| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Obstetrics, Gynecology, Reproductive Sciences and Physiology (E.D.A., G.W.A., A.L.N., J.S.B., D.L.S.), Center for Studies in Reproduction, University of Maryland School of Medicine, Baltimore, Maryland 21201; and Department of Physiological Sciences (G.J.P.), Eastern Virginia Medical School, Norfolk, Virginia 23501
Address all correspondence and requests for reprints to: Eugene D. Albrecht, Ph.D., Department of Obstetrics, Gynecology and Reproductive Sciences, The University of Maryland School of Medicine, Bressler Research Laboratories 11-019, 655 West Baltimore Street, Baltimore, Maryland 21201. E-mail: ealbrech{at}umaryland.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Endometrial VEG/PF mRNA levels were increased in five of five animals within 2 h of estradiol administration and remained elevated at 4 and 6 h. The net increase in glandular epithelial (7.31 ± 2.72 attomol/fmol 18S ribosomal rRNA) and stromal (3.13 ± 0.36) cell VEG/PF mRNA levels after estradiol administration was over 8-fold (P < 0.05) and 2.6-fold (P < 0.01) greater, respectively, than after vehicle (0.90 ± 0.30, glands and 1.20 ± 0.33, stroma). In contrast, endometrial VEG/PF mRNA expression was unaltered by progesterone. After estradiol treatment, endometrial paracellular cleft width was increased (P < 0.01) from a mean (±SE) of 71.6 ± 4.6 nm at 0 h to 101.1 ± 6.4 nm at 6 h, whereas vehicle or progesterone had no effect. We suggest that estrogen has a major role in regulating VEG/PF synthesis and early events in angiogenesis in the primate endometrium.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Using the baboon as a nonhuman primate model for the study of human reproductive endocrinology, we (10, 11) recently showed that endometrial glandular epithelial and stromal cell VEG/PF mRNA and protein expression was markedly decreased by ovariectomy and restored to normal by chronic administration of estrogen in levels that replicated the late proliferative/mid cycle estrogen surge phase of the menstrual cycle. Stimulatory effects of chronic estrogen administration on endometrial VEG/PF expression were also recently shown in the ovariectomized rhesus monkey by Nayak and Brenner (12). However, because long-term administration of steroid hormone may cause cellular differentiation, it remains to be determined whether the elevation in endometrial VEG/PF mRNA levels in primates treated chronically with estrogen reflected genomic up-regulation of VEG/PF. Moreover, it is not known whether an acute increase in endometrial VEG/PF expression in the primate leads to physiological events important to the process of angiogenesis, such as alteration in microvascular permeability.
In the present study, therefore, the temporal expression of VEG/PF mRNA levels was determined in glandular epithelial and stromal cells isolated by laser capture microdissection (LCM) from the endometrium of ovariectomized baboons after acute administration of estradiol and/or progesterone. Concurrently, the width of paracellular clefts between adjacent endometrial microvascular endothelial cells, which are comprised of tight junctions important in regulating vessel permeability, was also determined in baboons and correlated temporally with the expression of VEG/PF.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Young (6–8 yr old) adult female baboons (Papio anubis) originally obtained from the Southwest Foundation for Biomedical Research (San Antonio, TX) and weighing 12–15 kg were used in this study. Primarily nulliparous and a few multiparous (i.e. one or two prior pregnancies) baboons were used in this study. However, similar results for endometrial responsivity to steroid hormone were obtained in each instance. Baboons were housed individually in large primate cages in air-conditioned rooms, 12-h light, 12-h dark cycle, and received 20% protein primate chow (2050 Primate Diet, Harlan, Madison, WI) and fresh fruit twice daily and water ad libitum. Baboons were cared for and used strictly in accordance with U.S. Department of Agriculture regulations and the NIH Guide for the Care and Use of Laboratory Animals (Publication no. 86-23, 1985). The experimental protocols used in the present study were approved by the Institutional Animal Care and Use Committee of the University of Maryland School of Medicine.
Female baboons exhibiting regular menstrual cycles (mean ± SE length of cycle = 33.0 ± 0.5 d) were anesthetized with isoflurane (1.0–1.5%): nitrous oxide (0.5 liters/min): oxygen (2.0 liters/min) and bilaterally ovariectomized to remove the principal source of estrogen and progesterone (10). Ovariectomized baboons were then left for at least 60 d before being used for acute temporal study of endometrial VEG/PF expression and microvessel endothelial morphology. During the 5 d immediately preceding the study, ovariectomized baboons were injected sc daily with the highly specific aromatase inhibitor CGS 20267 (letrozole, 4,4'-[1,2,3-triazyol-1-yl-methylene]-bis-benzonitrite; Novartis Pharma AG, Basel, Switzerland) at a dosage of 0.5 mg/0.25 cc sesame oil to suppress potential aromatization in nonovarian sites. At 0800 h on the day of experimentation, baboons were anesthetized with isoflurane, placed in a supine position on a 37 C warming pad and underlying thick sponge rubber pad on a surgical table, continuously administered physiological saline (25–30 ml/h) via a 21-gauge catheter (Intracath, 19 gauge, 24 in., Becton DickinsonVascular Access, Sandy, UT) inserted into a peripheral saphenous vein and blood pressure and level of anesthesia monitored. A midline 5- to 6-cm abdominal incision was made to expose the uterus for subsequent biopsy, and at time 0 baboons then received estradiol and/or progesterone iv and sc to elicit a rapid surge, then sustained release of hormone to study the temporal effect on endometrial VEG/PF mRNA expression and microvascular paracellular clefts. Baboons were treated with either: 1) estradiol [a bolus of 1.0 µg/kg body weight 17ß-estradiol (Sigma, St. Louis, MO) in 0.5 ml 5.0% ethanol: normal saline delivered via a 23-gauge needle into an antecubital vein plus three SILASTIC brand implants (Dow Corning, Midland, MI) sc, 4.65 mm outside diameter x 6 cm length, containing 17ß-estradiol]; 2) estradiol (as above) plus progesterone [bolus of 15.0 µg/kg body weight progesterone (Sigma) in ethanol: saline delivered via antecubital vein and four SILASTIC brand implants sc containing progesterone]; 3) progesterone (as above); or 4) ethanol: saline vehicle.
Blood samples (2 ml) were obtained via the peripheral saphenous vein catheter periodically during the study period for determination of serum estradiol and progesterone concentrations by RIA as described previously (13). Intraassay and interassay coefficients of variation were 6.9% and 7.3%, respectively, for estradiol and 7.6% and 7.9%, respectively, for progesterone RIA.
Single 5-mm diameter core biopsies (Acu-Punch, Acuderm, Inc., Ft. Lauderdale, FL) were obtained from the uterine fundus, alternating from anterior and posterior surfaces, extending transmurally from outer surface to lumen at 0, 2, 4, and 6 h after steroid hormone administration. A small piece of gelatin sponge (Surgifoam, Ferrosan Inc., Soeborg, Denmark) and single 5–0 chromic suture (Ethicon, Inc., Sommerville, NJ) were applied immediately after each biopsy to rapidly seal the site of tissue excision.
In the biopsies of the first three estradiol-treated baboons, the endometrium was macroscopically sliced from the myometrium, ensuring that a thin rim of endometrium was left behind to prevent myometrial contamination. This endometrial sample was immediately frozen and stored in liquid nitrogen for subsequent VEG/PF mRNA analysis collectively in all endometrial cells (i.e. whole endometrium). The uterine biopsies obtained from the remaining estradiol and/or progesterone-treated baboons were embedded in a cryomold filled with OCT medium (Sakura Finetek USA, Inc., Torrance, CA), frozen on dry ice, and stored at -80 C for subsequent VEG/PF mRNA analysis in glandular epithelial and stromal cells isolated by LCM. In four of the estradiol-treated baboons, two progesterone-treated baboons, and one vehicle-treated baboon approximately one quarter (sliced longitudinally) of the uterine specimen obtained at 0 and 6 h was removed before embedding in OCT, the myometrium sliced off, and the remaining endometrium containing both functionalis and basalis zones prepared for electron microscopic analysis of endothelial paracellular clefts.
LCM of endometrial cells
Glandular epithelial and stromal cells were isolated from the endometrium by LCM as described previously (10). Briefly, serial 8-µm sections of the uterine biopsy were cut longitudinally (to include endometrium and myometrium) on a Jung Frigocut 2800E cryostat at -20 C (Leica Corp., Deerfield, IL) and mounted onto Superfrost Plus glass slides (Fisher Scientific, Suwanee, CA) at room temperature. Sections were immediately fixed in 70% ethanol for 30 sec, washed with distilled water, incubated in 95% ethanol, immersed in Eosin-Y (Richard Allen, Kalamazoo, MI) for 10 sec, dehydrated in 100% ethanol, and incubated 5, 10, and 15 min in xylene. Slides were air-dried and transferred to a desiccator at room temperature, and an Arcturus PixCell II LCM system equipped with an Olympus Corp. microscope (Arcturus Engineering, Inc., Mountain View, CA) was then used to capture glandular (but not luminal) epithelial and stromal (but not observable blood vessels) cells randomly from both the basalis and functionalis zones of the endometrial sections. A single LCM cap (Capture Transfer Film TF100, Arcturus Engineering, Inc.) was used per tissue section, and optimal conditions for LCM included a laser power of 40 mW and duration of 1.5–2.5 msec, and laser spot-size of 7.5 or 15 µm for glandular epithelium (depending on gland size) and 15 or 30 µm for stroma. Captured cells were then mixed with lysis buffer (RNeasy, QIAGEN, Valencia, CA) in a single Eppendorf tube (Brinkman Instruments, Inc., Westburg, NY), microcentrifuged, stored in lysate buffer overnight at -80 C and RNA extracted within 72 h. The entire cell capture process, from tissue sectioning to tissue lysis, was rapidly completed to limit RNA degradation.
VEG/PF mRNA competitive RT-PCR
RNA isolation and oligonucleotide primers. Total RNA was isolated from whole endometrium by guanidine isothiocyanate-cesium chloride and from LCM-captured glandular epithelial and stromal cells using a RNeasy Mini Kit (QIAGEN). LCM samples were then treated with amplification grade deoxyribonuclease 1 (Invitrogen-Life Technologies, Inc., Carlsbad, CA) to eliminate any residual DNA contamination, and RNA precipitated in sodium acetate/ethanol, and resuspended in 10 µl ribonuclease (RNase)-free water.
Total RNA in whole endometrial tissue was quantified by UV absorption spectrophotometry to permit normalization of VEG/PF mRNA levels. However, because of the limited yield of total RNA from LCM samples, UV absorption could not be used to quantify total RNA. Therefore, the levels of 18S ribosomal RNA (rRNA), a cellular RNA whose expression was relatively constant during the menstrual cycle (data not shown), were quantified by competitive RT-PCR to normalize VEG/PF mRNA levels determined in uterine cells isolated by LCM.
Oligonucleotide primers were synthesized by Invitrogen-Life Technologies, Inc. and based on the human VEG/PF (14) and 18S rRNA (15) cDNA sequences, as detailed previously (10): VEG/PF primer 1: downstream, 5'-GGTGAGGTTTGATCCGCATAATCTGCGCATCAGGGGCACACAGGAT-3'; VEG/PF primer 2: upstream, 5'-AATTTAATACGACTCACTATAGGGACTGCTGTCTTGGGTGCATTGG-3'; VEG/PF primer 3: downstream, 5'-GGTTTGATCCGCATAATCTGC-3'; VEG/PF primer 4: upstream, 5'-CTGCTGTCTTGGGTGCATTGG-3'; 18S rRNA primer 5:downstream, 5'-CGGCGTAGGGTAGGCACACGCTGAGCC AGTCAGTGTAGCGCGCGTGCAGCCCCGGACATCTAAGGGCATCACA-3'; 18S rRNA primer 6: upstream, 5'-GCGGCGTAATACGACTCACTATAGGGAGAGGAGTCAAGAACGAAAGTCGGA GGGCTTCCGGGAAACCAAAGTC-3'; 18S rRNA primer 7: downstream, 5'-GGACATCTAAGGGCATCACA-3' and 18S rRNA primer 8: upstream, 5'-TCAAGAACGAAAGTCGGAGG-3'.
Competitive reference standard. Homologous RNA fragments, i.e. competitive reference standards (CRS), containing the same primer binding regions but shortened internal sequence with respect to the target RNA for VEG/PF and 18S rRNA were prepared as described previously (10, 16). Reverse transcription (RT) of total RNA (0.5–3.0 µg) from baboon placenta (VEG/PF) or uterus (18S rRNA) was performed at 42 C for 60 min in a reaction volume (20 µl) containing 1 mM each of deoxy (d)-ATP, dCTP, dGTP, and deoxythymine triphosphate (Invitrogen-Life Technologies, Inc.), 200 U SUPERSCRIPT RNase H-RT or Molony murine leukemia virus RT (Invitrogen-Life Technologies, Inc.), 1x RT buffer, 40 U RNAguard (Amersham Pharmacia Biotech, Piscataway, NJ), and 250 ng random primers (Invitrogen-Life Technologies, Inc.). The RT reaction was terminated by heat inactivation of the RT enzyme at 70 C for 15 min, cooled to 4 C and 5 µl of the RT reaction was added to separate PCR volumes (45 µl) containing 0.2 mM each of dATP, dCTP, dGTP, and deoxythymine triphosphate, 1.25 U cloned Thermus aquaticus DNA polymerase (Amplitaq, Perkin Elmer/Cetus, Norwalk, CT), 1x PCR buffer, and 10 pmol of the respective paired primers to generate cDNA templates for VEG/PF and 18S rRNA. PCR was performed in a programmable thermal cycler (MJ Research, Inc., Cambridge, MA) for 25 (VEG/PF) and 20 (18S rRNA) sequential cycles, respectively. The amplification profile consisted of denaturation at 94 C for 1 min, primer annealing at 60 C for 1 min and extension at 72 C for 2 min, with a final extension at 72 C for 5 min. An aliquot of each reaction was subjected to 2.0% agarose gel electrophoresis, amplified products visualized by ethidium bromide staining and gel purified (QIAGEN DNA extraction kit), and the CRS synthesized from cDNA template (150 ng) using the MEGAscript T7 in vitro transcription kit (Ambion, Inc., Austin, TX). The cDNA templates were removed from the transcription reaction products by treatment with RNase-free deoxyribonuclease 1 (Ambion, Inc.), extracted with chloroform: isoamyl alcohol, and aliquots of CRS quantitated via UV absorption spectrophotometry at an OD of 260 nm.
RT-PCR assay. VEG/PF and 18S rRNA mRNA levels were simultaneously quantified by competitive RT-PCR assay (16, 17). A constant amount of RNA (1.5 µl of LCM sample or 600 ng of whole endometrium) was added to an RT mixture containing 2- or 3-fold serial dilutions of both VEG/PF-CRS (5400–200 attomol for whole endometrial samples and 25–0.02 attomol for LCM samples, respectively) and 18S rRNA-CRS (5–0.02 fmol). In all experiments, the presence of possible pseudogene or genomic DNA contamination was checked by control reactions in which either the RT enzyme or RNA was omitted. At least four points of the CRS curve were used for both VEG/PF and 18S rRNA quantitation.
Five and 2 µl of the RT mixture for VEG/PF and 18S rRNA, respectively, were added to separate PCR mixtures containing 10 pmol of the respective paired primers for VEG/PF and 18S rRNA. Total endometrial and LCM VEG/PF, and LCM 18S rRNA samples were amplified for 26, 34, and 24 sequential cycles, respectively; PCR products were gel fractionated, visualized with ethidium bromide, and photographed using type 665 positive/negative film (Polaroid Corp., Cambridge, MA).
Negatives were scanned using a Gel Doc 1000 imaging system and Multi-Analyst software program (Bio-Rad Laboratories, Inc., Hercules, CA). The intensity of amplified target and CRS cDNA products was represented as the relative area under each product band. A correction factor (18) was used to account for the relative size difference between target and CRS cDNAs. The logarithm (log) of the ratio of CRS to target area was plotted as a function of the log concentration of VEG/PF or 18S rRNA CRS added to each PCR. The latter curve plotted for each sample was analyzed by linear regression to ensure linear PCR amplification, indicative that RNA from LCM cells was intact within the region spanned by our sets of primers, and that the assay was performing optimally. The sample was reassayed if PCR amplification was not linear. The concentration of VEG/PF or 18S rRNA target mRNA was determined where the ratio of the log of CRS and target area was equal to 0 (i.e. the equivalence point).
Electron microscopic analysis of paracellular clefts
Endometrial biopsies for electron microscopic analysis were dissected into 1 x 1-mm pieces and fixed for 24 h in phosphate-buffered 4% formaldehyde/1% glutaraldehyde. After washing with sucrose buffer, endometrial fragments were incubated in 1% osmium tetroxide for 1 h, processed through a graded series of alcohol, and embedded in Epon resin (Poly/Bed 812, Polysciences Inc., Warrington, PA). Thick sections (
1 µm) were cut, counterstained with hematoxylin, and visualized at x100 and x200 magnification to identify vascularized areas of endometrium. Thin (80 nm) sections were then cut via a diamond knife, placed onto copper grids, stained with uranyl acetate and lead citrate, and viewed under an electron microscope (Joel JEM-100CX, Toyko, Japan) at 60 kV.
For each endometrial tissue sample, endothelial paracellular cleft widths were determined on 7–16 randomly chosen microvessels (i.e. comprised of 1–4 intact endothelial cells). Only junctional membranes that were sectioned perpendicularly at right angles (i.e. opposing parallel membranes in the section plane) were included for analysis. Paracellular cleft tight junctions were defined as the narrowest point of membrane apposition between two adjoining microvessel endothelial cells. A minimum of 4–8 electron microphotographs at x66,000 were taken for each endometrial microvessel. The final electron photomicrograph magnification (correcting for calibration and negative to print enlargement) from which paracellular cleft width measurements were made approximated x178,200. Paracellular cleft width data are presented in nanometers. The intraassay (i.e. between vessel, within animal) coefficient of variation for cleft width was relatively low (12.3%), indicating that this aspect of endothelial cell morphology was consistent across different microvessels in the endometrium.
Statistical analysis
Data were expressed as the means ± SE and analyzed either by ANOVA with post hoc comparisons of means by Newman-Keuls multiple comparison test or by Student’s paired t test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Peripheral serum estradiol concentrations were undetectable (i.e. <0.20 pg/ml) in ovariectomized baboons before acute steroid hormone administration. Within 0.25 h of bolus iv injection and sc implants of estradiol, mean ± SE serum estradiol levels increased to a maximum of 1,890 ± 247 pg/ml, and then progressively declined reaching values of 1,206 ± 313, 777 ± 223, and 441 ± 127 pg/ml at 2, 4, and 6 h after estrogen treatment (Table 1
). The absolute levels and temporal pattern of serum estradiol levels after administration of estradiol plus progesterone were similar to those values exhibited in baboons receiving estrogen alone (Table 1). In contrast, serum estradiol concentrations in ovariectomized baboons treated with vehicle or progesterone remained at less than 0.20 pg/ml.
|
). Similar levels of serum progesterone were observed over the acute study period in animals treated with progesterone alone. Endometrial VEG/PF mRNA
Figure 1 illustrates results of a representative competitive RT-PCR analysis of VEG/PF mRNA in whole endometrial tissue of an ovariectomized baboon before (i.e. time 0) and 2 h after treatment with estradiol. Using primers upstream from the alternative splice site, PCR generated a 323-bp target product that reflected collective expression of all of the VEG/PF isoforms and a 256-bp VEG/PF CRS product (Fig. 1A). PCR products were not generated when RNA or RT enzyme were omitted from the reaction. The correlation coefficients for regression of the log of the ratio of CRS and target areas with the log of increasing CRS were 0.98 (P < 0.01) and 0.99 (P < 0.01) for RNA from endometrial tissue obtained at 0 h and 2 h after estradiol administration, respectively (Fig. 1B), indicating linear PCR amplification in both samples.
|
shows the time-course for VEG/PF mRNA levels in whole endometrial tissue obtained from ovariectomized baboons after the acute administration of estradiol. Mean (±SE) VEG/PF mRNA levels (attomoles per microgram total RNA) increased approximately 5- to 6-fold (P < 0.01) from 812 ± 135 at time 0 to 4404 ± 946 and 5091 ± 1303 at 2 h and 4 h, respectively, and remained elevated at 6 h after estradiol administration.
|
shows the time-course for VEG/PF mRNA levels in isolated glandular epithelial and stromal cells of ovariectomized baboons treated with saline vehicle or estradiol. Glandular epithelial and stromal VEG/PF mRNA levels, corrected for 18S rRNA simultaneously determined by competitive RT-PCR, at time 0 h (0.66 ± 0.20 glands and 0.46 ± 0.24 stroma), remained relatively low 2 h (1.51 ± 0.70 and 1.37 ± 0.55), 4 h (2.70 ± 0.67 and 2.12 ± 1.49), and 6 h (1.34 ± 0.40 and 1.99 ± 1.08) after injection of vehicle and repeated biopsy. In contrast, after acute administration of estradiol basal glandular epithelial and stromal VEG/PF mRNA levels (1.36 ± 0.59 glands and 1.88 ± 1.30 stroma) increased approximately 7-fold and 3-fold, respectively, in 5 of 5 animals to mean ± SE levels of 8.70 ± 5.65 and 4.68 ± 1.36, respectively, at 2 h, 5.49 ± 1.80 and 5.50 ± 1.67 at 4 h, and 12.83 ± 8.29 and 5.18 ± 1.92 at 6 h (Fig. 3).
|
shows the net increase in VEG/PF mRNA level collectively at 2, 4, and 6 h (i.e. difference between mean value at 2, 4, and 6 h vs. basal value at time 0) in glandular epithelial and stromal cells isolated from the endometrium of ovariectomized baboons after administration of estradiol and/or progesterone. The net increase in glandular epithelial cell VEG/PF mRNA levels after the acute administration of estradiol (7.31 ± 2.72 attomol/fmol 18S rRNA) was 8-fold greater (P < 0.05) than that obtained after administration of saline-ethanol vehicle alone (0.90 ± 0.30 attomol/fmol 18S rRNA). The net increase in VEG/PF mRNA levels in stromal cells was 2.6-fold greater (P < 0.01) in estradiol-treated (3.13 ± 0.36 attomol/fmol 18S rRNA) than in vehicle-treated (1.20 ± 0.33 attomol/fmol 18S rRNA) baboons (Fig. 4). However, the absolute level of and relative increase in VEG/PF mRNA achieved with estradiol treatment was not as large in stromal as in glandular epithelial cells. In contrast to the increase in endometrial VEG/PF mRNA expression observed with estradiol treatment of baboons, the increases in glandular epithelial and stromal cell VEG/PF mRNA levels were diminished or prevented by concomitant administration of estradiol and progesterone (Fig. 4). Moreover, glandular epithelial and stromal VEG/PF mRNA levels in baboons treated with progesterone alone appeared similar to those observed with vehicle treatment.
|
Figure 5 shows a representative electron photomicrograph illustrating paracellular clefts between adjacent endothelial cells of endometrial microvessels of an ovariectomized baboon before and 6 h after acute estradiol treatment. Paracellular cleft width appeared to be increased, and tight junctions appeared to disappear (i.e. open) within 6 h of estradiol administration. Microvessel paracellular cleft widths in individual ovariectomized baboons before and after administration of vehicle/progesterone or estradiol are shown in Fig. 6. After estradiol administration, paracellular cleft width was increased (P < 0.01, paired t test) in four of four baboons, from a mean (±SE) of 71.6 ± 4.6 nm at 0 h to 101.1 ± 6.4 nm at 6 h. In contrast, paracellular cleft width was similar in value 0 h (70.1 ± 3.8 nm) and 6 h (72.3 ± 3.3 nm) after acute administration of saline: ethanol vehicle or progesterone.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in band shift assays and that confer estrogen inducibility to reporter constructs have been identified in two regions of the gene, one in the 5'-untranslated region (8). In primary human endometrial epithelial and stromal cells, estradiol stimulated VEG/PF gene transcription through a functional single variant estrogen response element located 1.5-kb upstream from the transcriptional start site (19). Considering these observations in vitro, and because the induction of VEG/PF mRNA in vivo in the rodent uterus was rapid, blocked by antiestrogens, and inhibited by actinomycin D but not puromycin or cycloheximide (8, 20), it is likely that the regulatory effects of estrogen on endometrial VEG/PF expression involve VEG/PF gene transcription and are mediated by the estrogen receptor. The observation of a rapid elevation in endometrial VEG/PF expression by estradiol in baboons of the present study, when considered with presence of the estrogen receptor and ß within the human (21), rhesus monkey (22, 23), and baboon (24) endometrium, suggest that estrogen has similar important actions on VEG/PF expression in the primate uterus. Others have concluded that steroid hormones have no role in regulating human endometrial VEG/PF expression (25, 26) because there are no major changes in VEG/PF expression during the menstrual cycle, despite the surges in estrogen and progesterone. We suggest that the levels of estrogen, albeit low, preceding and following the midcycle surge in estrogen, are nevertheless sufficient and necessary to maintain VEG/PF expression throughout the course of the menstrual cycle. Thus, it appears that VEG/PF expression was suppressed in the primate uterus only after serum estradiol levels were eliminated by ovariectomy. The ability to experimentally deplete and restore the levels of endogenous steroid hormones by ovariectomy and hormone replacement is of significant advantage and demonstrates the value of the nonhuman primate baboon model to study the regulation of events important to endometrial growth, development and function. Sustained VEG/PF synthesis would seem necessary to promote angiogenesis at the onset of the cycle for vascular reconstruction, throughout the proliferative phase for expansion of the vessel bed, and during the second half of the cycle for growth and elongation of the vascular tree.
The present study is also significant in showing for the first time in the primate that the estrogen-induced increase in endometrial VEG/PF expression was rapidly followed by a significant increase in paracellular cleft width and the apparent opening of tight junctions between microvessel endothelial cells of the endometrium. There is broad consensus that paracellular clefts form the principal pathway for water and hydrophilic solute flux across the capillary wall (27, 28). Indeed, there is excellent correlation between open tight junctions and extravasation of molecules such as albumin (29). Moreover, within 2 h of VEG/PF administration to mice, several changes indicative of increased vascular permeability occurred in the blood-brain barrier, including appearance of interendothelial cell gaps (30). Thus, the increase in uterine vascular permeability induced by acute estradiol administration to the rat is believed to be due to the formation of gaps between capillary endothelial cells (31, 32). One of the early events critical for angiogenesis is increased microvessel permeability (4, 5) and the rapid estradiol-induced up-regulation of uterine VEG/PF expression (7) precedes, and therefore may mediate, the well established early action of estrogen on microvascular permeability in the rodent uterus (33, 34). Consistent with this concept, the administration of VEG/PF antisera to immature rats blocked the marked increase in endometrial stromal edema induced by estradiol (35). Therefore, although further in vivo study is needed in the baboon, e.g. direct assessment of microvessel permeability by an indicator diffusion method (36), the concomitant and temporally related estrogen-induced increases in endometrial VEG/PF expression and microvessel paracellular cell gaps are consistent with the concept that VEG/PF mediated the changes in endometrial microvessel architecture elicited by estrogen in primates of the present study. However, because estrogen receptor and ß also are present in endometrial vascular endothelial cells in the human (37) and rhesus monkey (38), and estrogen promoted vascular endothelial cell proliferation (39), estrogen may also exert direct actions on microvessel function. Therefore, additional studies using antagonists of VEG/PF expression or action, e.g. soluble truncated VEG/PF receptor as has been used to study VEG/PF action in the corpus luteum of the marmoset monkey (40), are needed to definitively link estrogen, VEG/PF, and early aspects of angiogenesis in the primate endometrium.
In the present study, estradiol quickly up-regulated VEG/PF mRNA levels in both glandular epithelial and stromal cells within the baboon endometrium. Conceivably, therefore, the glands or stroma or both may serve as a source of VEG/PF to promote angiogenesis in the endometrium during the menstrual cycle. Considering the close approximation of the glandular epithelium and rich subepithelial microvascular network that develops immediately below the surface of the endometrium during the reproductive cycle, VEG/PF originating from glandular epithelial cells may be particularly important for angiogenesis in this location. However, because VEG/PF secretion from glandular epithelial cells appears to be largely apical in nature (41), it has also been suggested that most of the VEG/PF produced in the glands may be of greater importance to events associated with implantation. With initiation of a new menstrual cycle, preexisting vessels in the zona basalis give rise via angiogenesis to capillary sprouts, and under these circumstances VEG/PF originating from the stroma may be especially important in promoting angiogenesis and consequently the vascular foundation necessary for progressive growth and differentiation of the endometrium.
Although progesterone has been reported to increase VEG/PF mRNA expression in vivo in the rat (7, 8) and rhesus monkey (42) uterus, and in vitro in human endometrial cells (43), the magnitude of increase was less and the onset of induction slower than exhibited with estrogen. Brenner and co-workers (44) have shown both in the human and macaque that the VEG/PF KDR/flk-1 receptor, normally only expressed in the vascular endothelium, was markedly elevated in stromal cells of the superficial endometrial zones upon progesterone withdrawal during the premenstrual phase. In the present study, progesterone administered simultaneously with estradiol diminished the stimulatory effect observed with estradiol alone on endometrial glandular epithelial and stromal VEG/PF mRNA expression. This blunting effect of progesterone on VEG/PF expression is reminiscent of the inhibitory effect that progesterone has on other actions of estrogen in the endometrium, e.g. generation of the receptors for both estrogen and progesterone (2, 45). When administered alone to baboons of the present study, progesterone had no effect on endometrial VEG/PF expression or endothelial paracellular cleft width. The latter might be expected, however, because estrogen priming is needed to produce the estrogen and progesterone receptors (46).
In summary, the acute administration of estradiol to ovariectomized baboons within 2 h up-regulated VEG/PF mRNA expression by both glandular epithelial and stromal cells of the endometrium, and within 6 h increased endometrial endothelial paracellular cleft width as a marker of microvessel permeability, an early process apparently important for angiogenesis. These results suggest that estrogen has a major role in regulating VEG/PF synthesis and early events in angiogenesis in the primate endometrium.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: CRS, Competitive reference standards; d, deoxy; LCM, laser capture microdissection; log, logarithm, PF, permeability factor; RNase, ribonuclease; rRNA, ribosomal RNA; RT, reverse transcription; VEG, vascular endothelial growth.
Received October 3, 2002.
Accepted March 28, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ß in the baboon fetal adrenal gland. Endocrinology 140:5953–5961, is present in the vascular endothelium of the human and nonhuman primate endometrium. J Clin Endocrinol Metab 86:1370–1378This article has been cited by other articles:
 |
|
 |
|
  G. W. Aberdeen, S. J. Wiegand, T. W. Bonagura Jr., G. J. Pepe, and E. D. Albrecht Vascular Endothelial Growth Factor Mediates the Estrogen-Induced Breakdown of Tight Junctions between and Increase in Proliferation of Microvessel Endothelial Cells in the Baboon Endometrium Endocrinology, December 1, 2008; 149(12): 6076 - 6083. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. W. Bonagura, G. J. Pepe, A. C. Enders, and E. D. Albrecht Suppression of Extravillous Trophoblast Vascular Endothelial Growth Factor Expression and Uterine Spiral Artery Invasion by Estrogen during Early Baboon Pregnancy Endocrinology, October 1, 2008; 149(10): 5078 - 5087. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. M. Fraser, H. Wilson, A. Silvestri, K. D. Morris, and S. J. Wiegand The Role of Vascular Endothelial Growth Factor and Estradiol in the Regulation of Endometrial Angiogenesis and Cell Proliferation in the Marmoset Endocrinology, September 1, 2008; 149(9): 4413 - 4420. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. N. Jabbour, R. W. Kelly, H. M. Fraser, and H. O. D. Critchley Endocrine Regulation of Menstruation Endocr. Rev., February 1, 2006; 27(1): 17 - 46. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M Walter, P. A W Rogers, and J. E Girling The role of progesterone in endometrial angiogenesis in pregnant and ovariectomised mice Reproduction, June 1, 2005; 129(6): 765 - 777. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Y Lee and F. J DeMayo Animal models of implantation Reproduction, December 1, 2004; 128(6): 679 - 695. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. D. Albrecht, V. A. Robb, and G. J. Pepe Regulation of Placental Vascular Endothelial Growth/Permeability Factor Expression and Angiogenesis by Estrogen during Early Baboon Pregnancy J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5803 - 5809. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. A. Robb, G. J. Pepe, and E. D. Albrecht Acute Temporal Regulation of Placental Vascular Endothelial Growth/Permeability Factor Expression in Baboons by Estrogen Biol Reprod, November 1, 2004; 71(5): 1694 - 1698. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. D. Albrecht, J. S. Babischkin, Y. Lidor, L. D. Anderson, L. C. Udoff, and G. J. Pepe Effect of estrogen on angiogenesis in co-cultures of human endometrial cells and microvascular endothelial cells Hum. Reprod., October 1, 2003; 18(10): 2039 - 2047. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
) and 2 h (•) after estradiol treatment were plotted as a function of the log of CRS concentration added to each PCR. Lines were constructed by linear regression analysis and VEG/PF mRNA levels determined from the equivalence points (i.e. intersection of vertical with regression lines). Correlation coefficients (r2) determined by linear regression were 0.98 (P < 0.01) for 0 h and 0.99 (P < 0.01) 2 h after estradiol treatment of ovariectomized baboons.
, n = same 4 animals consecutively biopsied) or estradiol (
, n = same 5 animals consecutively biopsied) as detailed in the footnote of Table 1
