help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Puñales, M. K.
Right arrow Articles by Maia, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Puñales, M. K.
Right arrow Articles by Maia, A. L.
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 6 2644-2649
Copyright © 2003 by The Endocrine Society

RET Codon 634 Mutations in Multiple Endocrine Neoplasia Type 2: Variable Clinical Features and Clinical Outcome

Marcia K. Puñales, Hans Graf, Jorge L. Gross and Ana Luiza Maia

Endocrine Division, Hospital de Clínicas de Porto Alegre, Universidade Federal do Rio Grande do Sul, Porto Alegre 90035-003, Rio Grande do Sul, Brazil; and Serviço de Endocrinologia e Metabologia DA, Universidade Federal do Paraná (H.G.), Curitiba 80060-900, Paraná, Brazil

Address all correspondence and requests for reprints to: Ana Luiza Maia, M.D., Ph.D., Serviço de Endocrinologia, Hospital de Clínicas de Porto Alegre, Rua Ramiro Barcelos 2350, 90035-003 Porto Alegre, Rio Grande do Sul, Brazil. E-mail: almaia{at}vortex.ufrgs.br.


    Abstract
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion and Conclusions
 References
 
Since the establishment of a protocol for molecular analysis of hereditary medullary thyroid carcinoma (MTC) in southern Brazil, in 1997, 17 independent families with RET germline mutation have been identified. Because neither molecular diagnosis nor the pentagastrin test were available before the establishment of this protocol, we had the opportunity to observe a large number of patients in whom the disease has evolved naturally without medical intervention, namely prophylactic thyroidectomy. We observed a wide spectrum in terms of clinical presentation and natural course of the disease even among genetically related individuals. Sixty-nine individuals from 12 different families presented a codon 634 mutation, the most prevailing missense mutation in our series. The specific mutations identified were C634Y (n = 49), C634R (n = 13), and C634W (n = 7). Individuals with the C634R mutation presented significantly more distant metastases at diagnosis than subjects with the C634Y or C634W mutations (54.5% vs. 19.4% vs. 14.3%, respectively, P = 0.03). Further analysis of the estimated cumulative frequency of lymph node and/or distant metastases by Kaplan-Meier curves showed that the appearance of lymph nodes and metastases occurred later in patients with C634Y than in those with C634R (P = 0.001). Our results suggest that specific nucleotide and amino acid exchanges at codon 634 might have a direct impact on tumor aggressiveness in MEN 2A syndrome.


    Introduction
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion and Conclusions
 References
 
MEDULLARY THYROID CARCINOMA (MTC), a tumor of the parafollicular C cells of the thyroid, may occur sporadically or as part of three clinically distinct dominantly inherited cancer syndromes. In patients with familial MTC (FMTC) only the thyroid is affected. Patients with multiple endocrine neoplasia (MEN) 2A develop MTC, pheochromocytoma (pheo) and/or primary hyperparathyroidism (HPT) (1). In contrast, MEN 2B patients have MTC, pheo, ganglioneuromas of the digestive tract, mucosal neuromas, and/or skeletal abnormalities (1).

The RET proto-oncogene is the susceptibility gene for hereditary MTC (2). Germline mutations in MEN 2A and FMTC syndromes have been described in exons 10, 11, 13, 14, and 15 of RET, whereas a single germline mutation in exon 16 has been found in more than 95% of unrelated MEN 2B cases (1, 3). Genetic testing for germline mutations in the RET proto-oncogene has become available and today forms the basis for MTC screening procedures. Molecular biology now allows early identification of carriers of RET proto-oncogene germline mutations who will develop MTC later in life. In these patients, early prophylactic thyroidectomy must be considered to ensure definitive cure. In fact, early thyroidectomy may decrease the mortality from hereditary MTC to less than 5% (4).

In the past few years, several genotype-phenotype correlations have focused on the relationship between specific mutations and different MEN 2 syndrome variants (5, 6, 7). The international RET mutation consortium analysis, which studied 477 independent MEN 2 families, found a statistically significant association between the presence of any mutation at codon 634 and presence of pheo and HPT (5). On the contrary, mutations at codons 768 and 804 are thus far associated with FMTC, while codon 918 mutations are MEN-2B-specific (5). It is interesting to note that, whereas the international RET mutation consortium analysis reported that only 10% of FMTC families have germline mutations in the intracellular domain of the RET gene, the French Calcitonin Tumors Study Group found that this kind of mutation is present in about half of FMTC families (6), suggesting that the frequency of specific RET mutations in MEN 2A phenotype may be influenced by the genetic background of the studied population.

The international RET mutation consortium analysis did not include any Brazilian families, but in 1997 our group established a protocol for molecular analysis of MTC in southern Brazil. Until then, neither molecular diagnostic tools nor the pentagastrin test had been available, and therefore we had the opportunity to observe the natural evolution of the disease, without prophylactic interventions, in large families harboring the codon 634 RET mutation. These observations have allowed us to study the heterogeneity in phenotype and disease presentation associated with this mutation and motivated us to describe our findings. Therefore, the present report has two aims: first, to describe the frequency of the RET proto-oncogene in a sample of Brazilian kindred with hereditary MTC; and second to describe the natural course of the disease in 69 heterozygotes from 12 independent families presenting the RET codon 634 mutation.


    Patients and Methods
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion and Conclusions
 References
 
Patients

Patients with a diagnosis of medullary thyroid carcinoma attending the Endocrine Division at Hospital de Clínicas de Porto Alegre were invited to participate in the study. Our division is a reference center for molecular testing of germline RET mutation in Brazil, and therefore patients referred to us by other Brazilian centers for molecular investigation were also invited to participate.

A total of 88 patients with germline mutation of the RET proto-oncogene and/or and immunohistochemistry diagnosis of MTC were identified. This sample encompassed 17 index cases and 61 affected members of families with hereditary MTC, plus 10 individuals with sporadic tumors. Before undergoing genetic testing, all patients and/or their legal guardians gave their written informed consent, as required by the institution’s Ethics Committee.

MEN 2A cases were classified following the International Consortium of MEN Syndromes (5). Briefly, families with MTC, Pheo, and HPT were classified as MEN 2A(1); families with MTC and pheo as MEN 2A(2); and families with MTC and HPT, as MEN 2A(3). The classification of FMTC refers to families with a minimum of four members with MTC. Families with fewer than four members affected by MTC were classified under the category others. The data collected for each family included the clinical features of family members (association of other endocrine neoplasias), the presence and type of RET mutations, and information on atypical features noted, such as Hirschsprung’s disease or cutaneous lichen amyloidosis (CLA).

Patients with positive genetic screening underwent a complete clinical examination, laboratory tests [levels of basal calcitonin (Calcitonin IRMA-DSL7700, Diagnostic Systems Laboratories, Inc., Webster, TX, reference range less than 10 pg/ml), plasma calcium and PTH (Immulite 2000 Intact PTH, Diagnostic Products Corp., Los Angeles, CA)], and extensive diagnostic imaging investigation that included cervical ultrasonography, cervical, thorax, and abdominal computed tomography. Selected patients were submitted to whole-body metaiodobenzylguanidine scintigraphy to rule out pheo and/or local and distant metastasis. Also, a punch biopsy of the skin was performed in selected patients suspected of having CLA in an area clinically affected by a characteristic lesion. Biopsy specimens were fixed in 10% formalin and stained with hematoxylin and eosin, crystal violet, and congo red.

The regular follow-up of hereditary MTC in our Division consists of basal calcitonin, serum calcium and PTH determinations every 6 months and of a yearly abdominal and chest computed tomography. We advocate a preventive total thyroidectomy for gene carriers older than 5 yr, associated with a standard systematic central cervical lymph node dissection in those with suspected MTC or C cell disease on the basis of increased calcitonin level. Study participants with pheo or HPT underwent specific surgery. Tumor staging was performed according to the current International Union against Cancer tumor/node/metastases classification (8).

DNA Extraction and PCR amplification

Genomic DNA was prepared from white blood cells according to standard protocols. Oligonucleotide primers for amplification of different RET exons were designed on the intronic sequences flanking exons 10 (5' AGGCTGAGTGGGCTACGTCTG 3'/5' GTTGAGACCTCTGTGGGGCT 3'), 11 (5' ATGAGGCAGAGCATACGCAGCC 3'/5' CTTGAAGGCATCCACGGAGACC 3'), 13 (5' AACTTGGGCAAGGCGATGCA 3'/5' AGAACAGGGCTGTATGGAGC 3'), 14 (5' AAGACCCAAGCTGCCTGA 3'/5' GCTGGGTGCAGAGCCATAT 3'), 15 (5'-GACCGCTGTGCCTGGCCAT 3'/5'-GCAGGCAGTCCTTGGGAAGC 3') and 16 (5' AGGGATAGGGCCTGGGCTTC 3'/5' TAACCTCCACCCCAAGAGAG 3'). PCRs were run in a final volume of 50 µl using 100 or 200 ng genomic DNA, containing 20 mM Tris HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM deoxynucleotide triphosphate, 1 U Taq polymerase, and 1 µM of specific primer. Genomic DNA was denatured for 3 min at 94 C before 35 cycles at 94, 65, and 72 C for 1 min at each temperature, followed by a 5-min 72 C step in a programmable thermal controller (MJ Research, Inc., Waltham, MA). Following PCR, the amplicon sizes were analyzed in 1.5% agarose gel and the products visualized by ethidium bromide staining.

Single-strand conformational polymorphism analysis, restriction enzyme analysis, and direct sequencing

For single-strand conformational polymorphism analysis of exons 10, 11, 13, 14, and 15, the amplified DNA fragments were denatured in formamide and cooled in ice before gel loading. Separation was carried out in a vertical electrophoresis apparatus in an 8–12% polyacrylamide-0.8% bis-acrylamide gel at 8 C, 45 C, 30 C, or at room temperature for exons 10, 11, 13, and 14–15, respectively, at 200–240 mV for 2–4 h (9, 10). DNA bands were visualized by silver staining according to standard procedures (11). The bands presenting altered migration were further analyzed by differential restriction enzymes (12) for 2 h. The product was examined on a 2.5% agarose gel and the bands were visualized by ethidium bromide staining. Amplicons of exon 16 were directly screened for mutations by restriction enzyme analysis with FokI (12). Whenever necessary, the presence of the mutation was confirmed by direct sequencing of the PCR product using the Sanger method in an automated sequencer, according to the manufacturer’s instructions (Alf Express, Pharmacia Biotech AB, Uppsala, Sweden).

Statistical analysis

Results are expressed as mean ± SD unless otherwise specified. Baseline characteristics were compared using the {chi}2 test or Fisher’s exact test for qualitative variables, or the Student’s t test or Mann-Whitney’s U test for quantitative variables. The differences in cumulative lymph node and/or distant metastasis rates among groups were tested by Kaplan-Meier curves; comparisons between curves were performed using the log rank test. The Statistical Package for the Social Sciences 7.5 (SPSS, Inc., Chicago, IL) was used for the statistical analysis. P < 0.05 was considered as statistically significant.


    Results
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion and Conclusions
 References
 
Sample description

We analyzed the RET proto-oncogene from 160 individuals, 150 from members of 17 separate MEN 2 families and 10 from patients with apparently sporadic medullary thyroid carcinoma. A total of 78 individuals with hereditary MTC were enrolled in this study. Fifty-four of these individuals were identified based on clinical signs of thyroid neoplasia and familial thyroid cancer or endocrine related neoplasias. In addition, molecular screening identified another 24 individuals without clinical evidence of disease but at risk because of an affected relative. A mutation was identified in all kindred patients with documented germline transmission of MTC.

RET proto-oncogene mutations and disease phenotype

Table 1Go summarizes the clinical and molecular data of the families with MEN 2. Of the 17 families with hereditary MTC analyzed, 8 were diagnosed with MEN 2A; 4 with MEN 2B; 3 with the rare syndrome of MEN 2A associated with CLA; 1 with FMTC; and 1 was categorized as "others." MEN 2A patients were further subclassified into three operational categories based on the combination of disease features identified (6).


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical characteristics and RET mutations in families with multiple endocrine neoplasia type 2

 
We observed a wide spectrum of clinical presentation and natural course of the disease among MEN 2A individuals. The presence of pheo/HPT ranged from 12.5–100%. Age at diagnosis also showed ample variation in both individuals diagnosed based on the presence of palpable thyroid nodule (9–63 yr) and in those 22 identified by molecular screening (2.5–73 yr). Of the 8 families classified as MEN 2A, all but one had a mutation at codon 634, exon 11. The identified mutations were TGC->CGC (Cys->Arg, 42.8%), TAC (Cys->Tyr, 42.8%) and TGG (Cys->Trp, 14.2%).

Three families presented the rare syndrome of MEN 2A associated with CLA and all of them presented a germline mutation at codon 634. Because of the stringent operational definition of FMTC (2), only one family fell into this category. A mutation at codon 634 was identified in the index case and in 4 other family members. One family was included in the category "others." The proband, a 43-yr-old male who denied having a family history of thyroid cancer presented a TGC->TAC (Cys->Tyr) change at codon 634 and 1 of his 2 offspring was also diagnosed with MTC at age 25 yr. The most prevalent mutation in our series was observed at codon 634, accounting for 93% of cases.

Four patients with MEN 2B syndrome were identified. All individuals presented the characteristic phenotype and de novo mutation at codon 918, exon 16, resulting in the substitution of a methionine residue by threonine (M918T). As expected, these patients presented very aggressive tumors, with cervical or distant metastases at the time of diagnosis. One patient died at the age of 18 yr as a consequence of gastrointestinal bleeding.

RET 634 mutation heterozygotes

In view of the large number patients with a codon 634 mutation, we analyzed the individual clinical and oncological features of these patients. Sixty-nine individuals from 12 unrelated families were found to harbor the germline RET 634 mutation (Table 1Go). In 47 (68.1%) subjects, including index patients, the diagnosis was based on clinical evidence through evaluation of a thyroid nodule (Table 1Go). All of these individuals presented elevated basal serum calcitonin. Molecular screening identified another 22 (31.9%) patients without clinical signs of thyroid cancer. Serum basal calcitonin was determined in 19 of these, and was elevated in 8 (42%). As expected, the mean age at diagnosis was significantly lower in these individuals than in patients with clinical evidence of disease (21.7 ± 21.6 vs. 29.8 ± 11.6 yr, P < 0.04), although both groups presented a wide age range (Table 1Go).

In the group of individuals diagnosed by RET screening, we were surprised to identify as gene carriers three women with ages 62, 65, and 73 yr in a MEN 2A + CLA kindred (family no. 11, Table 1Go). They had no clinical complaints and their thyroid physical examination was considered normal. Thyroid ultrasonography displayed 1 or more nodules (varying in diameter from 0.3–2 cm) and guided-fine needle aspiration confirmed MTC. Serum basal calcitonin was elevated in all 3 patients (880 pg/ml, 1100 pg/ml and 37.0 pg/ml, respectively; reference range <10 pg/ml). The 65-yr-old patient underwent surgery, and the histopathologic examination revealed a 2-cm nodule on each thyroid lobe, with C cell hyperplasia and MTC. No metastasis was found in a total of 62 lymph nodes removed. The two other patients refused surgery. None of them presented distant metastases.

The frequency of pheo in the group of patients with clinical disease was 38.3% (n = 18). Nine individuals (19.1%) presented HPT; in seven of these patients, HPT was associated with pheo and MTC, whereas in two patients it was associated to MTC only. All patients except for one presented MTC as the first disease manifestation.

A total of 50 patients underwent surgery, 43 with clinical disease and 7 gene carriers. All patients presented C cell hyperplasia and/or MTC at histopathology. In the group of patients with clinical disease (Table 2Go), lymph node and distant metastases were present in 51.2% and 33.1% of individuals, respectively. Only 1 out of 7 gene carriers presented lymph node metastases—a 27-yr-old woman with a C634Y germline mutation. Seven patients died of MTC, and all of them had disseminated disease at diagnosis. Neither sex (P = 0.109) nor associated endocrine neoplasia, pheo (P = 0.174) or HPT (P = 0.92), were associated with mortality. In contrast, age at diagnosis (40.9 ± 10.4 vs. 28.6 ± 10.5, P = 0.007) and stage of disease (P = 0.001) were significantly associated with death.


View this table:
[in this window]
[in a new window]
 
Table 2. Clinical and oncological features of multiple endocrine neoplasia 2A grouped by nucleotide/amino acid exchange

 
We also analyzed the clinical and oncological features of 47 patients identified based on clinical evidence, grouped by nucleotide and amino acid exchange at codon 634 (Table 2Go). The specific mutations were C634Y (n = 30), C634R (n = 10), and C634W (n = 7). In these patients, we did not find significant differences in age at diagnosis (P = 0.46), frequency of pheo (P = 0.62) or HPT (P = 0.61), and lymph node metastasis (P = 0.19) among individuals with the three genotypes analyzed. However, the presence of distant metastases at diagnosis was significantly higher in C634R heterozygotes (P = 0.03).

Natural history of MEN 2A in codon 634 mutation heterozygotes

Based on the finding of a significant association between the C634R mutation and the presence of distant metastases at diagnosis, we speculated that specific changes in cysteine substitution at codon 634 could affect natural history of disease in MEN 2A. As gene dysfunction is present since birth, we assumed that the individual age at diagnosis would indicate the period of exposure, and thus we performed additional analyses using the Kaplan-Meier model. Indeed, Kaplan-Meier estimates of cumulative lymph node metastasis rate in the 50 patients who underwent surgery yielded distinct curves for C634R and C634Y genotypes (P = 0.027). The presence of distant metastases at diagnosis as a function of age was also analyzed. Kaplan-Meier estimates of distant metastasis rates yielded significantly different curves for C634R and C634Y heterozygotes (P = 0.001) (Fig. 1Go). Both events, lymph nodes and distant metastases, occurred earlier in individuals harboring the C634R mutation. The youngest patient with lymph nodes and distant metastases (a 15-yr-old girl) presented a C634R germline mutation. On the other hand, distant metastases were not diagnosed before age 30 yr in individuals with the C634Y mutation. Individuals with the C634W mutation were not analyzed because of the small number patients/events.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Kaplan-Meier estimates of the proportion of patients with specific codon 634 mutation and distant metastases at diagnosis. The log rank test was used to compared curves (P = 0.001).

 

    Discussion and Conclusions
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion and Conclusions
 References
 
We showed the frequency profile of RET proto-oncogene mutations in a sample of 17 unrelated Brazilian families with hereditary MTC. Because of the lack of genetic or clinical screening until recently, we had the unique opportunity to observe the natural history of MEN 2A in a large number of individuals harboring codon 634 mutations, classically described as high risk. We observed a wide variance in disease phenotype, age at onset and tumor behavior in different families. Individuals with the C634R genotype had significantly more distant metastases than those with the C634Y or C634W mutations, despite similar ages at diagnosis. Accordingly, Kaplan-Meier estimates of cumulative lymph node and/or distant metastasis rates demonstrated that these events occurred earlier in individuals harboring the C634R mutations, indicating that nucleotide and amino acid exchange might have a direct impact on tumor aggressiveness in MEN 2A syndrome.

The RET proto-oncogene is expressed in cells of neuronal and neuroepithelial origin and encodes a receptor tyrosine kinase (13). Approximately 92% of the three variants of MEN 2 are related to germline mutations of RET (3). Mutations on the highly conserved extracellular cysteine ligand-binding domain encoded by exons 10 and 11 induce constitutive tyrosine kinase activity due to aberrant homodimerization (14, 15). The transforming capacity of the c-RET examined in transfected NIH-3T3 cells has been shown to be dependent on specific mutated codons with the C634R (TGC->CGC) mutant showing a 3-to 5-fold higher transforming activity compared with any exon 10 Cys mutants (16). Although the three-dimensional structure of the RET extracellular domain is still unknown, these cysteines likely form intramolecular disulfide bonds in the wild-type receptor, and the mutation results in an unpaired cysteine, which forms an activating intermolecular bridge (17). Differences in dimerization induction intensities are a reasonable explanation for the phenotypes resulting from mutations of the different cysteines. In fact, the international RET mutation consortium analysis studied 477 MEN 2 families from 18 tertiary referral centers, which did not include any kindred from Brazil, and demonstrated that specifically mutated RET codons correlate with MEN 2 variants (2).

Differences in the frequency of specific RET mutations in MEN 2A phenotypes have been found in series from different countries, suggesting that the occurrence of these mutations may be influenced by genetic background (5, 6, 7, 18, 19, 20). In our series, the most frequent phenotype was the MEN 2A syndrome with codon 634 mutation, in agreement with the results of the International RET mutation consortium analysis. In that study, this kind of mutation was found in 86% of all cases of MEN 2A(1) and MEN 2A(2). One of our MEN 2A(2) families presented a C618R mutation, which was observed in only 4% of the families in the RET consortium. The family with FMTC presented the C634Y mutation, the most prevalent codon 634 specific mutation associated with this phenotype in the RET consortium.

In general, there is an agreement to recommend total thyroidectomy in MEN 2 carriers. However, no universal consensus exists as to the optimal timing and extent of prophylactic surgery in these patients. A recent study (7) has proposed a division of hereditary MTC into three risk groups, based on age at disease onset and genotype: high risk group, codon 634 and 618 mutations; intermediate risk group, codon 790, 620 and 611 mutations; and low risk group, codon 768 and 804 mutations. However, some reports have also called attention to the clinical variability and aggressiveness associated with RET mutation at codons that are classically described as having weakly activation, such as codon 804. Such reports indicate that identical RET mutations behave differently, even in the same genetic background (21, 22).

We studied 47 patients with codon 634 mutation in whom the disease has naturally evolved without medical interference (prophylactic or therapeutic thyroidectomy), and we have also observed a wide spectrum in the clinical presentation. Particularly, we studied a family harboring a C634Y mutation in which we identified, by molecular screening, members ages 62, 65, and 73 yr who were not aware of their condition and presented no clinical signs of disease, except for a thyroid nodule measuring less than 2 cm in diameter detected by ultrasonography. An interesting aspect was that the 65-yr-old patient—who was submitted to surgery—had elevated basal serum calcitonin and MTC at histopathological examination, but no lymph node or distant metastases, despite the advanced age, indicating low tumor aggressiveness. Although we do not have histopathological data about lymph node metastases for the 62- and 73-yr-old patients because they have refused surgery so far, both also seem to have an indolent disease. The observation of such unexpected clinical course of MCT in patients harboring the classically described high-risk 634 mutation suggested to us that nucleotide and amino acid exchange at this codon could have an impact on the oncological features of MEN 2A.

Indeed, patients harboring the C634R mutation presented significantly more distant metastases at diagnosis than subjects with C634Y or C634W, notwithstanding similar age at diagnosis. Accordingly, Kaplan-Meier estimates of cumulative lymph nodes and distant metastasis rates yielded distinct curves, indicating that these events occur earlier in individuals with the C634R genotype. These findings probably explain the significant association of this genotype with mortality in our series. Differences in oncological features nowadays are often difficult to detect since gene carriers have thyroidectomy even before MTC has emerged. Our results suggest that there might be differences in the type of nucleotide and amino acid exchange at codon 634 that affect the pace of malignant progression and that may ultimately lead to widespread metastatic MTC. In agreement with our findings, the youngest patients with hereditary MTC and lymph node metastasis reported in the literature outside a MEN 2B setting was a 5-yr-old girl with the C634R (Cys->Arg) missense change at codon 634 (23). Recently, the presence of MTC has been reported in a prophylactic thyroidectomy specimen obtained from a 17-month-old girl harboring the same mutation (24). The latter study also identified a 75-yr-old gene carrier with the C634Y genotype.

In our series, we identified three kindreds with the rare syndrome of MEN 2A associated with CLA. CLA was first associated with MEN 2A by Gagel et al. (25) in 1989, although Nunziata and colleagues (26) had previously reported the presence of a pruritus in affected members of a particular kindred. So far, this association has been reported in a total of only 19 families (3, 25, 26, 27, 28, 29). As in our study, these families were distributed along the operational phenotypic categories, with an apparent excess of MEN 2A(2) cases, all of which presented 634 mutations.

In conclusion, our results showed the frequency profile of proto-oncogene RET mutations of MEN 2A in 17 Brazilian families. In addition, we have demonstrated that families with hereditary thyroid carcinoma exhibit a highly variable disease presentation and that even high-risk mutations, such as those at codon 634, could present an indolent course depending on the type of nucleotide and amino acid substitution. Individuals harboring C634R, the most prevailing missense change at codon 634, seem to have a more aggressive disease, as demonstrated by more frequent distant metastases at diagnosis. They also seem to develop lymph nodes and distant metastasis at an earlier age, according to Kaplan-Meier analyses. In contrast, the C634Y genotype appears to have an indolent behavior, with low potential for spreading the disease in some individuals. Based on these results, we suggest that the timely prophylactic thyroidectomy advocated for codon 634 heterozygotes should take into account specific amino acid exchanges. The most significant drawback of our observations is the limitation in the number of patients/families. Considering the relatively small number of families with each genotype studied, and the fact that a large number of the individuals analyzed as unit-genotype belong to the same kindred, we cannot rule out the possibility of interference of other hereditary molecular events in our conclusions. Finally, it is our opinion that other information, in addition to the RET mutation, is still needed to allow understanding of disease mechanisms and to clarify the process leading to development of the full syndrome phenotype. Until such information is available, the best therapeutic approach in gene carriers of hereditary medullary thyroid carcinoma is still a matter of debate.


    Acknowledgments
 
We are thankful to Dr. Alberto Molinari (Hospital Nossa Senhora da Conceição, Porto Alegre, Rio Grande do Sul) and to Dr. José Gastão Rocha de Carvalho (Hospital de Clínicas, Universidade Federal do Paraná, Curitiba, Paraná) for referring patients for the present study. We also thank the surgeons of our Hospital, Dr. Alceu Migliavacca and Dr. José Ricardo Guimarães, for surgical management of our patients.


    Footnotes
 
This work was supported by Programa Núcleos de Excelência, Coordenação de Aperfeiçoamento de Pessoal, and Fundo de Incentivo a Pesquisa do Hospital de Clínicas de Porto Alegre, Brazil.

Current mailing address of all authors: Serviço de Endocrinologia, Hospital de Clínicas de Porto Alegre, Rua Ramiro Barcelos 2350, 90035-003 Porto Alegre, Rio Grande do Sul, Brazil.

Abbreviations: CLA, Cutaneous lichen amyloidosis; FMTC, familial MTC; HPT, hyperparathyroidism; MEN, multiple endocrine neoplasia; MTC, medullary thyroid carcinoma; pheo, pheochromocytoma.

Received September 11, 2002.

Accepted March 11, 2003.


    References
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion and Conclusions
 References
 

  1. Ponder BA 1999 The phenotypes associated with RET mutations in the multiple endocrine neoplasia type 2 syndromes. Cancer Res 59:1736–1742
  2. Mulligan LM, Kwok JB, Healey CS, Elsdon MJ, Eng C, Gardner E, Love DR, Mole SE, Moore JK, Papi L, Ponder MA, Telenius H, Tunnacliffe A, Ponder BA 1993 Germ-line mutation of the RET proto-oncogene in multiple endocrine neoplasia type 2 A. Nature 363:458–460[CrossRef][Medline]
  3. Eng C, Clayton D, Schuffenecker I, Lenoir G, Cote G, Gagel RF, Van Amstel HKP, Lips CJM, Nishisho I, Takai SI, Marsh DJ, Robinson BG, Frank-Raue K, Raue F, Xue F, Noll WW, Romei C, Pacini F, Fink M, Niederle B, Zedenius J, Nordenskjõld M, Komminoth P, Hendy GN, Gharib H, Thibodeau SN, Lacroix A, Frilling A 1996 The relationship between specific RET proto-oncogene mutation and disease phenotype in multiple endocrine neoplasia type 2. JAMA 276:1575–1579[Abstract/Free Full Text]
  4. Brandi ML, Gagel RF, Angelli A, Bilezikian JP, Beck-Peccoz P, Bordi C, Conte-Devolx B, Falchetti A, Gheri R, Libroia A, Lips CJM, Lombardi G, Mannelli M, Pacini F, Ponder BAJ, Raue F, Skogseid B, Tamburrano G, Thakker RV, Thompson NW, Tomassetti P, Tonelli F, Wells Jr SA, Marx SJ 2001 Consensus: guidelines for diagnosis and therapy of MEN type 1 and type 2. J Clin Endocrinol Metab 86:5658–5671[Abstract/Free Full Text]
  5. Mulligan LM, Marsh DJ, Robinson BG, Schuffeenecker I, Zedenius J, Lips CJM, Gagel RF, Takai SI, Noll WW, Fink M, Raue F, Lacroix A, Thibodeau SN, Frilling A, Ponder BAJ, Eng C 1995 RET mutation consortium. Genotype-phenotype correlation in multiple endocrine neoplasia type 2: report of international RET mutation consortium. J Intern Med 238:343–346[Medline]
  6. Niccoli-Sire P, Murat A, Rohmer V, Frank S, Chabrier G, Baldet L, Maes B, Savagner F, Giraud S, Bezieau S, Kottler M, Morange, Conte-Devolx B 2001 The French calcitonin tumors study group (GETC). Familial medullary thyroid carcinoma with noncysteine RET mutations: phenotype-genotype relationship in a large series of patients. J Clin Endocrinol Metab 86:3746–3753[Abstract/Free Full Text]
  7. Machens A, Gimm O, Hinze R, Hoppner W, Boehm BO, Dralle H 2001 Genotype-phenotype correlations in hereditary medullary thyroid carcinoma: oncological features and biochemical properties. J Clin Endocrinol Metab 86:1104–1109[Abstract/Free Full Text]
  8. Greene FL, Sobin LH 2002 The TNM system: our language for cancer care. J Surg Oncol 80:119–120[CrossRef][Medline]
  9. Ceccherini I, Hofstra RMW, Luo Y, Stulp RP, Barone V, Stelwagwn T 1994 DNA polymorphisms and conditions for SSCP analysis of the 20 exons of the RET proto-oncogene. Oncogene 9:3025–3029[Medline]
  10. Tsai MS, Ledger GA, Khosla S 1994 Identification of multiple endocrine neoplasia, type 2 gene carriers using linkage analysis and analysis of the RET proto-oncogene. J Clin Endocrinol Metab 78:1261–1267[Abstract]
  11. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular cloning. A laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press 18:56–57
  12. Wohllk N, Cote GJ, Evans DB, Goepfert H, Ordonez NG, Gagel RF 1996 Application of genetic screening information to the management of medullary thyroid carcinoma and multiple endocrine neoplasia type 2. Endocrinol Metab Clin North Am 25:1–24[CrossRef][Medline]
  13. Takahashi M, Cooper GM 1988 Cloning and expression of the RET proto-oncogene encoding a tyrosine-kinase with two potential transmembrane domain. Oncogene 3:571–576[Medline]
  14. Santoro M, Carlomagno F, Romano A, Bottaro DP, Dathan NA, Grieco M, Fusco A, Vecchio G, Matoskova B, Kraus MH, Difiore PP 1995 Activation of RET as a dominant transforming gene by germline mutations of MEN 2A and MEN 2B. Science 267:381–383[Abstract/Free Full Text]
  15. Chappuis-Flament S, Pasini A, De Vita G, Segouffin-Cariou C, Fusco A, Attie T, Lenoir GM, Santoro M, Billaud M 1998 Dual effect on the RET receptor of MEN 2 mutations affecting specific extracytoplasmic cysteines. Oncogene 17:2851–2861[CrossRef][Medline]
  16. Ito S, Iwashita T, Murakami H, Iwata Y, Sobue-Ku and Takahashi M 1997 Biological properties of RET with cysteine mutations correlate with multiple endocrine neoplasia type 2A, familial thyroid carcinoma, and Hirschsprung’s disease phenotype. Cancer Res 14:2870–2872
  17. Santoro M, Mellilo RM, Carlomagno F, Fusco A, Vecchio G 2002 Molecular mechanism of RET activation in human cancer. Ann NY Acad Sci 117–121
  18. Quadro L, Panariello L, Salvatore D, Carlomagno F, Del Frete M, Nunziata V, Colantuoni V, Di Giovanni G, Brandi ML, Mannelli M, Gheri R, Verga U, Libroia A, Berger N, Fusco A, Grieco M, Santoro M. Frequent 1994 RET protooncogene mutations in multiple endocrine neoplasia type 2a. J Clin Endocrinol Metab 79:590–594[Abstract]
  19. Hansen HS, Torring H, Godballe C, Jãger AC, Nielsen FC 2000 Is thyroidectomy necessary in RET mutations carriers of the familial medullary thyroid carcinoma syndrome? Cancer 89:863–867[CrossRef][Medline]
  20. Klein I, Ésik O, Homolya V, Szeri F, Váradi A 2001 Molecular genetic diagnostic program of multiple endocrine neoplasia type 2a and familial medullary thyroid carcinoma syndromes in Hungary. J Endocrinol 170:661–666[Abstract]
  21. Feldman GL, Edmonds MW, Ainsworth PJ, Schuffenecker I, Lenoir GM, Saxe AW, Talpos GB, Roberson J, Petrucelli N, Jackson CE 2000 Variable expressivity of familial medullary thyroid carcinoma (FMTC) due to a RET V804M (GTG->ATG) mutation. Surgery 128:93–98[CrossRef][Medline]
  22. Lombardo F, Baudin E, Chiefari E, Arturi F, Bardet S, Caillou B, Conte C, Dallapiccola B, Giuffrida D, Bidart JM, Schlumberger M, Filetti S 2002 Familial medullary thyroid carcinoma: clinical variability and low aggressiveness associated with RET mutation at codon 804. J Clin Endocrinol Metab 87:1674–1680[Abstract/Free Full Text]
  23. Gill JR, Reyes-Múgica M, Iyengar S, Kidd KK, Touloukian J, Smith C, Keller MS, Genel M 1996 Early presentation of metastatic medullary carcinoma in multiple endocrine neoplasia, type 2a. J Pediatr 31:459–464
  24. Sanso GE, Domene HM, Rudaz MCG, Pusiol E, Mondino AK, Roque M, Ring A, Perinetti H, Elsner B, Iorcansky S, Barontini M 2002 Very early detection of RET proto-oncogene mutation is crucial for preventive thyroidectomy in multiple endocrine neoplasia type 2 children. Cancer 94:323–330[CrossRef][Medline]
  25. Gagel R, Levy ML, Donovan DT, Alford BR, Wheeler B, Tschen JA 1989 Multiple endocrine neoplasia type 2 associated with cutaneous lichen amyloidosis. Ann Intern Med 111:802–806
  26. Nunziata V, Giannattasio R, Di Giovani G, D’Armiente MR, Mancini M 1989 Hereditary localized pruritus in affected members of a kindred with multiple endocrine neoplasia type 2A (Sipple’s syndrome). Clin Endocrinol (Oxf) 30:57–63[Medline]
  27. Lemos MC, Carilho F, Rodrigues FJ, Santos P, Carvalheiro M, Ruas MA, Regateiro FJ 2002 Early onset of medullary thyroid carcinoma in a kindred with multiple endocrine neoplasia type 2A associated with cutaneous lichen amyloidosis. Endocr Pract 8:19–22[Medline]
  28. Seri M, Celli I, Betsos N, Claudiani F, Camera G, Romeo G 1997 A cys634gly substitution of the RET proto-oncogene in a family with recurrence of multiple endocrine neoplasia type 2a and cutaneous lichen amyloidosis. Clin Genet 51:86–90[Medline]
  29. Ceccherini I, Romei C, Barone V, Pacini F, Martino E, Loviselli A, Pinchera A, Romeo G 1994 Identification of a cys634->tyr mutation of the RET proto-oncogene in a pedigree with multiple endocrine neoplasia type 2a and localized cutaneous lichen amyloidosis. J Endocrinol Invest 17:201–204[Medline]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
D Zenaty, Y Aigrain, M Peuchmaur, P Philippe-Chomette, C Baumann, F Cornelis, J P Hugot, D Chevenne, V Barbu, P J Guillausseau, et al.
Medullary thyroid carcinoma identified within the first year of life in children with hereditary multiple endocrine neoplasia type 2A (codon 634) and 2B
Eur. J. Endocrinol., May 1, 2009; 160(5): 807 - 813.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
I. N Milos, K. Frank-Raue, N. Wohllk, A. L. Maia, E. Pusiol, A. Patocs, M. Robledo, J. Biarnes, M. Barontini, T. P Links, et al.
Age-related neoplastic risk profiles and penetrance estimations in multiple endocrine neoplasia type 2A caused by germ line RET Cys634Trp (TGC>TGG) mutation
Endocr. Relat. Cancer, December 1, 2008; 15(4): 1035 - 1041.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
M. Peppa, E. Boutati, S. Kamakari, V. Pikounis, G. Peros, I. G Panayiotides, T. Economopoulos, S. A Raptis, and D. Hadjidakis
Multiple endocrine neoplasia type 2A in two families with the familial medullary thyroid carcinoma associated G533C mutation of the RET proto-oncogene
Eur. J. Endocrinol., December 1, 2008; 159(6): 767 - 771.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S Jindrichova, J Vcelak, P Vlcek, M Neradilova, J Nemec, and B Bendlova
Screening of six risk exons of the RET proto-oncogene in families with medullary thyroid carcinoma in the Czech Republic
J. Endocrinol., November 1, 2004; 183(2): 257 - 265.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Jimenez, G. T. Dang, P. N. Schultz, A. El-Naggar, S. Shapiro, E. A. Barnes, D. B. Evans, R. Vassilopoulou-Sellin, R. F. Gagel, G. J. Cote, et al.
A Novel Point Mutation of the RET Protooncogene Involving the Second Intracellular Tyrosine Kinase Domain in a Family with Medullary Thyroid Carcinoma
J. Clin. Endocrinol. Metab., July 1, 2004; 89(7): 3521 - 3526.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. M. Alvares Da Silva, R. M. B. Maciel, M. R. Dias Da Silva, S. R. C. Toledo, M. B. De Carvalho, and J. M. Cerutti
A Novel Germ-Line Point Mutation in RET Exon 8 (Gly533Cys) in a Large Kindred with Familial Medullary Thyroid Carcinoma
J. Clin. Endocrinol. Metab., November 1, 2003; 88(11): 5438 - 5443.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Puñales, M. K.
Right arrow Articles by Maia, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Puñales, M. K.
Right arrow Articles by Maia, A. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals