progesterone (n = 2 animals), as detailed in the footnote of Table 1Go. Values represent the net increase in VEG/PF mRNA between 0 h (i.e. immediately before steroid hormone administration) and collectively at 2, 4, and 6 h after estradiol and/or progesterone treatment. *, Significantly different (P < 0.05, ANOVA and Newman-Keuls multiple comparison test) than value in ovariectomized baboons treated with vehicle, when analyzed as percent increase vs. 0 h. **, Significantly different (P < 0.01, ANOVA and Newman-Keuls multiple comparison test) than value in ovariectomized baboons treated with vehicle alone, when analyzed either as absolute increase or percent increase vs. 0 h.

 
Endometrial microvascular paracellular cleft width

Figure 5Go shows a representative electron photomicrograph illustrating paracellular clefts between adjacent endothelial cells of endometrial microvessels of an ovariectomized baboon before and 6 h after acute estradiol treatment. Paracellular cleft width appeared to be increased, and tight junctions appeared to disappear (i.e. open) within 6 h of estradiol administration. Microvessel paracellular cleft widths in individual ovariectomized baboons before and after administration of vehicle/progesterone or estradiol are shown in Fig. 6Go. After estradiol administration, paracellular cleft width was increased (P < 0.01, paired t test) in four of four baboons, from a mean (±SE) of 71.6 ± 4.6 nm at 0 h to 101.1 ± 6.4 nm at 6 h. In contrast, paracellular cleft width was similar in value 0 h (70.1 ± 3.8 nm) and 6 h (72.3 ± 3.3 nm) after acute administration of saline: ethanol vehicle or progesterone.



View larger version (146K):
[in this window]
[in a new window]
 
Figure 5. Electron micrographs illustrating paracellular clefts (arrowheads mark tight junctions) between adjacent endothelial cells of endometrial microvessels of an ovariectomized baboon before (A) and 6 h after (B) acute estradiol treatment as detailed in Table 1Go footnote. Scale bar, 350 nm.

 


View larger version (14K):
[in this window]
[in a new window]
 
Figure 6. Paracellular cleft width (nanometers) between adjacent endometrial microvessel endothelial cells of ovariectomized baboons before (0 h) and 6 h after acute administration of saline vehicle (n = 1 animal)/progesterone (P4, n = 2 animals) or estradiol (n = 4 baboons).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present study shows that endometrial VEG/PF mRNA expression was rapidly elevated in vivo in ovariectomized baboons within 2 h of the administration of estradiol. This resulted from enhanced VEG/PF mRNA expression by both glandular epithelial and stromal cells, although the absolute levels and relative increase in VEG/PF seemed to be greater in the glands than in the stroma. Moreover, the stimulatory effect of estrogen on VEG/PF expression was specific and not elicited by manipulation of the uterus or by the steroid hormone progesterone. These results in the baboon are consistent with the rapid estradiol induction of VEG/PF mRNA expression previously reported in vivo in the rat (7) and sheep (9) uterus, and the restoration of glandular epithelial and stromal VEG/PF mRNA levels in the ovariectomized baboon (11) and rhesus monkey (12) by chronic administration of estradiol. Although sequences corresponding to classical estrogen response elements have not been identified in the 5'-flanking region of the VEG/PF gene, consensus half-palindromic sequences that bound estrogen receptor {alpha} in band shift assays and that confer estrogen inducibility to reporter constructs have been identified in two regions of the gene, one in the 5'-untranslated region (8). In primary human endometrial epithelial and stromal cells, estradiol stimulated VEG/PF gene transcription through a functional single variant estrogen response element located 1.5-kb upstream from the transcriptional start site (19). Considering these observations in vitro, and because the induction of VEG/PF mRNA in vivo in the rodent uterus was rapid, blocked by antiestrogens, and inhibited by actinomycin D but not puromycin or cycloheximide (8, 20), it is likely that the regulatory effects of estrogen on endometrial VEG/PF expression involve VEG/PF gene transcription and are mediated by the estrogen receptor. The observation of a rapid elevation in endometrial VEG/PF expression by estradiol in baboons of the present study, when considered with presence of the estrogen receptor {alpha} and ß within the human (21), rhesus monkey (22, 23), and baboon (24) endometrium, suggest that estrogen has similar important actions on VEG/PF expression in the primate uterus.

Others have concluded that steroid hormones have no role in regulating human endometrial VEG/PF expression (25, 26) because there are no major changes in VEG/PF expression during the menstrual cycle, despite the surges in estrogen and progesterone. We suggest that the levels of estrogen, albeit low, preceding and following the midcycle surge in estrogen, are nevertheless sufficient and necessary to maintain VEG/PF expression throughout the course of the menstrual cycle. Thus, it appears that VEG/PF expression was suppressed in the primate uterus only after serum estradiol levels were eliminated by ovariectomy. The ability to experimentally deplete and restore the levels of endogenous steroid hormones by ovariectomy and hormone replacement is of significant advantage and demonstrates the value of the nonhuman primate baboon model to study the regulation of events important to endometrial growth, development and function. Sustained VEG/PF synthesis would seem necessary to promote angiogenesis at the onset of the cycle for vascular reconstruction, throughout the proliferative phase for expansion of the vessel bed, and during the second half of the cycle for growth and elongation of the vascular tree.

The present study is also significant in showing for the first time in the primate that the estrogen-induced increase in endometrial VEG/PF expression was rapidly followed by a significant increase in paracellular cleft width and the apparent opening of tight junctions between microvessel endothelial cells of the endometrium. There is broad consensus that paracellular clefts form the principal pathway for water and hydrophilic solute flux across the capillary wall (27, 28). Indeed, there is excellent correlation between open tight junctions and extravasation of molecules such as albumin (29). Moreover, within 2 h of VEG/PF administration to mice, several changes indicative of increased vascular permeability occurred in the blood-brain barrier, including appearance of interendothelial cell gaps (30). Thus, the increase in uterine vascular permeability induced by acute estradiol administration to the rat is believed to be due to the formation of gaps between capillary endothelial cells (31, 32). One of the early events critical for angiogenesis is increased microvessel permeability (4, 5) and the rapid estradiol-induced up-regulation of uterine VEG/PF expression (7) precedes, and therefore may mediate, the well established early action of estrogen on microvascular permeability in the rodent uterus (33, 34). Consistent with this concept, the administration of VEG/PF antisera to immature rats blocked the marked increase in endometrial stromal edema induced by estradiol (35). Therefore, although further in vivo study is needed in the baboon, e.g. direct assessment of microvessel permeability by an indicator diffusion method (36), the concomitant and temporally related estrogen-induced increases in endometrial VEG/PF expression and microvessel paracellular cell gaps are consistent with the concept that VEG/PF mediated the changes in endometrial microvessel architecture elicited by estrogen in primates of the present study. However, because estrogen receptor {alpha} and ß also are present in endometrial vascular endothelial cells in the human (37) and rhesus monkey (38), and estrogen promoted vascular endothelial cell proliferation (39), estrogen may also exert direct actions on microvessel function. Therefore, additional studies using antagonists of VEG/PF expression or action, e.g. soluble truncated VEG/PF receptor as has been used to study VEG/PF action in the corpus luteum of the marmoset monkey (40), are needed to definitively link estrogen, VEG/PF, and early aspects of angiogenesis in the primate endometrium.

In the present study, estradiol quickly up-regulated VEG/PF mRNA levels in both glandular epithelial and stromal cells within the baboon endometrium. Conceivably, therefore, the glands or stroma or both may serve as a source of VEG/PF to promote angiogenesis in the endometrium during the menstrual cycle. Considering the close approximation of the glandular epithelium and rich subepithelial microvascular network that develops immediately below the surface of the endometrium during the reproductive cycle, VEG/PF originating from glandular epithelial cells may be particularly important for angiogenesis in this location. However, because VEG/PF secretion from glandular epithelial cells appears to be largely apical in nature (41), it has also been suggested that most of the VEG/PF produced in the glands may be of greater importance to events associated with implantation. With initiation of a new menstrual cycle, preexisting vessels in the zona basalis give rise via angiogenesis to capillary sprouts, and under these circumstances VEG/PF originating from the stroma may be especially important in promoting angiogenesis and consequently the vascular foundation necessary for progressive growth and differentiation of the endometrium.

Although progesterone has been reported to increase VEG/PF mRNA expression in vivo in the rat (7, 8) and rhesus monkey (42) uterus, and in vitro in human endometrial cells (43), the magnitude of increase was less and the onset of induction slower than exhibited with estrogen. Brenner and co-workers (44) have shown both in the human and macaque that the VEG/PF KDR/flk-1 receptor, normally only expressed in the vascular endothelium, was markedly elevated in stromal cells of the superficial endometrial zones upon progesterone withdrawal during the premenstrual phase. In the present study, progesterone administered simultaneously with estradiol diminished the stimulatory effect observed with estradiol alone on endometrial glandular epithelial and stromal VEG/PF mRNA expression. This blunting effect of progesterone on VEG/PF expression is reminiscent of the inhibitory effect that progesterone has on other actions of estrogen in the endometrium, e.g. generation of the receptors for both estrogen and progesterone (2, 45). When administered alone to baboons of the present study, progesterone had no effect on endometrial VEG/PF expression or endothelial paracellular cleft width. The latter might be expected, however, because estrogen priming is needed to produce the estrogen and progesterone receptors (46).

In summary, the acute administration of estradiol to ovariectomized baboons within 2 h up-regulated VEG/PF mRNA expression by both glandular epithelial and stromal cells of the endometrium, and within 6 h increased endometrial endothelial paracellular cleft width as a marker of microvessel permeability, an early process apparently important for angiogenesis. These results suggest that estrogen has a major role in regulating VEG/PF synthesis and early events in angiogenesis in the primate endometrium.


    Acknowledgments
 
The secretarial assistance of Wanda James with the manuscript is greatly appreciated. We appreciated the use of the Specialized Cooperative Centers Program in Reproduction Research Laser Capture Microdissection Facility at the University of Maryland for isolation of endometrial cells.


    Footnotes
 
This work was supported by NIH U54-HD-36207 as part of the NICHD Specialized Cooperative Centers Program in Reproduction Research. A.L.N. was supported by a Lalor Foundation Postdoctoral Fellowship.

Abbreviations: CRS, Competitive reference standards; d, deoxy; LCM, laser capture microdissection; log, logarithm, PF, permeability factor; RNase, ribonuclease; rRNA, ribosomal RNA; RT, reverse transcription; VEG, vascular endothelial growth.

Received October 3, 2002.

Accepted March 28, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Markee JE 1940 Menstruation in intraocular endometrial transplants in the rhesus monkey. Contrib Embryol 177:221–308
  2. Brenner RM, Slayden OD 1994 Cyclic changes in the primate oviduct and endometrium. In: Knobil E, Neill JD, eds. The physiology of reproduction. New York: Raven Press, Ltd.; 541–569
  3. Ferarra N, Davis-Smyth T 1997 The biology of vascular endothelial growth factor. Endocr Rev 18:4–25[Abstract/Free Full Text]
  4. Dvorak HF, Brown LF, Detmar M, Dvorak AM 1995 Vascular permeability factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis. Am J Pathol 146:1029–1039[Abstract]
  5. Dvorak HF, Nagy JA, Feng D, Brown LF, Dvorak AM 1999 Vascular permeability factor/vascular endothelial growth factor and the significance of microvascular hyperpermeability in angiogenesis. Curr Top Microbiol Immunol 237:97–132[Medline]
  6. Halder JB, Zhao X, Soker S, Paria BC, Klagsbrun M, Das SK, Dey SK 2000 Differential expression of VEGF isoforms and VEGF164-specific receptor neurophilin-1 in the mouse uterus suggests a role for VEGF164 in vascular permeability and angiogenesis during implantation. Genesis 26:213–224[CrossRef][Medline]
  7. Cullinan-Bove K, Koos R 1993 Vascular endothelial growth factor/vascular permeability factor expression in the rat uterus: rapid stimulation by estrogen correlates with estrogen-induced increases in uterine capillary permeability and growth. Endocrinology 133:829–837[Abstract/Free Full Text]
  8. Hyder SM, Huang JC, Nawaz Z, Boettger-Tong H, Makela S, Chiappetta C, Stancel GM 2000 Regulation of vascular endothelial growth factor expression by estrogens and progestins. Environ Health Perspect 108:785–790[Medline]
  9. Reynolds LP, Kirsch JD, Kraft KC, Redmer DA 1998 Time-course of the uterine response to estradiol-17ß in ovariectomized ewes: expression of angiogenic factors. Biol Reprod 59:613–620[Abstract/Free Full Text]
  10. Niklaus AL, Babischkin JS, Aberdeen GW, Pepe GJ, Albrecht ED 2002 Expression of vascular endothelial growth/permeability factor by endometrial glandular epithelial and stromal cells in baboons during the menstrual cycle and after ovariectomy. Endocrinology 143:4007–4017[Abstract/Free Full Text]
  11. Niklaus AL, Aberdeen GW, Babischkin JS, Pepe GJ, Albrecht ED Effect of estrogen on vascular endothelial growth/permeability factor expression by glandular epithelial and stromal cells in the baboon endometrium. Biol Reprod, in press
  12. Nayak NR, Brenner RM 2002 Vascular proliferation and vascular endothelial growth factor expression in the rhesus macaque endometrium. J Clin Endocrinol Metab 87:1845–1855[Abstract/Free Full Text]
  13. Albrecht ED, Aberdeen GW, Pepe GJ 2000 The role of estrogen in the maintenance of primate pregnancy. Am J Obstet Gynecol 182:432–438[CrossRef][Medline]
  14. Tischer E, Mitchell R, Hartman T, Silva M, Gospodarowicz D, Fiddes JC, Abraham JA 1991 The human gene for vascular endothelial growth factor. J Biol Chem 266:11947–11954[Abstract/Free Full Text]
  15. Torczynski RM, Fuke M, Bollon AP 1985 Cloning and sequencing of a human 18S ribosomal RNA gene. DNA 4:283–291[Medline]
  16. Riedy MC, Timm Jr EA, Stewart CC 1995 Quantitative RT-PCR for measuring gene expression. Biotechniques 18:70–76[Medline]
  17. Babischkin JS, Pepe GJ, Albrecht ED 1997 Estrogen regulation of placental P-450 cholesterol side-chain cleavage enzyme messenger ribonucleic acid levels and activity during baboon pregnancy. Endocrinology 138:452–459[Abstract/Free Full Text]
  18. Menzo S, Bagnarelli P, Giacca M, Manzin A, Varaldo P, Clementi M 1992 Absolute quantitation of viremia in human immunodeficiency virus infection by competitive reverse transcription and polymerase chain reaction. J Clin Microbiol 267:1752–1757
  19. Mueller MD, Vigne JL, Minchenko A, Lebovic DI, Leitman DC, Taylor RN 2000 Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors alpha and beta. Proc Natl Acad Sci USA 97:10972–10977[Abstract/Free Full Text]
  20. Hyder SM, Stancel GM 1999 Regulation of angiogenic growth factors in the female reproductive tract by estrogens and progestins. Mol Endocrinol 13:806–811[Free Full Text]
  21. Garcia E, Bouchard PL, De Brux J, Berdah J, Frydman R, Schaison G, Milgrom E, Perrot-Applanat M 1988 Use of immunocytochemistry of progesterone and estrogen receptors for endometrial dating. J Clin Endocrinol Metab 67:80–87[Abstract/Free Full Text]
  22. Okulicz WC, Savasta AM, Hoberg LM, Longcope C 1990 Biochemical and immunohistochemical analyses of estrogen and progesterone receptors in the rhesus monkey uterus during the proliferative and secretory phases of the artificial menstrual cycle. Fertil Steril 53:913–920[Medline]
  23. Slayden OD, Brenner RM 1994 RU 486 action after estrogen priming in the endometrium and oviducts of rhesus monkeys (Macaca mulatta). J Clin Endocrinol Metab 78:440–448[Abstract]
  24. Albrecht ED, Babischkin JS, Davies WA, Leavitt MG, Pepe GJ 1999 Identification and developmental expression of the estrogen receptor {alpha} and ß in the baboon fetal adrenal gland. Endocrinology 140:5953–5961[Abstract/Free Full Text]
  25. Gargett CE, Rogers PAW 2001 Human endometrial angiogenesis. Reproduction 121:181–186[Abstract]
  26. Smith SK 1998 Angiogenesis, vascular endothelial growth factor and the endometrium. Hum Reprod Update 4:509–519[Abstract/Free Full Text]
  27. Clough G 1991 Relationship between microvascular permeability and ultrastructure. Prog Biophys Mol Biol 55:47–69[CrossRef][Medline]
  28. Leach L, Firth JA 1995 Advances in understanding permeability in fetal capillaries of the human placenta: a review of organization of the endothelial paracellular clefts and their junctional complexes. Reprod Fertil Dev 7:1451–1456[CrossRef][Medline]
  29. Vinores SA, Sen H, Campochiaro PA 1992 An adenosine agonist and prostaglandin E1 cause breakdown of the blood-retinal barrier by opening tight junctions between vascular endothelial cells. Invest Ophthalmol Vis Sci 33:1870–1878[Abstract/Free Full Text]
  30. Roberts WG, Palade GE 1995 Increased microvascular permeability and endothelial fenestration induced by vascular endothelial growth factor. J Cell Sci 108:2369–2379[Abstract]
  31. Ham KN, Hurley JV, Lopata A, Ryan GB 1970 A combined isotopic and electron microscopic study of the response of the rat uterus to exogenous estradiol. J Endocrinol 46:71–81[Abstract/Free Full Text]
  32. Friederici HH 1967 The early response of uterine capillaries to estrogen stimulation. Lab Invest 17:322–333[Medline]
  33. Astwood E 1938 A six-hour assay for the quantitative determination of estrogen. Endocrinology 23:25–31[Abstract/Free Full Text]
  34. Ma W, Tan J, Matsumoto H, Robert B, Abrahamson DR, Das SK, Dey SK 2001 Adult tissue angiogenesis: evidence for negative regulation by estrogen in the uterus. Mol Endocrinol 15:1983–1992[Abstract/Free Full Text]
  35. Rockwell LC, Pillai S, Olson CE, Koos RD 2002 Inhibition of vascular endothelial growth factor/vascular permeability factor blocks estrogen-induced uterine edema and implantation in rodents. Biol Reprod 67:1804–1810[Abstract/Free Full Text]
  36. Xu Q, Qaum T, Adamis AP 2001 Sensitive blood-retinal barrier breakdown quantitation using Evans Blue. Invest Ophthal Vis Sci 42:789–794[Abstract/Free Full Text]
  37. Bausero P, Ben-Mahdi M, Mazucatelli J, Bloy C, Perrot-Applanat M 2000 Vascular endothelial growth factor is modulated in vascular muscle cells by estradiol, tamoxifen, and hypoxia. Am J Physiol 279:H2033–H2042
  38. Critchley HO, Brenner RM, Henderson TA, Williams K, Nayak NR, Slayden OD, Miller MR, Saunders PT 2001 Estrogen receptor ß, but not estrogen receptor {alpha}, is present in the vascular endothelium of the human and nonhuman primate endometrium. J Clin Endocrinol Metab 86:1370–1378[Abstract/Free Full Text]
  39. Morales DE, McGowan KA, Grant DS, Maheshwari S, Bhartiya D, Cid MC, Kleinman KH, Schnaper HW 1995 Estrogen promotes angiogenic activity in human umbilical vein endothelial cells in vitro and in a murine model. Circulation 91:755–763[Abstract/Free Full Text]
  40. Wulff C, Wilson H, Rudge JS, Wiegand SJ, Lunn SF, Fraser HM 2001 Luteal angiogenesis: prevention and intervention by treatment with vascular endothelial growth factor trapA40. J Clin Endocrinol Metab 86:3377–3386[Abstract/Free Full Text]
  41. Hornung D, Lebovic DI, Shifren JL, Vigne JL, Taylor RN 1998 Vectorial secretion of vascular endothelial growth factor by polarized human endometrial epithelial cells. Fertil Steril 69:909–915[CrossRef][Medline]
  42. Greb RR, Heikinheimo O, Williams RF, Hodgen GD, Goodman AL 1997 Vascular endothelial growth factor in primate endometrium is regulated by oestrogen-receptor and progesterone-receptor ligands in vivo. Hum Reprod 12:1280–1292
  43. Shifren JL, Tseng JF, Zaloudek CJ, Ryan IP, Meng YG, Ferrara N, Jaffe RB, Taylor RN 1996 Ovarian steroid regulation of vascular endothelial growth factor in the human endometrium: implications for angiogenesis during the menstrual cycle and in the pathogenesis of endometriosis. J Clin Endocrinol Metab 81:3112–3118[Abstract/Free Full Text]
  44. Nayak NR, Critchley HOD, Slayden OvD, Menrad A, Chwalisz K, Baird DT, Brenner RM 2000 Progesterone withdrawal up-regulates vascular endothelial growth factor receptor type 2 in the superficial zone stroma of the human and macaque endometrium: potential relevance to menstruation. J Clin Endocrinol Metab 85:3442–3452[Abstract/Free Full Text]
  45. Okulicz WC, Balsamo M, Tast J 1993 Progesterone regulation of endometrial estrogen receptor and cell proliferation during the late proliferative and secretory phase in artificial menstrual cycles in the rhesus monkey. Biol Reprod 49:24–32[Abstract]
  46. Okulicz WC, Savasta AM, Hoberg LM, Longcope C 1989 Immunofluorescent analysis of estrogen induction of progesterone receptor in the rhesus uterus. Endocrinology 125:930–934[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
G. W. Aberdeen, S. J. Wiegand, T. W. Bonagura Jr., G. J. Pepe, and E. D. Albrecht
Vascular Endothelial Growth Factor Mediates the Estrogen-Induced Breakdown of Tight Junctions between and Increase in Proliferation of Microvessel Endothelial Cells in the Baboon Endometrium
Endocrinology, December 1, 2008; 149(12): 6076 - 6083.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. W. Bonagura, G. J. Pepe, A. C. Enders, and E. D. Albrecht
Suppression of Extravillous Trophoblast Vascular Endothelial Growth Factor Expression and Uterine Spiral Artery Invasion by Estrogen during Early Baboon Pregnancy
Endocrinology, October 1, 2008; 149(10): 5078 - 5087.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. M. Fraser, H. Wilson, A. Silvestri, K. D. Morris, and S. J. Wiegand
The Role of Vascular Endothelial Growth Factor and Estradiol in the Regulation of Endometrial Angiogenesis and Cell Proliferation in the Marmoset
Endocrinology, September 1, 2008; 149(9): 4413 - 4420.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
H. N. Jabbour, R. W. Kelly, H. M. Fraser, and H. O. D. Critchley
Endocrine Regulation of Menstruation
Endocr. Rev., February 1, 2006; 27(1): 17 - 46.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
L. M Walter, P. A W Rogers, and J. E Girling
The role of progesterone in endometrial angiogenesis in pregnant and ovariectomised mice
Reproduction, June 1, 2005; 129(6): 765 - 777.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
K. Y Lee and F. J DeMayo
Animal models of implantation
Reproduction, December 1, 2004; 128(6): 679 - 695.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. D. Albrecht, V. A. Robb, and G. J. Pepe
Regulation of Placental Vascular Endothelial Growth/Permeability Factor Expression and Angiogenesis by Estrogen during Early Baboon Pregnancy
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5803 - 5809.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
V. A. Robb, G. J. Pepe, and E. D. Albrecht
Acute Temporal Regulation of Placental Vascular Endothelial Growth/Permeability Factor Expression in Baboons by Estrogen
Biol Reprod, November 1, 2004; 71(5): 1694 - 1698.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
E. D. Albrecht, J. S. Babischkin, Y. Lidor, L. D. Anderson, L. C. Udoff, and G. J. Pepe
Effect of estrogen on angiogenesis in co-cultures of human endometrial cells and microvascular endothelial cells
Hum. Reprod., October 1, 2003; 18(10): 2039 - 2047.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Albrecht, E. D.
Right arrow Articles by Pepe, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Albrecht, E. D.
Right arrow Articles by Pepe, G. J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*PROGESTERONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals