| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Medicinal Chemistry and Pharmacognosy, College of Pharmacy, Ohio State University, Columbus, Ohio 43210
Address all correspondence and requests for reprints to: Robert W. Brueggemeier, Ph.D., 250 Parks Hall, 500 West 12th Avenue, The Ohio State University, Columbus, Ohio 43210. E-mail: Brueggemeier.1{at}osu.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Transcriptional regulation of CYP19 (aromatase) in normal breast adipose tissue is directed by exons I.3, I.4, and promoter II (PII), with exon I.4 being the major promoter used (6, 7, 8, 9). Exon I.4 is regulated by dexamethasone in the presence of serum and class I cytokines such as IL-6. Promoters I.3 and II are both transactivated by protein kinase A (PKA)/cAMP-dependent signaling pathways (10, 11, 12). In addition, exon I.3 is also regulated by phorbol esters, which activate protein kinase C (PKC) (13, 14). However, in adipose tissue proximal to a breast tumor, increased expression of aromatase occurs and the major promoters used are switched to exons I.3 and II (9, 12, 13, 14, 15, 16, 17).
The exon-switching mechanism is most likely reflective of changes in transcriptional regulators or their relative concentrations that occur in the cancerous breast as opposed to the disease-free breast (18). Conditioned medium from breast tumor fibroblasts has been shown to significantly stimulate aromatase activity in cultured breast tissue fibroblasts (19). It is hypothesized that the prostaglandin E2 (PGE2) is a major factor produced by breast tumors that mediates promoter switching. PGE2 is a major secretory product of breast tumor epithelial cells as a consequence of cyclooxygenase-2 overexpression, and high levels of this prostaglandin are also found in fibroblasts, macrophages, and lymphocytes at the tumor site (20, 21). It is thought that PGE2 influences aromatase activity and expression by paracrine communication between tumor epithelial cells and cell-surface receptors on the surrounding stromal cells. PGE2 is capable of activating both PKA and PKC pathways and has been shown to regulate aromatase expression from promoter II in cultured adipose stromal cells (16, 22).
There are four main prostanoid receptors to which PGE2 binds, designated EP1 (23), EP2 (24), EP3 (25, 26), and EP4 (27, 28), based on their different pharmacological properties and secondary messenger pathways (29, 30). These G protein-coupled receptor pathways are classified as either stimulatory or inhibitory. EP1 is linked to a stimulatory pathway that activates PKC and initiates a cascade of serine/threonine phosphorylation events. Both the EP2 and EP4 receptors are coupled to the PKA signal transduction system. However, in contrast to the EP2 receptor, the signal produced by the EP4 receptor is lost within a few minutes because of agonist-induced desensitization (31). EP3 is the only inhibitory receptor identified thus far. It is also coupled to the adenylate cyclase-PKA signal transduction system, but its effects are mediated by an inhibitory G protein subunit. This pathway represents an inherent mechanism of terminating PGE2 signaling.
All four PGE2 receptors are found in most tissues (30, 32, 33), localized on the plasma membrane and the nuclear envelope (34, 35). However, characterization of these receptors in breast tissue has not been performed to date. This may be limited partly by the availability of commercial antibodies to each of these subtypes. Nevertheless, determining which EP receptors are expressed is important in elucidating the mechanism(s) by which PGE2 regulates aromatase in the disease free and cancerous breast. It is possible that certain cell types, such as fibroblasts, may express more than one subtype, which could signify multiple pathways of regulation.
Our hypothesis is that PGE2 may regulate aromatase gene expression via multiple receptor-linked pathways. In the present study, the mechanisms by which PGE2 influence aromatase activity and expression in the normal human breast were investigated. Receptor agonists and antagonists were used to assess the responses of stromal cells isolated from reduction mammoplasty tissues. The results demonstrate that the EP1, EP2, and EP3 signaling pathways are involved. This complex regulation may or may not become dysfunctional in the neoplastic breast.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Radiolabeled [1ß-3H]-androst-4-ene-3,17-dione was obtained from NEN Life Science Products (Boston, MA). The following compounds were purchased from Cayman Chemical (Ann Arbor, MI): PGE2, 5-trans PGE2, 17-phenyl trinor PGE2, 11-deoxy PGE1, sulprostone, SC-19220, and AH 6809. The aromatase inhibitor 7
-(4'-amino) phenylthio-1,4-androstaediene-3,17-dione (7-APTA) was synthesized in our laboratory following published methods (36, 37, 38). Androstenedione was purchased from Steraloids (Wilton, NH), and all other chemicals were obtained from Aldrich Laboratories, Inc. (Milwaukee, WI). Dexamethasone, indomethacin, tetradecanoyl phorbol acetate (TPA), double-stranded lyophilized DNA and the ß-actin monoclonal antibody (mouse) were obtained from Sigma (St. Louis, MO). The human EP1 receptor polyclonal antibody and the human EP2 receptor polyclonal antibody were obtained from Cayman Chemical. The equine aromatase polyclonal antibody (39) was a kind gift from Dr. Gilles-Eric Seralini (University of Caen, Caen, France). The enhanced chemiluminescent kit was obtained from Roche Molecular Biochemicals (Indianapolis, IN). DMEM/F12 media, trypsin, TRIzol, and all enzymes were obtained from Invitrogen (Carlsbad, CA). Radioactive samples were counted on a LS6800 liquid scintillation counter (Beckman, Palo Alto, CA). Mixture 3a70B was obtained from Research Prospect International Corp. (Mount Prospect, IL). A J2–21 centrifuge (Beckman) was used to separate different cellular components.
Cell culture
Patient breast tissues were obtained through the Tissue Procurement Shared Resource Program of the Ohio State University Comprehensive Cancer Center. All tissue specimens used were from cancer-free female patients that underwent reductive mammoplasty. Primary breast fibroblasts were isolated by 0.1% collagenase digestion of breast tissue specimens and cultured as described previously (40) in T-75 flasks containing DMEM/F12 media supplemented with 10% fetal bovine serum, L-glutamine (5 mM), and gentamicin (0.025%). For all experiments, the cells were plated in T-25 flasks or 100-mm plates and grown to subconfluency. Before treatment, the media was changed to a defined one containing DMEM/F12 media with 1.0 mg/ml human albumin (OSU Hospital Pharmacy), 5.0 mg/liter human transferrin and 5.0 mg/liter bovine insulin.
Tritiated water-release assay
Aromatase activity was measured in adipose stromal cells with a tritiated water-release assay described previously (41). Cells in T-25 flasks were treated with 0.1% ethanol (control) dexamethasone (100 nM), the aromatase inhibitor 7-APTA (100 nM), the phorbol ester, TPA (10 nM), and the following compounds at 1-µM concentrations: indomethacin, PGE2, 5-trans PGE2, 17-phenyl trinor PGE2, 11-deoxy PGE1, and sulprostone. The antagonists SC-19220 (EP1) and AH 6809 (EP1/EP2) were added simultaneously with agonists at 10 µM. After 24 h, the cells were incubated for 6 h with fresh media and drugs along with 50 nM androstenedione including 2 µCi [1ß-3H] androst-4-ene-3, 17-dione. Subsequently, the media was removed for extraction purposes and a 250-µl aliquot was counted in 5 ml of liquid scintillation mixture.
Diphenylamine DNA assay
To determine the amount of cells in each flask used in the aromatase enzyme assay, the cells were trypsinized and analyzed using the diphenylamine DNA assay adapted to a 96-well plate (42). DNA standards (0–10 µg) were prepared using double-stranded DNA reconstituted in PBS and added in duplicates directly to the wells. A uniform cell suspension was prepared from the T-25 flasks in 50 µl PBS, and 5–10 µl of the unknown samples were added in duplicates to separate wells. A solution of 0.16% acetaldehyde in water was prepared and mixed at a 1:5 ratio with perchloric acid (20% vol/vol). This solution (60 µl) was added to each well along with 100 µl of a 4% diphenylamine solution in glacial acetic acid. The plates were incubated at 37 C for 24 h and the OD595 was measured using a microplate reader. The DNA concentration was determined by extrapolation to the standard curve and the amount of cells/flask was calculated using the equation: 1 cell = 1 pg DNA.
Western blotting analysis
Whole-cell lysates were prepared from cells treated for 24 h in 100-mm plates by a freeze/thaw method in cold radioimmunoprecipitation assay buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS] plus protease inhibitors. Quantitation was performed using a protein assay method (Bio-Rad Laboratories, Inc., Hercules, CA). Equal amounts of total cellular proteins were resolved on 8% Tris-glycine gels by SDS-PAGE and subsequently transferred onto polyvinylidene difluoride membranes. For aromatase analysis, polyvinylidene difluoride membranes were probed with an equine aromatase polyclonal antibody (2 µg/ml). For PGE2 receptor protein analysis, membranes were probed with a human EP1 receptor polyclonal antibody (1 µg/ml) or a human EP2 receptor polyclonal antibody (1 µg/ml). To confirm equal protein loading and protein integrity, blots were also probed for ß-actin (0.25 µg/ml). Chemiluminescent Western blots were detected and quantified using a LumiImager (Roche Molecular Biochemicals).
Competitive RT-PCR
Total RNA was isolated from cells treated for 24 h using the TRIzol reagent according to the manufacturer’s protocol. RNA samples were dissolved in Dnase and RNase-free H2O and quantitated using a spectrophotometer. To assess the quality of the RNA samples, they were loaded on a 0.8% agarose-formaldehyde gel and electrophoresed for 1.5 h at 80 V. The integrity of 18S and 28S rRNA of each sample was analyzed by ethidium bromide staining of the gel. Complementary DNA was synthesized using Superscript II RNase H- reverse transcriptase according to the recommended protocol. The cDNA generated by this method was used as a template in subsequent PCR amplifications.
The competitive PCR protocol was performed using the PCR Mimic TM construction kit (Clonetech Laboratories, Inc., Palo Alto, CA). Heterologous DNA templates were generated for the aromatase mRNA and the 36B4 mRNA using the sequences defined in Table 1
. The equimolar concentration of the competitor DNA templates and target cDNA was experimentally determined by adding 10-3 to 102 attomol heterologous DNA to a constant amount of cDNA in a 15-µl PCR reaction. For aromatase analysis, the reaction consisted of 4 µl cDNA, 1 x PCR premix F (Epicentre Technologies, Madison, WI), heterologous aromatase template (1 attomol), 1 U Platinum Taq DNA polymerase, and 0.27 µM of each primer (GAATATTGGAAGGATGCACAGACT and GGGTAAAGA TCATTTCCAGCATGT). For 36B4 analysis, 1 µl cDNA was added to 1x PCR buffer, 1.5 mM MgCl2, 0.2 mM deoxynucleotide triphosphates, 10 attomol heterologous 36B4 template, 1 U Platinum Taq DNA polymerase, and 0.27 µM of each primer (AAACTGCTGCCTCATATCCG and TTTCAGCAAGTGGGAAGGT) in a total volume of 15 µl. For both genes, PCR was performed on a PTC-100 thermal cycler (MJ Research, Inc., Waltham, MA) according to previously published procedures (43).
|
Statistical analysis
Statistical and graphical information was determined using GraphPad Prism software (GraphPad Software, Inc., San Diego, CA) and Microsoft Excel (Microsoft Corp., Richmond, WA). Statistically significant differences were calculated with the two-tailed unpaired t test and the one-way ANOVA. P values are reported at 95% confidence intervals.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Both agents significantly stimulated aromatase activity over control levels (P < 0.05). TPA was the most potent inducer of activity seen (mean activity: 0.065 ± 0.015 pmol/h per 106 cells). Indomethacin, a nonspecific cyclooxygenase inhibitor, did not significantly alter basal levels of aromatase activity in the cells.
|
). Both PGE2 and 5-trans PGE2 significantly induced aromatase activity (P < 0.05). In addition, the variation among the mean activities of the control, PGE2, and 5-trans PGE2 groups was statistically significant (P < 0.05). This was calculated using a one-way ANOVA. Thus, the synthetic agent is a more potent inducer of aromatase activity than PGE2.
|
). EP1 was detected as a single band of molecular mass 47,000 (Fig. 3A), and EP2 was visualized as a 53,000 doublet (Fig. 3B). EP2 protein expression appeared more abundant than EP1 expression.
|
and 5). The activity levels induced by these agonists were comparable to those induced by PGE2. The 7-APTA virtually abolished enzyme activity levels.
|
|
). The same effect was observed when added along with PGE2. Likewise, when AH 6809 was added in conjunction with the EP2 agonist 11-deoxy PGE1, or PGE2, aromatase activity levels were decreased to basal levels (Fig. 5). These levels were not significantly different from that of control. These results are particularly important because PGE2, 17-phenyl trinor PGE2, and 11-deoxy PGE1 all significantly induced aromatase activity levels over control (P < 0.05). To determine whether inhibitory PGE2 receptor pathways are also involved in aromatase regulation, sulprostone, an EP3 agonist (51), was used. By itself, 1 µM sulprostone had no apparent effect on aromatase activity. However, when added simultaneously with PGE2, the resulting mean activity was not significantly different from that of the control (Fig. 6).
Western blotting analysis was used to determine the effects of PGE2 receptor pathways on aromatase protein expression (Fig. 7). Using an equine aromatase polyclonal antibody, aromatase protein was detected primarily as a doublet of 55,000 molecular mass and quantified using ß- actin protein expression as a control. PGE2, 5-trans PGE2, and 17-phenyl trinor PGE2 significantly increased aromatase protein expression over control levels (P < 0.05). Consistent with the effects on aromatase activity, treatment with SC-19220 together with 17-phenyl trinor PGE2 resulted in aromatase protein levels not significantly different from the control. Because of a large experimental error, no significant induction of aromatase protein was observed with 11-deoxy PGE1 treatment, although the mean levels were higher than control. However, the EP1/EP2 antagonist AH 6809 significantly decreased aromatase protein expression when used in combination with 11-deoxy PGE1 (P < 0.05). Neither sulprostone or sulprostone/PGE2 treatments altered aromatase protein expression levels.
|
are representative of replicate experiments. The pattern of mRNA expression shown is generally consistent with both the aromatase activity and Western data. Aromatase mRNA appears to be increased by PGE2 and 17-phenyl trinor PGE2. Treatment with SC-19220 prevented an induction by 17-phenyl trinor PGE2. The 11-deoxy PGE1 also induced aromatase mRNA expression. This effect was blocked by AH 6809 treatment. Furthermore, aromatase mRNA levels appeared to be lower than control when AH 6809 was administered together with PGE2. By itself, sulprostone had no apparent effect on aromatase mRNA levels, but in combination with PGE2, it prevented an induction of aromatase mRNA expression.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Both the EP1 and EP2 receptors are expressed in adipose stromal cells and accordingly, both pathways are involved in PGE2 regulation of aromatase. Agonists of these pathways induced aromatase expression and activity, which was abolished by selective antagonists. These results with EP2 signaling are consistent with studies conducted by Zhao et al. (16, 22). Using specific agonists, they demonstrated that aromatase activity was stimulated by EP2 signaling; however, these researchers did not observe an effect via EP1. Interestingly, they found that costimulation by agonists of both pathways produced a synergistic effect, but treatment with 17-phenyl trinor PGE2 or even phorbol esters alone did not result in an induction. Comparisons between these studies are complicated by the fact that the fibroblasts used in their study were derived from sc adipose tissue from women at the time of reduction abdominoplasty or reduction mammoplasty. Because the cells used were not all fibroblasts of breast origin, conclusions on the regulation of aromatase by PGE2 in the breast may be premature. Nevertheless, they showed that PGE2 stimulated cAMP formation and the production of promoter II-specific aromatase transcripts. They postulated that aromatase activity in adipose tissue proximal to a breast tumor is stimulated by PGE2, acting through the EP2 receptor and a PKA/cAMP mechanism that leads to activation of promoter II.
In contrast, this present study in breast stromal cells showed evidence of regulation of aromatase by both the EP1 and EP2 receptor-linked pathways. The phorbol ester TPA also produced highly significant levels of aromatase activity, suggesting that PKC activation is sufficient to stimulate aromatase. In a 1998 study conducted by Harada and Honda (14), TPA induced aromatase mRNA in adipose stromal cells and caused a switch from exon 1b (I.4) to exon 1c (I.3). Thus, activation of both PKA and PKC may be important in the regulation of aromatase in breast cancer.
In this study, aromatase also seemed to be controlled by the EP3 pathway, an inhibitory G protein-linked cascade. This pathway blocked PGE2-mediated increases in aromatase activity and expression and may have important implications for the regulation of aromatase in breast cancer. This finding also raises the question whether this inhibitory loop of regulation is lost or mutated in breast cancer. If so, do fibroblasts derived from or proximal to breast tumors express different densities of PGE2 receptors than fibroblasts from normal breast tissue? Future studies should further examine these issues in isolated primary culture systems and cocultures of breast cancer epithelial and adipose stromal cells.
In conclusion, PGE2 induces aromatase activity and expression through at least two receptor subtypes, EP1 and EP2. This has direct implications for the regulation of estrogen biosynthesis in hormone-dependent tumor growth and development. Regulation of aromatase in breast cancer by PGE2 is very complex and potential mechanisms may involve changes in receptor expression and/or function and perhaps genetic variation in subtypes expressed.
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: 7-APTA, 7-(4'-Amino) phenylthio-1,4-androstaediene-3,17-dione; PGE2, prostaglandin E2; PKA, protein kinase A; PKC, protein kinase C; TPA, tetradecanoyl phorbol acetate.
Received September 23, 2002.
Accepted March 11, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(4'-amino)-thiophenyl-4-androstene-3, 17-dione in human mammary carcinoma cell culture. Cancer Res 47:4548–4551- substituted androstenediones as effective in vitro and in vivo inhibitors of aromatase. Steroids 50:163–170[CrossRef][Medline]
(4'- amino)-thiophenyl-4-androstene-3, 17-dione on 7, 12-dimethyl-benz(a)anthracene-induced mammary carcinoma in rats. Cancer Res 48:6808–6810This article has been cited by other articles:
 |
|
 |
|
  J. Frasor, A. E. Weaver, M. Pradhan, and K. Mehta Synergistic Up-Regulation of Prostaglandin E Synthase Expression in Breast Cancer Cells by 17{beta}-Estradiol and Proinflammatory Cytokines Endocrinology, December 1, 2008; 149(12): 6272 - 6279. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. W. Visscher, V. S. Pankratz, M. Santisteban, C. Reynolds, A. Ristimaki, R. A. Vierkant, W. L. Lingle, M. H. Frost, and L. C. Hartmann Association Between Cyclooxygenase-2 Expression in Atypical Hyperplasia and Risk of Breast Cancer J Natl Cancer Inst, March 19, 2008; 100(6): 421 - 427. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. K. Choi, S. H. Roh, H. G. Kim, E. H. Han, H. G. Jeong, and K. W. Kang Enhanced expression of aromatase in p53-inactivated mammary epithelial cells Endocr. Relat. Cancer, March 1, 2008; 15(1): 139 - 147. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Subbaramaiah, C. Hudis, S.-H. Chang, T. Hla, and A. J. Dannenberg EP2 and EP4 Receptors Regulate Aromatase Expression in Human Adipocytes and Breast Cancer Cells: EVIDENCE OF A BRCA1 AND p300 EXCHANGE J. Biol. Chem., February 8, 2008; 283(6): 3433 - 3444. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Chen, S. Reierstad, Z. Lin, M. Lu, C. Brooks, N. Li, J. Innes, and S. E. Bulun Prostaglandin E2 Induces Breast Cancer Related Aromatase Promoters via Activation of p38 and c-Jun NH2-Terminal Kinase in Adipose Fibroblasts Cancer Res., September 15, 2007; 67(18): 8914 - 8922. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Fulton, X. Ma, and N. Kundu Targeting Prostaglandin E EP Receptors to Inhibit Metastasis. Cancer Res., October 15, 2006; 66(20): 9794 - 9797. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. K. Yiu and A. Toker NFAT Induces Breast Cancer Cell Invasion by Promoting the Induction of Cyclooxygenase-2 J. Biol. Chem., May 5, 2006; 281(18): 12210 - 12217. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Ma, N. Kundu, S. Rifat, T. Walser, and A. M. Fulton Prostaglandin E Receptor EP4 Antagonism Inhibits Breast Cancer Metastasis. Cancer Res., March 15, 2006; 66(6): 2923 - 2927. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Watanabe, M. Noda, and S. Nakajin Effect of epidermal growth factor and prostaglandin on the expression of aromatase (CYP19) in human adrenocortical carcinoma cell line NCI-H295R cells J. Endocrinol., January 1, 2006; 188(1): 59 - 68. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. W. Brueggemeier, J. C. Hackett, and E. S. Diaz-Cruz Aromatase Inhibitors in the Treatment of Breast Cancer Endocr. Rev., May 1, 2005; 26(3): 331 - 345. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. R. Simpson, M. Misso, K. N. Hewitt, R. A. Hill, W. C. Boon, M. E. Jones, A. Kovacic, J. Zhou, and C. D. Clyne Estrogen--the Good, the Bad, and the Unexpected Endocr. Rev., May 1, 2005; 26(3): 322 - 330. [Full Text] [PDF]
|
|
|
|
 |
|
 E. S. Diaz-Cruz, C. L. Shapiro, and R. W. Brueggemeier Cyclooxygenase Inhibitors Suppress Aromatase Expression and Activity in Breast Cancer Cells J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2563 - 2570. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Heneweer, M. Muusse, M. Dingemans, P. C. de Jong, M. van den Berg, and J. T. Sanderson Co-culture of Primary Human Mammary Fibroblasts and MCF-7 Cells as an In Vitro Breast Cancer Model Toxicol. Sci., February 1, 2005; 83(2): 257 - 263. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Muller-Decker, I. Berger, K. Ackermann, V. Ehemann, S. Zoubova, S. Aulmann, W. Pyerin, and G. Furstenberger Cystic Duct Dilatations and Proliferative Epithelial Lesions in Mouse Mammary Glands upon Keratin 5 Promoter-Driven Overexpression of Cyclooxygenase-2 Am. J. Pathol., February 1, 2005; 166(2): 575 - 584. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Zhou, T. Suzuki, A. Kovacic, R. Saito, Y. Miki, T. Ishida, T. Moriya, E. R. Simpson, H. Sasano, and C. D. Clyne Interactions between Prostaglandin E2, Liver Receptor Homologue-1, and Aromatase in Breast Cancer Cancer Res., January 15, 2005; 65(2): 657 - 663. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L Hilakivi-Clarke, C Wang, M Kalil, R Riggins, and R G Pestell Nutritional modulation of the cell cycle and breast cancer Endocr. Relat. Cancer, December 1, 2004; 11(4): 603 - 622. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Matsuzaki, M. Canis, C. Vaurs-Barriere, J.L. Pouly, O. Boespflug-Tanguy, F. Penault-Llorca, P. Dechelotte, B. Dastugue, K. Okamura, and G. Mage DNA microarray analysis of gene expression profiles in deep endometriosis using laser capture microdissection Mol. Hum. Reprod., October 1, 2004; 10(10): 719 - 728. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-H. Chang, C. H. Liu, R. Conway, D. K. Han, K. Nithipatikom, O. C. Trifan, T. F. Lane, and T. Hla From the Cover: Role of prostaglandin E2-dependent angiogenic switch in cyclooxygenase 2-induced breast cancer progression PNAS, January 13, 2004; 101(2): 591 - 596. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
