help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lindsay, R. S.
Right arrow Articles by Walker, B. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lindsay, R. S.
Right arrow Articles by Walker, B. R.
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 6 2738-2744
Copyright © 2003 by The Endocrine Society

Subcutaneous Adipose 11ß-Hydroxysteroid Dehydrogenase Type 1 Activity and Messenger Ribonucleic Acid Levels Are Associated with Adiposity and Insulinemia in Pima Indians and Caucasians

Robert S. Lindsay, Deborah J. Wake, Saraswathy Nair, Joy Bunt, Dawn E. W. Livingstone, Paska A. Permana, P. Antonio Tataranni and Brian R. Walker

National Institute of Diabetes and Digestive and Kidney Diseases (R.S.L., S.N., J.B., P.A.P., P.A.T.), National Institutes of Health, Department of Health and Human Services, Phoenix, Arizona 85016; and Endocrinology Unit, Department of Medical Sciences (D.J.W., D.E.W.L., B.R.W.), University of Edinburgh, Western General Hospital, Edinburgh EH4 2XU, United Kingdom

Address all correspondence to: P. Antonio Tataranni, M.D., National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Department of Health and Human Services, 4212 North 16th Street, Room 541A, Phoenix, Arizona 85016. E-mail: antoniot{at}mail.nih.gov.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Metabolic effects of cortisol may be critically modulated by glucocorticoid metabolism in tissues. Specifically, active cortisol is regenerated from inactive cortisone by the enzyme 11ß-hydroxysteroid dehydrogenase type 1 (11-HSD1) in adipose and liver. We examined activity and mRNA levels of 11-HSD1 and tissue cortisol and cortisone levels in sc adipose tissue biopsies from 12 Caucasian (7 males and 5 females) and 19 Pima Indian (10 males and 9 females) nondiabetic subjects aged 28 ± 7.6 yr (mean ± SD; range, 18–45). Adipose 11-HSD1 activity and mRNA levels were highly correlated (r = 0.51, P = 0.003). Adipose 11-HSD1 activity was positively related to measures of total (body mass index, percentage body fat) and central (waist circumference) adiposity (P < 0.05 for all) and fasting glucose (r = 0.43, P = 0.02), insulin (r = 0.60, P = 0.0005), and insulin resistance by the homeostasis model (r = 0.70, P < 0.0001) but did not differ between sexes or ethnic groups. Intra-adipose cortisol was positively associated with fasting insulin (r = 0.37, P = 0.04) but was not significantly correlated with 11-HSD1 mRNA or activity or with other metabolic variables. In this cross-sectional study, higher adipose 11-HSD1 activity is associated with features of the metabolic syndrome. Our data support the hypothesis that increased regeneration of cortisol in adipose tissue influences metabolic sequelae of human obesity.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
IT HAS BEEN PROPOSED that tissue-specific dysregulation of cortisol metabolism may influence the development of metabolic disease (1). In human obesity circulating concentrations of cortisol are not consistently elevated, but cortisol metabolism, and thereby glucocorticoid action, may be altered at the tissue level (1). Adipose tissue contains the enzyme 11ß-hydroxysteroid dehydrogenase type 1 (11-HSD1) (2), which acts in vivo as a reductase, converting inactive cortisone to the active form, cortisol (3). Adipose 11-HSD1 activity is increased in animal models of obesity (4), and both activity (5, 6) and mRNA (7) of 11-HSD1 have been reported recently to be elevated in sc adipose tissue of obese human subjects. The potential metabolic importance of these observations is suggested by recent animals models demonstrating that knockout of 11-HSD1 results in resistance to hyperglycemia induced by fat feeding (8) and increased hepatic insulin sensitivity (9). Conversely, artificially increasing 11-HSD1 activity in adipose tissue, by introduction of an 11-HSD1 transgene under control of an adipose specific promoter, results in development of visceral adiposity, hyperglycemia, and insulin resistance in a mouse model (10).

We investigated the cross-sectional relationship of adipose 11-HSD1 activity to metabolic variables by assessing enzyme activity, mRNA levels, and tissue cortisol and cortisone levels in adipose biopsies taken from human subjects. We examined the hypotheses that 11-HSD1 activity, mRNA levels, and tissue cortisol levels are positively related to indices of adiposity, insulin resistance, and hyperglycemia. We further assessed whether there are ethnic differences in 11-HSD1 activity by examining these relationships in both Pima Indians, a group with marked propensity to both obesity and type 2 diabetes, and Caucasians.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects

Pima and Caucasian volunteers were admitted to the metabolic ward of the Clinical Diabetes and Nutrition Section, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health (Phoenix, AZ). Subjects were recruited by newspaper advertisement or by community-based recruiters. Although subjects are not formally matched for adiposity, an effort was made to recruit Caucasian subjects across a similar range of adiposity as in the Pima group. All subjects were determined to be in good health by medical history, physical examination, and laboratory screening tests. None were taking medications. Exclusion criteria included smoking, alcohol or drug abuse, and diabetes, according to a 75-g oral glucose tolerance test (11). On admission subjects were placed on a weight-maintenance diet (50% carbohydrate, 30% fat, 20% protein) calculated on the basis of body weight and adjusted to maintain body weight within ± 1%. Body composition, including percentage body fat (%fat) was assessed by dual-energy x-ray absorptiometry (DPX-L; Lunar Corp., Madison, WI) (12). The circumference of the waist was measured supine at the level of the umbilicus. Fat biopsies were obtained after a 12-h overnight fast, between 0830 h and 1000 h. Procedures for biopsy have been described previously (13). In brief, sc abdominal adipose tissue was removed from the periumbilical region by percutaneous needle biopsy under local anesthesia (lidocaine 1%). Biopsies were frozen immediately at -70 C.

The study was approved by the ethics committee of the National Institute of Diabetes and Digestive and Kidney Diseases and the Tribal Council of the Gila River Indian Community. Subjects provided written informed consent.

Analytical measurements

The plasma glucose concentration was measured by the glucose oxidase method (Beckman glucose analyzer; Beckman, Fullerton, CA) and insulin by RIA (Concept 4; ICN Biomedicals, Inc., Costa Mesa, CA). Homeostasis model of assessment insulin resistance index (HOMA-IR) was calculated as previously described (14).

11-HSD1 activity. Fat was thawed, homogenized in Krebs buffer at pH 7.4 and 750 µg/ml protein, and incubated at 37 C with 2 mM nicotinamide adenine dinucleotide phosphate and 100 nM 1,2,6,7-3H-cortisol for 30 h, with samples withdrawn at 3, 6, 20, and 30 h for separation of cortisol and cortisone by HPLC with on-line liquid scintillation detection (4, 5, 6). The 11-HSD1 activity was measured in the dehydrogenase direction (i.e. cortisol to cortisone rather than reductase cortisone to cortisol) because reductase activity is less stable in vitro (1) and the dehydrogenase direction is preferred when the enzyme is liberated from its intracellular environment (15). When driven by excess cofactor, this activity is proportional to total protein, regardless of the direction that the reaction is measured.

11-HSD1 mRNA. Approximately 500 mg fat were homogenized in 1.5 ml Trizol, extracted in chloroform and RNAid matrix (Anachem), washed three times, and precipitated by addition of diethylpyrocarbonate H2O/dithiothreitol/RNAsin. RNA was quantified spectrophotometrically at OD260. RNA integrity was checked by electrophoresis on 1.2% agarose gel. Oligo dT-primed cDNA was synthesized from 0.5 µg of RNA samples. PCR amplification of glyceraldehyde 3-phosphate dehydrogenase transcript using glyceraldehyde 3-phosphate dehydrogenase primers provided in the kit (CLONTECH Laboratories, Inc., Palo Alto, CA) was carried out to confirm successful cDNA synthesis.

Transcript level quantification for 11-HSD1 was performed with real-time PCR primer-probe sets using the ABI PRISM 7700 sequence detection system (Applied Biosystems, Foster City, CA) using primers 5'GGAATATTCAGTGTCCAGGGTCAA3'(F), 5'TGATCTCCAGGGCACATTCCT3'(R), and 5'-6-FAM-CTTGGCCTCATAGACACAGAAACAGCCA-BHQ-3', respectively. Human cyclophilin (Applied Biosystems) was used to normalize the 11-HSD1 transcript levels. A standard curve for each primer-probe set was generated by serial dilution of cDNA from a healthy subject done in triplicate. Each sample was run in duplicate and the mean values of the duplicates were used to calculate transcript level.

Tissue cortisol and cortisone. Following homogenization in Trizol, the infranatant from the RNA extraction protocol (see above) was used to extract steroids. Approximately 0.3 pmol/ml (<1% final tissue concentrations) of 1,2,6,7-3H4-cortisone and 1,2,6,7-3H4-cortisol (Amersham, Little Chalfont, Buckinghamshire, UK) were added to the homogenate to correct for steroid extraction and HPLC efficiency. Samples was centrifuged to remove the fat layer and extracted on a sep-pak (Waters C18 cartridges, Elstree, Hertfordshire, UK), further purified with hexane, reextracted with ethyl acetate, and reconstituted in mobile phase for HPLC separation of cortisone and cortisol fractions as previously described (16). Fractions were counted for recovery of tracer 3H-steroid (mean, 61 ± 12%) and assayed in triplicate for endogenous cortisol and cortisone by RIAs (16). Final steroid concentrations are expressed per gram of wet weight of adipose tissue after adjustment for extraction efficiency.

Statistical analysis

All values are represented as mean ± SD unless otherwise indicated. Statistical analyses were performed using the procedures of the SAS Institute, Inc. (Cary, NC). Relationships between 11-HSD1 activity and adipose or metabolic variables were assessed either by Pearson correlation (using area under the curve for the 11-HSD1 reaction) or, where multiple covariates were assessed, by general linear modeling. Where appropriate, variables (fasting insulin, 11-HSD1 mRNA, tissue cortisol) were log transformed to approach a normal distribution. Where 11-HSD1 activity is modeled as the dependent variable, separate time points of the 11-HSD1 assay (3, 6, 20, and 30 h) were fitted in a single model with a repeated measures design.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Baseline characteristics and relation of adipose 11-HSD1 activity to mRNA levels and tissue cortisol

Measures of adiposity [body mass index (BMI), %fat, waist circumference)], fasting plasma glucose, and insulin were comparable between the Pima and Caucasian groups (Table 1Go). Neither fasting plasma insulin nor HOMA-IR differed between Pimas and Caucasians, even after adjustment for sex, %fat, or BMI (data not shown). Ten subjects (Caucasian, two males and one female; Pima, three males and four females) had impaired glucose tolerance (IGT) (11). All other subjects were normal glucose tolerant (NGT). Although glucose at 2 h was higher in those with IGT, other baseline variables were similar (%fat, BMI, waist, all P > 0.5 vs. NGT) including fasting glucose (NGT 87 ± 7 mg/dl; IGT 92 ± 11; P = 0.2).


View this table:
[in this window]
[in a new window]
 
Table 1. Subject characteristics

 
11-HSD1 activity (area under curve for adipose biopsies at 3, 6, 20, and 30 h of incubation) was significantly associated with mRNA levels (Fig. 1Go; r = 0.51, P = 0.003). This relationship was consistent across all time points of the activity assay (3, 6, 20, and 30 h; r = 0.47, 0.49, 0.56, 0.60, respectively; P < 0.01 for all). When considered separately the relation of 11-HSD1 activity and mRNA levels was present in both Pima Indians (r = 0.58, P = 0.01) and Caucasians (r = 0.69, P = 0.02).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 1. Relationship of 11-HSD activity and mRNA in 31 subjects (r = 0.51, P = 0.003). The 11-HSD activity is defined as the area under the curve for bioassay of 11-HSD1 adipose biopsies at 3, 6, 20, and 30 h of incubation. The 11-HSD1 mRNA is expressed vs. cyclophilin as reference standard.

 
Intra-adipose concentrations of cortisol [median (interquartile range), 14.2 (9.4–25.8) nmol/kg] and cortisone [14.8 (5.0–21.4) nmol/kg] were similar [ratio of intra-adipose cortisol: cortisone, 1.4 (0.5–2.9)]. There were no significant relationships of 11-HSD1 activity (r = 0.13, P = 0.49) or mRNA (r = 0.30, P = 0.11) to intra-adipose cortisol. Intra-adipose cortisol: cortisone ratio showed no relationship to 11-HSD1 activity or mRNA (assessed by Spearman correlation r = 0.07 and -0.05, respectively, P > 0.5 for both).

Relationship of adipose 11-HSD1 to obesity and metabolic variables

In all subjects, 11-HSD1 activity was significantly associated with BMI, %fat, waist circumference, fasting plasma glucose, fasting plasma insulin, and HOMA-IR (Table 2Go, Fig. 2Go). When Pima Indians and Caucasians were considered separately, positive associations of BMI, %fat, waist, fasting plasma glucose, fasting plasma insulin, and HOMA-IR were also present (with r >0.5 and P < 0.05) with the exception of %fat (r = 0.52, P = 0.09) and glucose (r = 0.43, P = 0.18) in Caucasians. In general, similar but somewhat weaker relationships were observed with adipose 11-HSD1 mRNA (Table 2Go).


View this table:
[in this window]
[in a new window]
 
Table 2. Correlations of measurements in adipose tissue with in vivo metabolic variables

 


View larger version (13K):
[in this window]
[in a new window]
 
Figure 2. Relationship of 11-HSD1 activity to metabolic variables in 31 subjects (see also Table 2Go). The 11-HSD activity is defined as the area under the curve for bioassay of 11-HSD1 adipose biopsies at 3, 6, 20, and 30 h of incubation.

 
To dissect confounding effects in these relationships, 11-HSD1 activity was modeled against continuous variables (using all data 3, 6, 20, and 30 h by repeated ANOVA). Either fasting insulin (P = 0.02) or HOMA-IR (P = 0.0002) remained significant predictors of 11-HSD1 activity in models also including %fat, sex, ethnicity (Pima vs. Caucasian) and waist. Similarly either fasting insulin (P = 0.02) or HOMA-IR (P = 0.01) were significant predictors of 11-HSD1 mRNA (in models also including %fat, sex, ethnicity, and waist). By contrast, after adjustment for insulin sensitivity in these models, measures of adiposity (%fat or waist) were not significant independent predictors of 11-HSD1 activity or mRNA (P > 0.2 for all).

Ethnicity was not significantly related to 11-HSD1 activity as a single predictor (P = 0.53) or in the above models. Overall Caucasians tended to have higher 11-HSD1 mRNA levels as a single predictor (Table 1Go, P = 0.07), and this was significant in the above models (P = 0.0007 in model with sex, %fat, waist, and fasting insulin; P = 0.0005 in model with sex, %fat, waist, and HOMA-IR).

No difference in 11-HSD1 activity or mRNA was found in individuals with IGT vs. NGT (P = 0.71), even after adjustment for other covariates (sex, %fat, ethnicity; P for effect of glucose tolerance status = 0.68). In multivariate models fasting glucose was not related to 11-HSD1 mRNA or activity (data not shown)

Sex was not related to 11-HSD1 activity or mRNA either as a single predictor (P = 0.73, P = 0.11, respectively) or after inclusion of %fat, fasting insulin, or HOMA-IR as additional predictors.

Relation of intra-adipose cortisol and cortisone to obesity and metabolic variables

Correlations between intra-adipose cortisol and anthropometric or metabolic variables were generally positive but significant only in the case of fasting insulin (Table 2Go). Intra-adipose cortisol was not significantly related to fasting insulin or HOMA-IR in multivariate models (including %fat, sex, and waist). Neither intra-adipose cortisone nor cortisol:cortisone ratios correlated with anthropometric or metabolic variables (data not shown). There were no ethnic differences in intra-adipose cortisol or cortisone levels.


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
A number of recent studies have supported a potential role of glucocorticoid metabolism by adipose tissue in lipid and glucose homeostasis. In this cross-sectional study, we confirmed strong associations of sc adipose 11-HSD1 activity with indices of obesity and showed additional relationships with metabolic variables reflecting insulin sensitivity. Furthermore, we showed that adipose 11-HSD1 mRNA levels are closely correlated with enzyme activity in homogenized adipose tissue and higher mRNA levels also predict increased adiposity and insulin resistance.

The concept of tissue-specific dysregulation of 11-HSD1 activity in human obesity is now supported by a series of studies. It arose from observations that conversion of oral cortisone to plasma cortisol is impaired in obese men (5, 17), consistent with impaired hepatic 11-HSD1, yet urinary ratios of cortisol/cortisone metabolites are highly variable (5, 6, 17, 18, 19) suggesting compensatory differences in extrahepatic 11-HSD1 activity. The concept was supported by increased 11-HSD1 activity in adipose of Zucker obese rats and ob/ob obese mice associated with reduced 11-HSD1 activity in livers in these animals (4, 10). Moreover, an earlier study using arteriovenous cannulation of abdominal sc fat suggested increased conversion of cortisone to cortisol in obesity (3). Three recently published studies have confirmed increased 11-HSD1 activity (5, 6) and mRNA (7) in sc adipose tissue of obese men and women.

The current data confirm the magnitude of this increase in 11-HSD1 activity; demonstrate a close relationship of 11-HSD1 activity and mRNA from the same biopsies, as has previously been seen in studies in rodents (20); and support higher 11-HSD1 activity and gene transcription in adipose tissue in obesity. By contrast, one study, examining biopsy material obtained during intra-abdominal surgery, has recently reported no relationship to BMI of 11-HSD1 mRNA levels in freshly homogenized adipose tissue (21). Furthermore, 11-HSD1 activity was measured in cultured preadipocytes and adipocytes and was either not correlated with, or in omental preadipocytes showed an inverse relationship with, BMI (21). To explain this discrepancy with published results, it has been suggested (21) that measurement of 11-HSD1 activity in the dehydrogenase direction, as we have done here and previously (5, 6), might produce spurious results. However, we think this is unlikely because the dehydrogenase direction is preferred when 11-HSD1 is liberated from its intracellular environment in homogenized tissue (15), is more stable than reductase activity in vitro (1), and in the conditions used here is proportionate to the amount of protein added to the assay. We think it more likely that confounding effects of obtaining biopsies during the stress of major surgery, and loss of phenotype during culture of cells in vitro, accounts for the apparent discrepancy. The current data show for the first time a close relationship between 11-HSD1 mRNA and (dehydrogenase) activity in human adipose tissue and support the conclusion that increased adipose 11-HSD1 activity in obesity is due to increased gene transcription.

The metabolic impact of these observations has been uncertain. In mice with transgenic overexpression of 11-HSD1 in adipose tissue, a similar magnitude of increased 11-HSD1 activity to the range seen in this study (~3-fold) resulted in obesity that was much more obvious in omental fat than in sc fat (10). This effect on fat distribution probably reflects higher expression of glucocorticoid receptors in omental fat. In humans, studies in cultured cells from omental adipose tissue suggest that the same relatively high glucocorticoid receptor expression occurs (22) and is accompanied by higher 11-HSD1 expression (2). Although sc adipose 11-HSD1 predicts indices of both generalized and central obesity (3, 5, 6, 7), we cannot yet confirm whether increased 11-HSD1 in sc adipose tissue can be extrapolated to omental adipose tissue. Furthermore, if increased adipose 11-HSD1 activity does result in metabolic consequences, as is suggested by transgenic mouse models (10), it is not known whether increases in omental as well as sc 11-HSD1 would be a prerequisite for this.

Our data do suggest, however, that increased adipose 11-HSD1 could have a significant effect on the metabolic complications of obesity in humans. We report significant relationships of adipose 11-HSD1 and measures of insulin sensitivity. Previous studies in humans either did not report relationships of adipose 11-HSD1 to metabolic variables (7, 21) or found that relationships between increased adipose 11-HSD1 activity and insulin resistance (measured by euglycemic hyperinsulinemic clamp) could be entirely accounted for by coexisting obesity (5, 6). In the present larger study, there are strong relationships between 11-HSD1 in adipose and insulin resistance (as assessed by HOMA-IR and fasting plasma insulin). In multivariate analyses it appears that the principal relationship we are observing may be with insulin resistance. There are two caveats to this. First, given the relatively small number of subjects in our study, multivariate models should be interpreted with caution. Second, the measures we have used (fasting insulin and HOMA-IR), although correlated with measures of insulin resistance derived from euglycemic hyperinsulinemic clamp (23), are not gold standard measures of insulin resistance. Nevertheless, our study suggests that there is a relationship between the extent of increased adipose 11-HSD1 in obesity and the severity of associated hyperinsulinemia.

Given the cross-sectional nature of our study, it is not possible to infer whether higher 11-HSD1 is the cause or consequence of obesity and insulin resistance. It remains possible that 11-HSD1 is raised as a consequence of hyperinsulinemia or insulin resistance. A number of studies suggest that, at least in cell culture, insulin regulates 11-HSD1 expression in adipocytes. However, the effects are inconsistent. Up-regulation of 11-HSD1 by coincubation of cells with insulin and glucocorticoids may reflect increased 11-HSD1 expression during adipocyte differentiation (2). In mature cells insulin may down-regulate 11-HSD1 expression in adipocytes (2, 24) as it does in other tissues (25, 26). In animal models insulin sensitizing agents have inconsistent effects on 11-HSD1 activity and expression (20, 27). Finally, in a recent case-control study of patients with hyperglycemia and insulin resistance who were not more obese than controls, adipose 11-HSD1 activity was not altered (28). In light of these results, it is possible that insulin resistance at the level of adipocytes acts to increase 11-HSD1 activity, but we think it more likely that some other feature of obesity is responsible for changes in 11-HSD1, which, in turn, may contribute to the metabolic complications of the obesity. For example, adipose 11-HSD1 is potently stimulated by cytokines including TNF{alpha} (29, 30, 31). Notably, TNF{alpha} is increased in obesity and has been proposed as a potential mediator of insulin resistance secondary to obesity (32).

In mice with transgenic overexpression of 11-HSD1 in adipose, plasma corticosterone levels are unaltered but intra-adipose corticosterone levels are elevated about 2-fold (10). To test whether the adverse metabolic consequences of increased adipose 11-HSD1 could similarly be attributed to increased intra-adipose generation of cortisol, we extracted glucocorticoids from adipose biopsies. We found that the concentrations of intra-adipose cortisone approximate those found in plasma (16), but concentrations of cortisol were approximately 10-fold lower than would be expected in plasma, given that the biopsies were obtained between 0830 h and 1000 h. This is likely to reflect the absence of corticosteroid-binding globulin in adipose tissue, and hence intra-adipose cortisol concentrations approximate free cortisol concentrations in plasma. Notably, there was no significant relationship of adipose 11-HSD1 to concentrations of intra-adipose cortisol or cortisone. There may be a number of explanations of this. First, although the technique of extraction of steroids from tissues has recently been applied in animal studies (10) the small size of human adipose biopsies is technically demanding and application to small samples is novel. Second, we have not assessed influences of variations in plasma concentrations of cortisol, including those relating to the stress of the biopsy. Unfortunately concomitant plasma samples were not available to allow assessment of this. In the transgenic mice with adipose 11-HSD1 overexpression, samples were obtained during the diurnal nadir of glucocorticoid secretion (10), when 11-HSD1 is putatively more important in maintaining intra-cellular glucocorticoid levels (1).

Here biopsies were obtained during the diurnal peak of cortisol secretion when the influence of circulating cortisol may be more important. In that light we consider our examination of intra-adipose cortisol exploratory and clearly far from definitive. Nevertheless, we did find positive relationships between intra-adipose cortisol and most anthropometric and metabolic indices of obesity and insulin resistance, which reached statistical significance for fasting plasma insulin. These relationships deserve further exploration to establish whether they can be attributed to variations in adipose 11-HSD1 and/or increased plasma cortisol, which has been observed in subjects with the metabolic syndrome (33, 34, 35).

As part of this study, we investigated ethnic differences in 11-HSD1 in Pima and Caucasian subjects. The Pima Indians have a greatly increased propensity to obesity (36). Furthermore, for any degree of obesity, they have a similar degree of central adiposity (37) but a greatly increased prevalence of type 2 diabetes (38). We hypothesized that differences in 11-HSD1, and, by inference, glucocorticoid action in adipocytes might underpin this increased risk of progression to type 2 diabetes. Previous studies comparing Pima with Caucasian subject population have not detected any difference in 24-h urinary-free cortisol or fasting cortisol between Pima and Caucasian males (39). We detected no major differences in adipose 11-HSD1 activity between Pimas and Caucasians. The lack of ethnic differences in adipose 11-HSD1, together with the recent demonstration that up-regulation of adipose 11-HSD1 accompanies obesity with a demonstrable underlying cause of hypothalamic disease (40), supports the concept that 11-HSD1 dysregulation is downstream rather than a primary event in the pathophysiology of obesity. Levels of mRNA were higher in Caucasians in some models, leaving the possibility that differences exist in the relation of insulin sensitivity and adipose 11-HSD1 between ethnic groups; however, given the sample size, we were not able to explore this further.

In conclusion we find that, in this cross-sectional study, sc adipose 11-HSD1 activity and mRNA levels are closely related. Furthermore, increased 11-HSD1 activity and expression are closely associated with not only measures of adiposity but also insulin resistance and hyperglycemia. Our data support the hypothesis that 11-HSD1 may act in modulation of metabolic disease in humans.


    Acknowledgments
 
We thank members of the Gila River Indian Community as well as the other volunteers for participation in this study. We also gratefully acknowledge the nurses of the Clinical Research Unit as well as the staff of the metabolic kitchen for their care of the patients in these studies. We thank Jill Campbell for technical support.


    Footnotes
 
B.R.W. is supported by the British Heart Foundation.

Abbreviations: BMI, Body mass index; %fat, percentage body fat; HOMA-IR, homeostasis model of assessment insulin resistance index; 11-HSD1, 11ß-hydroxysteroid dehydrogenase type 1; IGT, impaired glucose tolerance; NGT, normal glucose tolerant.

Received December 30, 2002.

Accepted March 5, 2003.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Seckl JR, Walker BR 2001 Minireview: 11ß-hydroxysteroid dehydrogenase type 1—a tissue-specific amplifier of glucocorticoid action. Endocrinology 142:1371–1376[Abstract/Free Full Text]
  2. Bujalska IJ, Kumar S, Stewart PM 1997 Does central obesity reflect "Cushing’s disease of the omentum"? Lancet 349:1210–1213[CrossRef][Medline]
  3. Katz JR, Mohamed-Ali V, Wood PJ, Yudkin JS, Coppack SW 1999 An in vivo study of the cortisol-cortisone shuttle in subcutaneous abdominal adipose tissue. Clin Endocrinol (Oxf) 50:63–68[CrossRef][Medline]
  4. Livingstone DE, Jones GC, Smith K, Jamieson PM, Andrew R, Kenyon CJ, Walker BR 2000 Understanding the role of glucocorticoids in obesity: tissue-specific alterations of corticosterone metabolism in obese Zucker rats. Endocrinology 141:560–563[Abstract/Free Full Text]
  5. Rask E, Olsson T, Soderberg S, Andrew R, Livingstone DE, Johnson O, Walker BR 2001 Tissue-specific dysregulation of cortisol metabolism in human obesity. J Clin Endocrinol Metab 86:1418–1421[Abstract/Free Full Text]
  6. Rask E, Walker BR, Soderberg S, Livingstone DE, Eliasson M, Johnson O, Andrew R, Olsson T 2002 Tissue-specific changes in peripheral cortisol metabolism in obese women: increased adipose 11ß-hydroxysteroid dehydrogenase type 1 activity. J Clin Endocrinol Metab 87:3330–3336[Abstract/Free Full Text]
  7. Paulmyer-Lacroix O, Boullu S, Oliver C, Alessi MC, Grino M 2002 Expression of the mRNA coding for 11ß-hydroxysteroid dehydrogenase type 1 in adipose tissue from obese patients: an in situ hybridization study. J Clin Endocrinol Metab 87:2701–2705[Abstract/Free Full Text]
  8. Kotelevtsev Y, Holmes MC, Burchell A, Houston PM, Schmoll D, Jamieson P, Best R, Brown R, Edwards CR, Seckl JR, Mullins JJ 1997 11ß-hydroxysteroid dehydrogenase type 1 knockout mice show attenuated glucocorticoid-inducible responses and resist hyperglycemia on obesity or stress. Proc Natl Acad Sci USA 94:14924–14929[Abstract/Free Full Text]
  9. Morton NM, Holmes MC, Fievet C, Staels B, Tailleux A, Mullins JJ, Seckl JR 2001 Improved lipid and lipoprotein profile, hepatic insulin sensitivity, and glucose tolerance in 11ß-hydroxysteroid dehydrogenase type 1 null mice. J Biol Chem 276:41293–41300[Abstract/Free Full Text]
  10. Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR, Flier JS 2001 A transgenic model of visceral obesity and the metabolic syndrome. Science 294:2166–2170[Abstract/Free Full Text]
  11. World Health Organization 1985 Diabetes mellitus. Report of a Study Group. Geneva: WHO; WHO Technical Report Series
  12. Tataranni PA, Ravussin E 1995 Use of dual-energy X-ray absorptiometry in obese individuals. Am J Clin Nutr 62:730–734[Abstract/Free Full Text]
  13. Abbott WG, Foley JE 1987 Comparison of body composition, adipocyte size, and glucose and insulin concentrations in Pima Indian and Caucasian children. Metabolism 36:576–579[CrossRef][Medline]
  14. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC 1985 Homeostasis model assessment: insulin resistance and ß-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28:412–419[CrossRef][Medline]
  15. Agarwal AK, Monder C, Eckstein B, White PC 1989 Cloning and expression of rat cDNA encoding corticosteroid 11ß-dehydrogenase. J Biol Chem 264:18939–18943[Abstract/Free Full Text]
  16. Whitworth JA, Burt D, Atherden SM, Edwards CRW 1989 The kidney is the major site of cortisone production in man. Clin Endocrinol (Oxf) 31:355–361[Medline]
  17. Stewart PM, Boulton A, Kumar S, Clark PM, Shackleton CH 1999 Cortisol metabolism in human obesity: impaired cortisone–>cortisol conversion in subjects with central adiposity. J Clin Endocrinol Metab 84:1022–1027[Abstract/Free Full Text]
  18. Andrew R, Phillips DI, Walker BR 1998 Obesity and gender influence cortisol secretion and metabolism in man. J Clin Endocrinol Metab 83:1806–1809[Abstract/Free Full Text]
  19. Fraser R, Ingram MC, Anderson NH, Morrison C, Davies E, Connell JM 1999 Cortisol effects on body mass, blood pressure, and cholesterol in the general population. Hypertension 33:1364–1368[Abstract/Free Full Text]
  20. Berger J, Tanen M, Elbrecht A, Hermanowski-Vosatka A, Moller DE, Wright SD, Thieringer R 2001 Peroxisome proliferator-activated receptor-gamma ligands inhibit adipocyte 11ß-hydroxysteroid dehydrogenase type 1 expression and activity. J Biol Chem 276:12629–12635[Abstract/Free Full Text]
  21. Tomlinson JW, Sinha B, Bujalska I, Hewison M, Stewart PM 2002 Expression of 11ß-hydroxysteroid dehydrogenase type 1 in adipose tissue is not increased in human obesity. J Clin Endocrinol Metab 87:5630–5635[Abstract/Free Full Text]
  22. Bronnegard M, Arner P, Hellstrom L, Akner G, Gustafsson JA 1990 Glucocorticoid receptor messenger ribonucleic acid in different regions of human adipose tissue. Endocrinology 127:1689–1696[Abstract/Free Full Text]
  23. Hanson RL, Pratley RE, Bogardus C, Narayan KM, Roumain JM, Imperatore G, Fagot-Campagna A, Pettitt DJ, Bennett PH, Knowler WC 2000 Evaluation of simple indices of insulin sensitivity and insulin secretion for use in epidemiologic studies. Am J Epidemiol 151:190–198[Abstract/Free Full Text]
  24. Napolitano A, Voice MW, Edwards CR, Seckl JR, Chapman KE 1998 11ß-Hydroxysteroid dehydrogenase 1 in adipocytes: expression is differentiation-dependent and hormonally regulated. J Steroid Biochem Mol Biol 64:251–260[CrossRef][Medline]
  25. Hammami MM, Siiteri PK 1991 Regulation of 11ß-hydroxysteroid dehydrogenase activity in human skin fibroblasts: enzymatic modulation of glucocorticoid action. J Clin Endocrinol Metab 73:326–334[Abstract/Free Full Text]
  26. Jamieson PM, Chapman KE, Edwards CR, Seckl JR 1995 11ß-Hydroxysteroid dehydrogenase is an exclusive 11ß-reductase in primary cultures of rat hepatocytes: effect of physicochemical and hormonal manipulations. Endocrinology 136:4754–4761[Abstract]
  27. Livingstone DE, Kenyon CJ, Walker BR 2000 Mechanisms of dysregulation of 11ß-hydroxysteroid dehydrogenase type 1 in obese Zucker rats. J Endocrinol 167:533–539[Abstract]
  28. Andrews RC, Herlihy O, Livingstone DE, Andrew R, Walker BR 2002 Abnormal cortisol metabolism and tissue sensitivity to cortisol in patients with glucose intolerance. J Clin Endocrinol Metab 87:5587–5593[Abstract/Free Full Text]
  29. Handoko K, Yang K, Strutt B, Khalil W, Killinger D 2000 Insulin attenuates the stimulatory effects of tumor necrosis factor alpha on 11ß-hydroxysteroid dehydrogenase 1 in human adipose stromal cells. J Steroid Biochem Mol Biol 72:163–168[CrossRef][Medline]
  30. Tomlinson JW, Moore J, Cooper MS, Bujalska I, Shahmanesh M, Burt C, Strain A, Hewison M, Stewart PM 2001 Regulation of expression of 11ß-hydroxysteroid dehydrogenase type 1 in adipose tissue: tissue-specific induction by cytokines. Endocrinology 142:1982–1989[Abstract/Free Full Text]
  31. Friedberg M, Zoumakis E, Hiroi N, Bader T, Chrousos GP, Hochberg Z 2003 Modulation of 11ß-hydroxysteroid dehydrogenase type 1 in mature human subcutaneous adipocytes by hypothalamic messengers. J Clin Endocrinol Metab 88:385–393[Abstract/Free Full Text]
  32. Hotamisligil GS 1999 The role of TNFalpha and TNF receptors in obesity and insulin resistance. J Intern Med 245:621–625[CrossRef][Medline]
  33. Phillips DI, Barker DJ, Fall CH, Seckl JR, Whorwood CB, Wood PJ, Walker BR 1998 Elevated plasma cortisol concentrations: a link between low birth weight and the insulin resistance syndrome? J Clin Endocrinol Metab 83:757–760[Abstract/Free Full Text]
  34. Walker BR, Soderberg S, Lindahl B, Olsson T 2000 Independent effects of obesity and cortisol in predicting cardiovascular risk factors in men and women. J Intern Med 247:198–204[CrossRef][Medline]
  35. Rosmond R, Dallman MF, Bjorntorp P 1998 Stress-related cortisol secretion in men: relationships with abdominal obesity and endocrine, metabolic and hemodynamic abnormalities. J Clin Endocrinol Metab 83:1853–1859[Abstract/Free Full Text]
  36. Knowler WC, Pettitt DJ, Saad MF, Charles MA, Nelson RG, Howard BV, Bogardus C, Bennett PH 1991 Obesity in the Pima Indians: its magnitude and relationship with diabetes. Am J Clin Nutr 53(6 Suppl):1543S–1551S
  37. Gautier JF, Milner MR, Elam E, Chen K, Ravussin E, Pratley RE 1999 Visceral adipose tissue is not increased in Pima Indians compared with equally obese Caucasians and is not related to insulin action or secretion. Diabetologia 42:28–34[CrossRef][Medline]
  38. Knowler WC, Pettitt DJ, Saad MF, Bennett PH 1990 Diabetes mellitus in the Pima Indians: incidence, risk factors and pathogenesis. Diabetes Metab Rev 6:1–27[Medline]
  39. Tataranni PA, Cizza G, Snitker S, Gucciardo F, Lotsikas A, Chrousos GP, Ravussin E 1999 Hypothalamic-pituitary-adrenal axis and sympathetic nervous system activities in Pima Indians and Caucasians. Metabolism 48:395–399[CrossRef][Medline]
  40. Tiosano D, Eisentein I, Militianu D, Chrousos GP, Hochberg Z 2003 11ß-Hydroxysteroid dehydrogenase activity in hypothalamic obesity. J Clin Endocrinol Metab 88:379–384[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J EndocrinolHome page
D. E W Livingstone, S. L Grassick, G. L Currie, B. R Walker, and R. Andrew
Dysregulation of glucocorticoid metabolism in murine obesity: comparable effects of leptin resistance and deficiency
J. Endocrinol., May 1, 2009; 201(2): 211 - 218.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Q. Purnell, S. E. Kahn, M. H. Samuels, D. Brandon, D. L. Loriaux, and J. D. Brunzell
Enhanced cortisol production rates, free cortisol, and 11{beta}-HSD-1 expression correlate with visceral fat and insulin resistance in men: effect of weight loss
Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E351 - E357.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. W. Tomlinson, J. Finney, C. Gay, B. A. Hughes, S. V. Hughes, and P. M. Stewart
Impaired Glucose Tolerance and Insulin Resistance Are Associated With Increased Adipose 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Expression and Elevated Hepatic 5{alpha}-Reductase Activity
Diabetes, October 1, 2008; 57(10): 2652 - 2660.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Sai, C. L. Esteves, V. Kelly, Z. Michailidou, K. Anderson, A. P. Coll, Y. Nakagawa, T. Ohzeki, J. R. Seckl, and K. E. Chapman
Glucocorticoid Regulation of the Promoter of 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Is Indirect and Requires CCAAT/Enhancer-Binding Protein-{beta}
Mol. Endocrinol., September 1, 2008; 22(9): 2049 - 2060.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Balachandran, H. Guan, M. Sellan, S. van Uum, and K. Yang
Insulin and Dexamethasone Dynamically Regulate Adipocyte 11{beta}-Hydroxysteroid Dehydrogenase Type 1
Endocrinology, August 1, 2008; 149(8): 4069 - 4079.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
K. Yang, H. Guan, E. Arany, D. J. Hill, and X. Cao
Neuropeptide Y is produced in visceral adipose tissue and promotes proliferation of adipocyte precursor cells via the Y1 receptor
FASEB J, July 1, 2008; 22(7): 2452 - 2464.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
D. P Macfarlane, S. Forbes, and B. R Walker
Glucocorticoids and fatty acid metabolism in humans: fuelling fat redistribution in the metabolic syndrome
J. Endocrinol., May 1, 2008; 197(2): 189 - 204.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. A. De Sousa Peixoto, S. Turban, J. H. Battle, K. E. Chapman, J. R. Seckl, and N. M. Morton
Preadipocyte 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Is a Keto-Reductase and Contributes to Diet-Induced Visceral Obesity in Vivo
Endocrinology, April 1, 2008; 149(4): 1861 - 1868.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. Boullu-Ciocca, V. Achard, V. Tassistro, A. Dutour, and M. Grino
Postnatal Programming of Glucocorticoid Metabolism in Rats Modulates High-Fat Diet-Induced Regulation of Visceral Adipose Tissue Glucocorticoid Exposure and Sensitivity and Adiponectin and Proinflammatory Adipokines Gene Expression in Adulthood
Diabetes, March 1, 2008; 57(3): 669 - 677.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
B. R Walker
Glucocorticoids and Cardiovascular Disease
Eur. J. Endocrinol., November 1, 2007; 157(5): 545 - 559.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Barat, D. E. W. Livingstone, C. M. C. Elferink, C. R. McDonnell, B. R. Walker, and R. Andrew
Effects of Gonadectomy on Glucocorticoid Metabolism in Obese Zucker Rats
Endocrinology, October 1, 2007; 148(10): 4836 - 4843.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
Z. Michailidou, A. P Coll, C. J Kenyon, N. M Morton, S. O'Rahilly, J. R Seckl, and K. E Chapman
Peripheral mechanisms contributing to the glucocorticoid hypersensitivity in proopiomelanocortin null mice treated with corticosterone
J. Endocrinol., July 1, 2007; 194(1): 161 - 170.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Buren, S.-A. Bergstrom, E. Loh, I. Soderstrom, T. Olsson, and C. Mattsson
Hippocampal 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Messenger Ribonucleic Acid Expression Has a Diurnal Variability that Is Lost in the Obese Zucker Rat
Endocrinology, June 1, 2007; 148(6): 2716 - 2722.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
D. Qi and B. Rodrigues
Glucocorticoids produce whole body insulin resistance with changes in cardiac metabolism
Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E654 - E667.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. J. Wake, N. Z. M. Homer, R. Andrew, and B. R. Walker
Acute In Vivo Regulation of 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Activity by Insulin and Intralipid Infusions in Humans
J. Clin. Endocrinol. Metab., November 1, 2006; 91(11): 4682 - 4688.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
P. Darmon, F. Dadoun, S. Boullu-Ciocca, M. Grino, M.-C. Alessi, and A. Dutour
Insulin resistance induced by hydrocortisone is increased in patients with abdominal obesity
Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E995 - E1002.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
B. Mariniello, V. Ronconi, S. Rilli, P. Bernante, M. Boscaro, F. Mantero, and G. Giacchetti
Adipose tissue 11{beta}-hydroxysteroid dehydrogenase type 1 expression in obesity and Cushing's syndrome
Eur. J. Endocrinol., September 1, 2006; 155(3): 435 - 441.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. K. Paulsen, S. B. Pedersen, J. O. L. Jorgensen, S. Fisker, J. S. Christiansen, A. Flyvbjerg, and B. Richelsen
Growth Hormone (GH) Substitution in GH-Deficient Patients Inhibits 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Messenger Ribonucleic Acid Expression in Adipose Tissue
J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 1093 - 1098.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
K. M Oltmanns, B. Dodt, B. Schultes, H. H Raspe, U. Schweiger, J. Born, H. L Fehm, and A. Peters
Cortisol correlates with metabolic disturbances in a population study of type 2 diabetic patients
Eur. J. Endocrinol., February 1, 2006; 154(2): 325 - 331.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. L. McCormick, X. Wang, and G. J. Mick
Evidence That the 11 {beta}-Hydroxysteroid Dehydrogenase (11 {beta}-HSD1) Is Regulated by Pentose Pathway Flux: STUDIES IN RAT ADIPOCYTES AND MICROSOMES
J. Biol. Chem., January 6, 2006; 281(1): 341 - 347.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
N. M. Morton, V. Densmore, M. Wamil, L. Ramage, K. Nichol, L. Bunger, J. R. Seckl, and C. J. Kenyon
A Polygenic Model of the Metabolic Syndrome With Reduced Circulating and Intra-Adipose Glucocorticoid Action
Diabetes, December 1, 2005; 54(12): 3371 - 3378.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Grino
Prenatal nutritional programming of central obesity and the metabolic syndrome: role of adipose tissue glucocorticoid metabolism
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2005; 289(5): R1233 - R1235.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. M. Paterson, J. R. Seckl, and J. J. Mullins
Genetic manipulation of 11{beta}-hydroxysteroid dehydrogenases in mice
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2005; 289(3): R642 - R652.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
S. Arampatzis, B. Kadereit, D. Schuster, Z. Balazs, R. A S Schweizer, F. J Frey, T. Langer, and A. Odermatt
Comparative enzymology of 11{beta}-hydroxysteroid dehydrogenase type 1 from six species
J. Mol. Endocrinol., August 1, 2005; 35(1): 89 - 101.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
N. Draper and P. M Stewart
11{beta}-Hydroxysteroid dehydrogenase and the pre-receptor regulation of corticosteroid hormone action
J. Endocrinol., August 1, 2005; 186(2): 251 - 271.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. S. Fox, N. L. Heard-Costa, R. S. Vasan, J. M. Murabito, R. B. D'Agostino Sr., and L. D. Atwood
Genomewide Linkage Analysis of Weight Change in the Framingham Heart Study
J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3197 - 3201.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
R. Andrew, J. Westerbacka, J. Wahren, H. Yki-Jarvinen, and B. R. Walker
The Contribution of Visceral Adipose Tissue to Splanchnic Cortisol Production in Healthy Humans
Diabetes, May 1, 2005; 54(5): 1364 - 1370.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
G. Apostolova, R. A. S. Schweizer, Z. Balazs, R. M. Kostadinova, and A. Odermatt
Dehydroepiandrosterone inhibits the amplification of glucocorticoid action in adipose tissue
Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E957 - E964.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
P. A. Tataranni and E. Ortega
A Burning Question: Does an Adipokine-Induced Activation of the Immune System Mediate the Effect of Overnutrition on Type 2 Diabetes?
Diabetes, April 1, 2005; 54(4): 917 - 927.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
E. E. Kershaw, N. M. Morton, H. Dhillon, L. Ramage, J. R. Seckl, and J. S. Flier
Adipocyte-Specific Glucocorticoid Inactivation Protects Against Diet-Induced Obesity
Diabetes, April 1, 2005; 54(4): 1023 - 1031.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. C. Sandeep, R. Andrew, N. Z.M. Homer, R. C. Andrews, K. Smith, and B. R. Walker
Increased In Vivo Regeneration of Cortisol in Adipose Tissue in Human Obesity and Effects of the 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Inhibitor Carbenoxolone
Diabetes, March 1, 2005; 54(3): 872 - 879.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. J. Drake, D. E. W. Livingstone, R. Andrew, J. R. Seckl, N. M. Morton, and B. R. Walker
Reduced Adipose Glucocorticoid Reactivation and Increased Hepatic Glucocorticoid Clearance as an Early Adaptation to High-Fat Feeding in Wistar Rats
Endocrinology, February 1, 2005; 146(2): 913 - 919.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. Boullu-Ciocca, A. Dutour, V. Guillaume, V. Achard, C. Oliver, and M. Grino
Postnatal Diet-Induced Obesity in Rats Upregulates Systemic and Adipose Tissue Glucocorticoid Metabolism During Development and in Adulthood: Its Relationship With the Metabolic Syndrome
Diabetes, January 1, 2005; 54(1): 197 - 203.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
P. W. Franks, W. C. Knowler, S. Nair, J. Koska, Y.-H. Lee, R. S. Lindsay, B. R. Walker, H. C. Looker, P. A. Permana, P. A. Tataranni, et al.
Interaction Between an 11{beta}HSD1 Gene Variant and Birth Era Modifies the Risk of Hypertension in Pima Indians
Hypertension, November 1, 2004; 44(5): 681 - 688.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. W. Tomlinson, E. A. Walker, I. J. Bujalska, N. Draper, G. G. Lavery, M. S. Cooper, M. Hewison, and P. M. Stewart
11{beta}-Hydroxysteroid Dehydrogenase Type 1: A Tissue-Specific Regulator of Glucocorticoid Response
Endocr. Rev., October 1, 2004; 25(5): 831 - 866.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Kannisto, K. H. Pietilainen, E. Ehrenborg, A. Rissanen, J. Kaprio, A. Hamsten, and H. Yki-Jarvinen
Overexpression of 11{beta}-Hydroxysteroid Dehydrogenase-1 in Adipose Tissue Is Associated with Acquired Obesity and Features of Insulin Resistance: Studies in Young Adult Monozygotic Twins
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4414 - 4421.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Valsamakis, A. Anwar, J. W. Tomlinson, C. H. L. Shackleton, P. G. McTernan, R. Chetty, P. J. Wood, A. K. Banerjee, G. Holder, A. H. Barnett, et al.
11{beta}-Hydroxysteroid Dehydrogenase Type 1 Activity in Lean and Obese Males with Type 2 Diabetes Mellitus
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4755 - 4761.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. M. Morton, L. Ramage, and J. R. Seckl
Down-Regulation of Adipose 11{beta}-Hydroxysteroid Dehydrogenase Type 1 by High-Fat Feeding in Mice: A Potential Adaptive Mechanism Counteracting Metabolic Disease
Endocrinology, June 1, 2004; 145(6): 2707 - 2712.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Asensio, P. Cettour-Rose, C. Theander-Carrillo, F. Rohner-Jeanrenaud, and P. Muzzin
Changes in Glycemia by Leptin Administration or High- Fat Feeding in Rodent Models of Obesity/Type 2 Diabetes Suggest a Link between Resistin Expression and Control of Glucose Homeostasis
Endocrinology, May 1, 2004; 145(5): 2206 - 2213.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. A. S. Schweizer, M. Zurcher, Z. Balazs, B. Dick, and A. Odermatt
Rapid Hepatic Metabolism of 7-Ketocholesterol by 11{beta}-Hydroxysteroid Dehydrogenase Type 1: SPECIES-SPECIFIC DIFFERENCES BETWEEN THE RAT, HUMAN, AND HAMSTER ENZYME
J. Biol. Chem., April 30, 2004; 279(18): 18415 - 18424.
[Abstract] [Full Text] [PDF]


Home page
Recent Prog Horm ResHome page
J. R. Seckl, N. M. Morton, K. E. Chapman, and B. R. Walker
Glucocorticoids and 11beta-Hydroxysteroid Dehydrogenase in Adipose Tissue
Recent Prog. Horm. Res., January 1, 2004; 59(1): 359 - 393.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
D. J. Wake, E. Rask, D. E. W. Livingstone, S. Soderberg, T. Olsson, and B. R. Walker
Local and Systemic Impact of Transcriptional Up-Regulation of 11{beta}-Hydroxysteroid Dehydrogenase Type 1 in Adipose Tissue in Human Obesity
J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3983 - 3988.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lindsay, R. S.
Right arrow Articles by Walker, B. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lindsay, R. S.
Right arrow Articles by Walker, B. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals