help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carvajal, C. A.
Right arrow Articles by Fardella, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carvajal, C. A.
Right arrow Articles by Fardella, C. E.
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 6 2501-2507
Copyright © 2003 by The Endocrine Society

Two Homozygous Mutations in the 11ß-Hydroxysteroid Dehydrogenase Type 2 Gene in a Case of Apparent Mineralocorticoid Excess

Cristian A. Carvajal, Alexis A. Gonzalez, Damian G. Romero, Angel González, Lorena M. Mosso, Elizabeth T. Lagos, Maria del P. Hevia, Maria P. Rosati, Tomás O. Perez-Acle, Celso E. Gomez-Sanchez, Joaquín A. Montero and Carlos E. Fardella

Department of Endocrinology and Internal Medicine (C.A.C., A.A.G., L.M.M., J.A.M., C.E.F.) and Faculty of Medicine and Center for Genomics and Bioinformatics (A.G., T.O.P.-A.), Pontificia Universidad Católica de Chile, 114-D Santiago, Chile; Department of Nephrology (E.T.L., M.d.P.H., M.P.R.), Hospital San Juan de Dios, Santiago, Chile; and Division of Endocrinology (D.G.R., C.E.G.-S.), University of Mississippi Medical Center and the G. V. Montgomery Veterans Affairs Medical Center, Jackson, Mississippi 39216

Address all correspondence and requests for reprints to: Carlos E. Fardella, M.D., Department of Endocrinology and Metabolism Faculty of Medicine, Pontificia Universidad Católica de Chile, Lira 85, 5th Floor Santiago, Chile. E-mail: cfardella{at}med.puc.cl.


   Abstract
Top
 Abstract
Introduction
 Patients and Methods
 Results
 Discussion
 References
 
The human microsomal 11ß-hydroxysteroid dehydrogenase type 2 (11ßHSD2) metabolizes active cortisol into cortisone and protects the mineralocorticoid receptor from glucocorticoid occupancy. In a congenital deficiency of 11ß-HSD2, the protective mechanism fails and cortisol gains inappropriate access to mineralocorticoid receptor, resulting in low-renin hypertension and hypokalemia. In the present study, we describe the clinical and molecular genetic characterization of a patient with a new mutation in the HSD11B2 gene. This is a 4-yr-old male with arterial hypertension. The plasma renin activity and serum aldosterone were undetectable in the presence of a high cortisol to cortisone ratio. PCR amplification and sequence analysis of HSD11B2 gene showed the homozygous mutation in exon 4 Asp223Asn (GAC->AAC) and a single nucleotide substitution C->T in intron 3. Using site-directed mutagenesis, we generated a mutant 11ßHSD2 cDNA containing the Asp223Asn mutation. Wild-type and mutant cDNA was transfected into Chinese hamster ovary cells and enzymatic activities were measured using radiolabeled cortisol and thin-layer chromatography. The mRNA and 11ßHSD2 protein were detected by RT-PCR and Western blot, respectively. Wild-type and mutant 11ßHSD2 protein was expressed in Chinese hamster ovary cells, but the mutant enzyme had only 6% of wild-type activity. In silico 3D modeling showed that Asp223Asn changed the enzyme’s surface electrostatic potential affecting the cofactor and substrate enzyme-binding capacity. The single substitution C->T in intron 3 (IVS3 + 14 C->T) have been previously reported that alters the normal splicing of pre-mRNA, given a nonfunctional protein. These findings may determine the full inactivation of this enzyme, explaining the biochemical profile and the early onset of hypertension seen in this patient.


   Introduction
Top
 Abstract
 Introduction
Patients and Methods
 Results
 Discussion
 References
 
THE 11ß-HYDROXYSTEROID DEHYDROGENASES (11ßHSD) are microsomal enzymes that interconvert the active steroids, cortisol and corticosterone, to their inactive metabolites, cortisone and 11-dehydrocorticosterone, respectively. There are at least two 11ßHSDs; the type 1 enzyme is expressed predominantly in glucocorticoid target tissues and the type 2 enzyme is expressed in mineralocorticoid target tissues (1).

The 11ßHSD2 is crucial in regulating mineralocorticoid action. Because the concentrations of cortisol in human blood are nearly 1000 times higher than that aldosterone, the discovery that glucocorticoids could bind to mineralocorticoid receptor posed the problem of how the aldosterone could exert specific and separate action from cortisol. It is now generally agree that 11ßHSD2 metabolizes active cortisol in cortisone and protects the mineralocorticoid receptor from glucocorticoid occupancy and thus defends the mineralocorticoid receptor from being overwhelmed by glucocorticoids (2).

The 11ßHSD2 enzyme is most abundantly expressed in tissues such as kidney and colon but is also expressed in pancreas, placenta, prostate, and gonads (3, 4). The enzyme catalyzes only the oxidase reaction (cortisol to cortisone), uses NAD+ as a cofactor, and has a low Michaelis-Menten constant (Km; 10–100 nM) (5, 6). Thus, 11ßHSD2 found in the renal collecting ducts possesses all the features required to protect the mineralocorticoid receptor from occupancy by endogenous glucocorticoids: location in mineralocorticoid target cells, very high affinity for its substrate, and an ability to reduce steroids drastically to irreversible dehydrogenation. For these reasons, when there is a congenital absence of 11ßHSD2 (3) or the enzyme’s activity is inhibited by licorice (7) or carbenoxolone (8), the protective mechanism fails and cortisol gains inappropriate access to mineralocorticoid receptor, resulting in hypertension and hypokalemia.

The human HSD11B2 gene is in chromosome 16q22, consists of five exons spanning about 6.2 kb, and encodes a protein of 405 amino acids, with a predicted molecular mass of 42 kDa, which is only 14% identical to the type I enzyme (4, 9). The 11ßHSD2 belongs to short-chain dehydrogenase/reductase family, which had a 15–30% sequence identity among them. However, the members of the family share a great similarity in their tertiary structures. The folding pattern of these proteins is a combination of {alpha}-helix and ß-sheets. Two important regions in the 11ßHSD2 are the cofactor-binding site (Gly-XXX-Gly-X-Gly motif) and steroid-binding site (Tyr-XXX-Lys motif). Initial modeling of the enzyme was performed with human 17 estradiol dehydrogenase and glucose dehydrogenase (Bacillus megaterium) whose tertiary structures correspond to patterns of the short-chain dehydrogenase/reductase family (4, 10, 11).

The syndrome of apparent mineralocorticoid excess (AME) is due to inactivating mutations in the HSD11B2 gene (5, 6). It is a rare disorder with an autosomal recessive inheritance and characterized by childhood onset of hypertension, hypokalemic alkalosis, and low plasma renin and aldosterone levels (12, 13, 14). This syndrome is also characterized by a high plasma cortisol to cortisone ratio or a high urinary tetrahydrocortisol plus allotetrahydrocortisol to tetrahydrocortisone (THF+aTHF/THE) ratio. Serum cortisol concentrations alone do not aid the diagnosis, although the plasma cortisol half-life is increased (13, 15, 16). In this study we described the clinical and molecular characterization of a patient with two homozygous mutations in the HSD11B2 gene, who associated the typical phenotype found in the syndrome of AME.


   Patients and Methods
Top
 Abstract
 Introduction
 Patients and Methods
Results
 Discussion
 References
 
Patients

A 4-yr-old Chilean male was seen by one of us at the age of 3 yr. He was presented with increased thirst, polyuria, failure to thrive, height and weight less than the third percentile, hypertension (140/90 mm Hg), hypokalemia (serum potassium, 3.0 mEq/liter), and bilateral nephrocalcinosis. Plasma renin activity (PRA) and serum aldosterone (SA) were undetectable. Serum cortisol was normal (7.7 µg/dl), with a low cortisone value (0.53 µg/dl; normal value, 3.28 ± 1.09) in the presence of a high serum cortisol to cortisone (F/E) ratio of 14.5 (normal value, 2.8 ± 1.1). The patient was the only child of a 16-yr-old woman. The father and grandparents were unknown, and the mother refused to provide any information about the father. The patient and his mother came from a small and isolated village in northern Chile. The mother was normotensive and her PRA (3.1 ng/ml·h), SA (6.3 ng/dl), and potassium (4.0 mEq/liter) were normal, but the F/E ratio was slightly high (5.9). Human kidney proteins were obtained from the cortical region of renal tissue obtained from a biopsy of a healthy patient prepared for renal transplant. Informed consent was obtained from all participants in this study according to the guidelines of the Declaration of Helsinki, and the protocol approved by the Research Committee of the School of Medicine at Pontificia Universidad Católica de Chile.

Biochemical methods profile

SA was measured by RIA using a commercial kit (Diagnostic Products, Los Angeles, CA). Intra- and interassay variation for SA were 5.1% and 7.1%, respectively, and the normal range was 1–16 ng/dl. The PRA was determined as previously described (17), its intra- and interassay variations were 6.1% and 8.2%, respectively, and the normal range was 1–2.5 ng/ml·h (18). The lower limit of PRA determination was 0.1 ng/ml·h (19). Steroids were extracted with methane-dichloride. Cortisol was measured by RIA and cortisone by ELISA using highly specific antibody antihuman cortisone. Cortisol and cortisone samples were also measured by HPLC to confirm the values. Samples were analyzed by liquid chromatograph Waters 441 equipped with a reverse-phase column µBondapack C-18 (Waters, Milford, MA). Samples and steroids mixtures (containing known amounts of metabolites to be measured) were analyzed to 254 nm. HPLC mobile phase consists in isocratic gradient methanol:water (60:40) with 1% tetrahydrofuran (Fischer Chemicals, Pittsburgh, PA), flow rate 1.2 ml/min, and 1500 {psi} internal pressure. Retention times for cortisone, cortisol, and 6{alpha}-methylprednisolone (internal standard; Steraloids, Newport, RI) were 5.6, 6.7, and 9.2 min, respectively. Sensitivity of the chromatographic method for cortisone and cortisol was 0.5 µg/dl.

Analysis of genomic DNA

Genomic DNA of the patient and his mother was isolated from peripheral leukocytes. PCR amplification of five exons of HSD11B2 gene was performed in three segments using the oligonucleotides primers shown in Table 1Go. Cycling conditions were 2 min at 94 C and 30 cycles of 1 min at 94 C, 1 min 30 sec at 60 C and 2 min at 72 C, and final extension 7 min at 72 C. Amplified gene fragments were purified in low-melting-point agarose and purified with Wizard PCR preps (Promega Corp., Madison, WI). Sequence analysis of the HSD11B2 gene was performed by fluorescent dideoxy chain terminator method in ABI Prism-377 DNA sequencer (Applied Biosystems, Foster City, CA). Sequences were matched with the published HSD11B2 gene sequence (GI 9989705) with the BLAST software (20). Restriction analysis with the BsmFI enzyme was performed to determinate the mutation haplotype of the patient and his mother. BsmFI recognizes and cuts the sequence GGGGACN14/N, which occurs only in the wild-type allele.


View this table:
[in this window]
[in a new window]
  		Table 1. Oligonucleotide primers (5'->3') used for PCR amplification of HSD11B2 gene

 
Site-direct mutagenesis and transient transfection

Full-length human HSD11B2 complementary DNA (GI 4504498) was cloned in a pCR3 expression vector (Invitrogen, Carlsbad, CA). The 11ßHSD2 Asp223Asn mutation in HSD11B2 was generated with the QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) using the following primers: GGGAGCCCAGCGGGGAACATGCCATATCCG (sense) and CGGATATGGCATGTTCCCCGCTGGGC-TCCC (antisense) (italicized base indicates the changed one). Mutant clones were screened by amplifying the mutation-flanking region by PCR with the following primers: (h-11HSD2-S-614 AGGCCACAATGAAGTAGTTGCT and h-11HSD2-AS-858 GTTCACAGCTGAATGTGTCCAT) and Advantaq Plus DNA polymerase (CLONTECH Laboratories, Inc., Palo Alto, CA), followed by enzymatic digestion with BslI. The fragment pattern was analyzed by electrophoresis in 4% metaphor agarose. The mutagenized cDNA was sequenced in its entirety to confirm the mutation and ensure that no other bases had been changed. Chinese hamster ovary K1 (CHO-K1) cells, grown on {alpha}MEM supplemented with 10% fetal bovine serum were split 1:16 and transferred to 6-well plates. Subsequently, 1–5 x 105 CHO-K1 cells were transfected with 3 µg plasmid DNA using Lipofectamine PLUS (Invitrogen) and grown in serum-free media for 3 h. The media were replaced with complete media and cells cultured for an additional 18 h before being subjected to the experimental protocols described below.

RT-PCR of HSD11B2 mRNA

Total RNA was extracted with TRIZOL LS reagent (Invitrogen). RNA (3 µg) was reverse transcribed using the SuperScript II kit (Invitrogen). Transfection efficiency was verified by RT-PCR within the exponential phase of the reaction, as described previously (21, 22), with the h-11HSD2-S614 and h-11HSD2-AS-858 primers.

11ßHSD2 immunodetection

Western blot analysis was performed with rabbit immunopurified polyclonal antiserum (anti-h11ßHSD2) in 1:2000 dilution, donated by Drs. Jonathan Seckl and Roger Brown (Edinburgh University, Edinburgh, UK) Briefly, 40 µg total proteins from the transfected and nontransfected cells, and 10 µg of the human kidney homogenate proteins were denatured and electrophoresed in 12% SDS-PAGE 2 h at 90 V and transferred to polyvinylidene fluoride membranes for 45 min at 100 V. Membranes were blocked with nonfat milk and incubated with polyclonal antiserum raised against human 11ßHSD2 for 18 h at 4 C, washed, and finally developed with anti-IgG-rabbit-horseradish-peroxidase (Bio-Rad Laboratories, Inc., Hercules, CA) (1:3000) using a chemiluminescent detection kit (Perkin-Elmer, Norwalk, CT).

11ßHSD2 enzyme activity assays

11ßHSD2 activity was analyzed by incubating transfected CHO cells with variable concentrations of [3H]-cortisol for 30 min and 2 h. Steroids were extracted and analyzed by thin-layer chromatography (TLC) in Silicagel 60 F-254 (Merck, Darmstadt, Germany), with a solvent mixture of hexane:ethylacetate (50:50). TLC was exposed to autoradiography films at -80 C for 1 wk and then developed to localize the standards and sample migration spots. Cortisol or cortisone migration spots on TLC plates were scrapped and extracted with isopropyl alcohol, and then activities of radiolabeled steroids were determined by scintillation spectrometry. To determinate the apparent kinetics parameters, Km, and maximal velocity (Vmax), whole CHO cells were incubated 30 min at 37 C with 2, 5, 10, 50, and 100 nM [3H]-cortisol and analyzed by Lineweaver-Burk plot (Hyper.exe version 1.02a; JS Esterby, Liverpool, UK). Cells were incubated for times (30 min) that resulted in less than 20% substrate conversion to ensure first-order kinetics as described previously (21).

Sequence alignment and protein modeling

11ßHSD2 sequence alignment was performed with the Vector NTI V.7.1 software (23, 24, 25) using human 17 estradiol dehydrogenase as query protein. Modeling of the core region (residues 80–327 San Diego, CA) was performed using Modeler from Insight II software (Accelrys Inc., San Diego, CA) in a Silicon Graphics Origin 200 biprocessed server (Silicon Graphics, Mountain View, CA). The tertiary structure of 11ßHSD2 was manually corrected according to second structure consensus patterns, transferring coordinates for conflict regions from a previously generated 11ßHSD2 model, built from glucose dehydrogenase (Bacillus megaterium) structure. Model for transmembrane (TM) region (residues 1–80) gave a 3{alpha}-helix motif, which was corrected using the N-terminal of sintaxine 1A template. Core and TM region were independently modeled and manually assembled. The obtained structure was used as model for new coordinate assignment iteration until reaching the final structure (residues 1–327). The C-terminal region (residues 328–405) was not modeled. Mutant design methodology was substitution of Asp223 to Asn223 in the proposed model. Docking assays were performed with only core models, using natural cofactor NAD+ and substrate cortisol. We defined a 5 Å radius around the substrate’s atoms placed at binding sites vicinity in which it all were mobiles. Reaction mechanism used was sequentially ordered, first cofactor and then substrate. Energy minimization for docking assays of enzyme cofactor and subsequently enzyme-cofactor-substrate was performed during 15,000 iterations using the conjugate gradient method and consistent valence force field.


   Results
Top
 Abstract
 Introduction
 Patients and Methods
 Results
Discussion
 References
 
Clinical studies

The patient displayed typical features of AME such as low renin hypertension, polyuria, polydypsia, hypokalemia, failure to thrive, and nephrocalcinosis. PRA and SA were significantly decreased, indicating a suppression of the renin-aldosterone axis. Evidence of an impaired metabolism of serum cortisol to cortisone was given by the diminished amounts of serum cortisone and the increased F/E ratio. Treatment of the patient with spironolactone (25 mg/d) normalized the blood pressure (110/70 mm Hg) and electrolytes and improved growth progression. The heterozygous mother was normotensive and had no features of AME, except by the slightly high F/E ratio.

Molecular studies

Sequencing analysis of the HSD11B2 gene of the affected child revealed a homozygous single substitution C->T in intron 3 (IVS3 + 14 C->T; nt 7279) and a homozygous nucleotide change in the second codon of exon 4 (GAC->AAC, nt 7375) as shown in Fig. 1Go. This nucleotide change corresponds to a novel mutation that results in an amino acid change from Asp223 to Asn223. Sequencing analysis of the mother showed a heterozygous haplotype for both mutations. To confirm the Asp223Asn mutation, we performed a restriction analysis using the BsmFI enzyme in the patient, mother, and 20 normotensive subjects. As shown in Fig. 2Go, the patient had only the noncleaved 1100-bp fragment, indicating that the mutations are in both alleles. The mother showed the original 1100-bp fragment and two other bands of 810 and 290 bp, confirming that she was heterozygous for the exonic mutation. Enzymatic restriction in normotensives showed only the expected 810- and 290-bp fragments, indicating only the normal sequence (only two representative subjects, NT1 and NT2, are shown). We also studied several individuals with essential hypertension, and we were unable to detect the Asp223Asn mutation or the substitution in intron 3 (data not shown).



View larger version (46K):
[in this window]
[in a new window]
  		Figure 1. Sequencing analysis of HSD11B2 gene in the patient (A) and a control (B). The intron 3 electropherogram shows the homozygous transition C->T (nt 7279). The exon 4 sequence shows the homozygous nucleotide change GAC->AAC (nt 7375, underlined) that determinate the Asp223Asn mutation.

 


View larger version (62K):
[in this window]
[in a new window]
  		Figure 2. A 2% agarose gel of PCR product digested with BsmFI from patient (lane 1), mother (lane 2), and two normotensive controls (NT; lanes 3 and 4) is shown. Details for restriction analysis are described in Patients and Methods.

 
Expression studies

To determine the functional consequences of the Asp223Asn mutation, we constructed expression vectors to produce the normal and mutant 11ßHSD2 proteins in suitable mammalian cells. These vectors were used to transfect CHO cells, which do not normally express 11ßHSD2. RT-PCR analysis indicated comparable expression of HSD11B2 RNA from both constructs (data no shown). Western immunoblotting analysis of transfected CHO cells with either wild-type or mutant Asp223Asn vectors showed the presence of a protein approximately of 42 kDa (Fig. 3Go), but less immunoreactivity was observed in lysates from cells transfected with mutant construct. By contrast, CHO cells transfected with the pCR3 vector alone and untransfected cells had no immunologically identifiable 11ßHSD2 protein.



View larger version (35K):
[in this window]
[in a new window]
  		Figure 3. Western blot analysis of homogenates from CHO transfected cells. The immunoblot shows in wild-type (WT), Asp223Asn mutant (Mut-Asn223), and the normal human kidney (HK; positive control) the presence of immunoreactive protein of identical molecular weight (42 kDa). By contrast, the pCR3 vector alone (pCR3) and untransfected cells (UC, negative control) had no immunologically identifiable 11ß HSD2 protein.

 
To test the enzymatic activity of the Asp223Asn mutation, CHO cells transfected with 11ßHSD2 wild-type and mutant Asp223Asn cDNA were incubated with radiolabeled cortisol. After 2 h of incubation, steroids in the culture medium were extracted and analyzed by TLC. Metabolization of 3H-cortisol was observed only in CHO cells transfected with wild-type HSD11B2 cDNA (Fig. 4Go). Apparent kinetics parameters measured at 30-min incubation with 3H-cortisol in wild-type enzyme were Vmax of 0.23 ± 0.02 pmol/min per dish and Km of 26.1 nmol/liter. Activity of mutant Asp223Asn was approximately 6% of wild-type activity, similar to that found in the vector alone and untransfected cells.



View larger version (43K):
[in this window]
[in a new window]
  		Figure 4. TLC of [3H]-cortisol and [3H]-cortisone. 11ß HSD2 activity was analyzed by incubating transfected CHO cells with [3H]-cortisol. Steroids were extracted and analyzed by TLC. In a representative figure, autoradiography of TLC of CHO cells incubated with 100 nM 3H-cortisol for 2 h. WT, Wild-type; MUT, Asp223Asn mutant; UC, untransfected cells.

 
11ßHSD2 modeling

We obtained a structure for wild-type protein (core and TM region, residues 1–327), which computes a potential energy of 1642.17 Kcal/mol per Angstrom (Fig. 5Go). Model validation was performed using a 3D structures database (Profiles-3D, Insight II; Accelrys Inc.). A high score obtained from the11ßHSD2 folding pattern (residues 1–327) validated the proposed tertiary structure. In docking assays, NAD+ binds wild-type protein interacting with the cofactor-binding motif, in this case Gly-Cys-Asp-Ser-Gly-Phe-Gly, having a favorable reaction energy (-212.38 Kcal/mol per Angstrom). Distances for Gly (89)-P1NAD, Gly (93)-C17NAD, and Gly (95)-C18NAD were 4.49, 4.88, and 5.07 Å, respectively. Hydrogen bonding against Asp (91), Ser (92), and Phe (95) of the same motif suggests a right-binding site orientation. Cortisol docking assays converged in wild-type 11ßHSD2, in which cortisol interacts with the key atoms in the catalytic domain, Tyr (232)-H11-F and F-C9-C2-NAD, at distances of 2.49 and 4.57 Å, respectively. We assumed that energy contributions of the N-terminal region (3{alpha}-helix motif) and C-terminal region were not relevant for processes occurring at the active site. In the mutant 11ßHSD2, the docking assays for NAD+ and cortisol were not successful in spite of the folding model pattern similar to those found in the wild-type enzyme (root mean square deviation = 0.3506 Å/res) (Fig. 6AGo). In the mutant, the binding site volumes for NAD+ and cortisol were smaller than those found in the wild-type enzyme (416 vs. 512 Å3, and 321 vs. 414 Å3, respectively). The calculated surface volume for NAD+ and cortisol were 420 and 297 Å3, respectively. NAD+ would be incapable of entering into the cofactor-binding site of mutant, owing to its size and the compression of the binding pocket. Surface electrostatic potential energy was higher in the mutant than the wild-type enzyme (816 vs. 718 Boltzmann constant of temperature per electrical charge, respectively), which is reflected in the new surface charge distribution (Fig. 6BGo).



View larger version (39K):
[in this window]
[in a new window]
  		Figure 5. Tridimensional model for wild-type 11ß HSD2. Figure shows in a ribbon display the core region (left) and 3{alpha}-helix of the TM domain (right) of wild-type 11ß HSD2. In sticks appears the catalytic domain Y232GTSK (236) (Tyr in green and Lys in sky blue inside the core). In purple, Asp (223) oriented to the outside of the core.

 


View larger version (67K):
[in this window]
[in a new window]
  		Figure 6. Docking and electrostatic potential in wild-type and mutant enzyme model. A, Folding patterns were similar between wild-type (left) and mutant models (right). Docking was unsuccessful for mutant. B, Asp223Asn mutation decreases binding site volumes and produces enzyme’s surface electrostatic potential compressing and impairing NAD+ and cortisol-binding sites. The NAD+-binding site in either wild-type or mutant 11ß HSD2 are shown (B, green arrows). Surface electrostatic potential energy (Boltzmann constant of temperature per electrical charge) is shown in spectrum chart (B, bottom right). See Results for more details.

 

   Discussion
Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
References
 
In this study, the patient clinical data support the presence of a deficiency in the 11ßHSD2 activity, causing AME including low renin hypertension, hypokalemia, and hypoaldosteronemia with an increased serum F/E ratio. Nephrocalcinosis and failure to thrive are also classical findings in patients with AME. The heterozygous mother was normotensive with normal PRA and SA values. However, her serum F/E ratio was slightly high, suggesting a mild defect in peripheral cortisol-to-cortisone metabolism. Similar findings have been previously reported in heterozygous parents in whom the slight reduction in cortisol-to-cortisone metabolism, attributed to either haplotype insufficiency or a dominant negative effect of the mutation (26, 27). The absence of clinical and biochemical evidence of 11ßHSD2 deficiency in heterozygous subjects have been also described in family members of affected patients (22).

The patient’s molecular analysis demonstrated the presence of two homozygous substitutions, the C->T change in intron 3 and the GAC->AAC mutation in exon 4 that results in the nonconservative amino acid change Asp223Asn. This is a novel mutation that would be translated to an enzyme with almost no dehydrogenase activity, impairing the conversion of cortisol to cortisone (approximately 6% of normal activity). Apparent kinetics parameters observed in wild-type enzyme were consistent with reports using similar systems (16, 21). Kinetics parameters, Km and Vmax, could not be calculated for the mutant enzyme owing to its very low activity.

Hydropathicity plots and tertiary structure shows that 11ßHSD2 has three successive hydrophobic segments (3{alpha}-helix) of approximately 20 amino acids each in the N-terminal region before the cofactor-binding domain. These could function as TM segments anchoring the enzyme to the membrane of the endoplasmic reticulum (13). In the 11ßHSD2 structure modeling, all measured cofactor and substrate distances are at minimal energy position for wild-type docking, which is in agreement with the proposed catalytic mechanism (3, 13), suggesting an adequate spatial disposition for atoms involved in the catalysis of the cortisol hydroxyl group (Fig. 6AGo, left). Despite the mutant enzyme folding pattern similarity to the wild-type model, its modeling revealed significant changes, including energetic (changes in the enzyme’s surface electrostatic potential) and geometric (NAD+ and cortisol-binding site compression) ones. Therefore, we hypothesized that both kinds of changes, energetic and geometric, impair the effective binding of NAD+ and subsequently of cortisol to the catalytic domain, gating the enzyme inactivity.

The C->T change in intron 3 had been previously described by Mune et al. (5). This single base change, 14 bp distal to the exon-intron junction, causes skipping of exon 4, in which the sequence that codifies for the catalytic domain are localized, resulting in an inactive 11ßHSD2 enzyme. This mutation was postulated not to directly alter the splice donor or acceptor sites but induce significant change in the secondary structure of the pre-mRNA that may affect the splicing process (5). Thus, if some mutated RNA is translated, it will carry on the exonic mutation Asp223Asn that, as we just demonstrated, almost abolishes the enzymatic activity. Thus, in this patient both mutations cause the severe AME phenotype observed.

To date, more than 20 mutations have been identified in the 11ß-HSD2 gene, resulting in a functional impairment of the enzyme activity (13, 14, 28, 29, 30, 31, 32, 33, 34, 35). Almost all mutations described have been localized between exons 3 and 5 of the HSD11B2 gene, with the exception of the L114,{Delta}6nt mutation (26). In the South American population, only the homozygous Arg213Cys mutation had been reported. This mutation was found in two Chilean siblings with nonconsanguineous heterozygous parents (5, 34). Our patient is the second case described in Chile, but in this patient the possibility of consanguinity cannot be discarded because the patient comes from a small and isolated village in northern Chile and the mother refused to provide any information about the father and other family members.

The impaired activity of 11ßHSD2 was demonstrated in vivo by a high serum F/E ratio, which was several times higher than those found in a normotensive group with normal renin and serum aldosterone (Carvajal, C., L. Mosso, and C. Fardella, unpublished data). Measurement of cortisol and cortisone was performed by RIA and ELISA, respectively, and confirmed by HPLC; the correlation between both measurements was 0.92 and 0.77 (P < 0.05), respectively. There are only a few reports that use the serum cortisol and cortisone values as screening of 11ßHSD2 deficiency (22, 36, 37). In the study by Morineau et al. (22), the serum F/E ratio in affected patients was 3–5 times higher than that found in normotensive volunteers. This value is similar to those found in our patient, which was close to 5 times higher than that found in a similar control population. There are no reports comparing the classical urinary THF+aTHF/THE ratio with the serum F/E ratio. However, unpublished data (Ferrari, P.) suggest that THF+aTHF/THE ratio is quite similar to serum F/E ratio.

In summary, we report a case of severe hypertension with an AME phenotype that associates a new homozygous Asp223Asn mutation that abolished the enzymatic activity of 11ßHSD2. Likewise, new research tools, such as in silico assays demonstrated that the Asp223Asn mutation produces a disruption in the surface electrostatic potential and geometrical changes that could explain the impairment in cofactor binding in 11ßHSD2 enzyme and then the loss of enzyme activity. The finding of an intronic nucleotide transition in our patient corresponds to the already known change of C->T in intron 3 that cause skipping of exon 4, and impairing of Asp223Asn mutation can be expressed in the mutant enzyme. Both homozygous mutations induce important changes in the catalytic domain and cofactor binding, resulting in an inactive 11ßHSD2 enzyme, which explains the biochemical profile and early onset of hypertension seen in this patient.


   Acknowledgments
 
We appreciate the gift of the human 11ßHSD2 antiserum from Drs. Jonathan Seckl and Roger Brown (Edinburgh University, Edinburgh, UK).


   Footnotes
 
This work was supported by Chilean Grant FONDECYT 1011035.

Abbreviations: 11ßHSD2, 11ß-Hydroxysteroid dehydrogenase type 2; AME, apparent mineralocorticoid excess; CHO-K1, Chinese hamster ovary K1; F/E, cortisol to cortisone; Km, Michaelis-Menten constant; NAD+, nicotinamide adenine dinucleotide (oxidized form); PRA, plasma renin activity; SA, serum aldosterone; THF+aTHF/THE, tetrahydrocortisol plus allotetrahydrocortisol to tetrahydrocortisone; TLC, thin-layer chromatography; TM, transmembrane; Vmax, maximal velocity.

Received December 4, 2002.

Accepted February 16, 2003.


   References
Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 

  1. Fardella CE, Miller WL 1996 Molecular biology of mineralocorticoid metabolism. Annu Rev Nutr 16:443–470[CrossRef][Medline]
  2. Funder JW, Pearce PT, Smith R, Smith I 1988 Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science 242:583–585[Abstract/Free Full Text]
  3. Penning, TM 1997 Molecular endocrinology of hydroxysteroid dehydrogenases. Endocr Rev 18:281–305[Abstract/Free Full Text]
  4. Albiston AL, Obeyesekere VR, Smith RE, Krozowski ZS 1994 Cloning and tissue distribution of the human 11ß-hydroxysteroid dehydrogenase type II enzyme. Mol Cell Endocrinol 105:R11–R17
  5. Mune T, Rogerson FM, Nikkila H, Agarwal AK, White PC 1995 Human hypertension caused by mutations in the kidney isozyme of 11 beta-hydroxysteroid dehydrogenase. Nat Genet 10:394–399[CrossRef][Medline]
  6. Wilson RC, Krozowski ZS, Li K, Obeyesekere VR, Razzaghy-Azar M, Harbison MD, Wei JQ, Shackleton CH, Funder JW, New MI 1995 A mutation in the HSD11B2 gene in a family with apparent mineralocorticoid excess. J Clin Endocrinol Metab 80:2263–2266[Abstract]
  7. Brown RW, Chapman KE, Edwards CRW, Seckl JR 1993 Human placental 11 beta-hydroxysteroid dehydrogenase: evidence for and partial purification of a distinct NAD+-dependent isoform. Endocrinology 132:2614–2621[Abstract]
  8. Rusvai E, Náray-Fejes-Tóth A 1993 A new isoform of 11ß -hydroxysteroid dehydrogenase in aldosterone target cells. J Biol Chem 268:1017–1020[Abstract/Free Full Text]
  9. Agarwal AK, Rogerson FM, Mune T, White PC 1995 Gene structure and chromosomal localization of the human HSD11K gene encoding the kidney (type 2) isozyme of 11ß-hydroxysteroid dehydrogenase. Genomics 29:195–199[CrossRef][Medline]
  10. Krozowski Z 1994 The short-chain alcohol dehydrogenase superfamily: variations on a common theme. J Steroid Biochem Mol Biol 51:125–130[CrossRef][Medline]
  11. Jornvall H, Persson B, Krook M, Atrian S, Gonzalez-Duarte R, Jeffery J, Ghosh D 1995 Short-chain dehydrogenases/reductases (SDR). Biochemistry 34:6003–6013[CrossRef][Medline]
  12. Ulick S, Levine LS, Gonzalez P 1979 A syndrome of apparent mineralocorticoid excess associated with defects in the peripheral metabolism of cortisol. J Clin Endocrinol Metab 49:757–764[Abstract]
  13. White PC, Mune T, Agarwal AK 1997 11ß-hydroxysteroid dehydrogenase and the syndrome of apparent mineralocorticoid excess. Endocr Rev 18:249–324
  14. Stewart PM, Krozowski ZS 1999 11ß-hydroxysteroid dehydrogenase. Vitam Horm 57:249–324[Medline]
  15. Ferrari P, Lovati E, Frey F 2000 The role of the 11ß-hydroxysteroid dehydrogenase type 2 in human hypertension. J Hypertens 18:241–248[CrossRef][Medline]
  16. Wilson RC, Dave-Sharma S, Wei J-Q, Obeyesekere VR, Li K, Ferrari P 1998 A genetic defect resulting in mild low-renin hypertension. Proc Natl Acad Sci USA 95:10200–10205[Abstract/Free Full Text]
  17. Kreft C, Menard J, Corvol P 1979 Value of renin measurement, saralasin test, and acelretolol treatment in hypertension. Kidney Int 15:176–183[Medline]
  18. Sealey JE, James GD, Laragh JH 1995 Interpretation and guidelines for the use of plasma and urine aldosterone and plasma angiotensin II, angiotensinogen, prorenin, peripheral, and renal vein renin tests. In: Laragh JH, Brenner BM, eds. Hypertension: pathophysiology, diagnosis, and management. New York: Raven Press; 1953–1967
  19. Montero J, Soto J, Fardella C, Foradori A, Valdés G 1998 [Measurement of low levels of plasma renin activity. A methodological improvement]. Rev Med Chil 126:151–154[Medline]
  20. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ 1990 Basic local alignment search tool. J Mol Biol 215:403–410[CrossRef][Medline]
  21. Scott Nunez B, Rogerson F, Tomoatsu M, Igarashi, Y, Nakagawa, Y, Philipov G 1999 Mutants of 11beta-hydroxysteroid dehydrogenase (11-HSD2) with partial activity: improved correlations between genotype and biochemical phenotype in apparent mineralocorticoid excess. Hypertension 34:638–642[Abstract/Free Full Text]
  22. Morineau G, Marc JM, Boudi A 1999 Genetic, biochemical, and clinical studies of patients with A328V or R213C mutations in 11ßHSD2 causing apparent mineralocorticoid excess. Hypertension 34:435–441[Abstract/Free Full Text]
  23. Informax, Inc. 2002 Vector NTI Suite version 7. Frederick, MD: Informax Inc.; www.informaxinc.com
  24. Needleman SB, Wunsch CD 1970 A general method applicable to the search for similarities in the amino acid sequence of two proteins. Mol Biol 48:443–453
  25. Gribskov M, McLachlan AD, Eisenberg D 1987 profile analysis: detection of distantly related proteins. Proc Natl Acad Sci USA 84:4355–4358[Abstract/Free Full Text]
  26. Odermatt A, Dick B, Arnold P Zaehner T, Plueschke V, Deregibus M, Repetto H, Frey B, Frey F, Ferrari P 2001 A mutation in the cofactor-binding domain of 11ß-hydroxysteroid dehydrogenase type 2 associated with mineralocorticoid hypertension. J Clin Endocrinol Metab 86:1247–1252[Abstract/Free Full Text]
  27. Li A, Li KXZ, Marui S, Krozowski ZS, Batista MC, Whorwood CB 1997 Apparent mineralocorticoid excess in a Brazilian kindred: hypertension in the heterozygote state. J Hypertens 15:1397–1402[CrossRef][Medline]
  28. Obeyesekere V, Ferrari P, Andrews RK, Wilson RC, New MI, Funder JW 1995 The R337C mutation generates a high Km 11ß-hydroxysteroid dehydrogenase type II enzyme in a family with apparent mineralocorticoid excess. J Clin Endocrinol Metab 80:3381–3383[Abstract]
  29. Ferrari P, Obeyesekere VR, Li K, Wilson RC, New MI, Funder JW, Krozowski ZS 1996 Point mutations abolish 11ß-hydroxysteroid dehydrogenase type II activity in three families with the congenital syndrome of apparent mineralocorticoid excess. Mol Cell Endocrinol 119:21–24[CrossRef][Medline]
  30. Ferrari P, Obeyesekere VR, Li K, Andrews RK, Krozowski ZS 1996 The 11ßhydroxysteroid dehydrogenase type II enzyme: biochemical consequences of the congenital R337C mutation. Steroids 61:197–200[CrossRef][Medline]
  31. Stewart PM, Krozowski ZS, Gupta A, Milford DV, Howie AJ, Sheppard MC 1995 Human hypertension in the syndrome of apparent mineralocorticoid excess due to mutation of the 11ß-hydroxysteroid dehydrogenase type 2 gene. Lancet 1:88–91
  32. Kitanaka S, Katsumata N, Tanae A, Hibi I, Takeyama K, Fuse H 1997 A new compound heterozygous mutation in the 11ß-hydroxysteroid dehydrogenase type 2 gene in a case of apparent mineralocorticoid excess. J Clin Endocrinol Metab 82:4054–4058[Abstract/Free Full Text]
  33. Dave-Sharma S, Wilson RC, Harbison MD, Newfeld R, Azar MR, Krozowski ZS 1998 Examination of genotype and phenotype relationships in 14 patients with apparent mineralocorticoid excess. J Clin Endocrinol Metab 83:2244–2254[Abstract/Free Full Text]
  34. Rodriguez JA 2000 Syndrome of apparent mineralocorticoid excess caused by a deficiency of 11beta-hydroxysteroid dehydrogenase: clinical and genetic study in a Chilean family followed for 19 years. Rev Med Chil 128:17–26[Medline]
  35. Walker BR, Stewart PM, Shackleton CH, Padfield PL, Edwards CR 1993 Deficient inactivation of cortisol by 11 beta-hydroxysteroid dehydrogenase in essential hypertension. Clin Endocrinol 39:221–227[Medline]
  36. Morineau G, Boudi A, Barka A, Gourmelen M, Degeilh F, Hardy N, Al-Halnak A, Soliman H 1997 Radioimmunoassay of cortisone in serum, urine, and saliva to asses the status of the cortisol-cortisone shuttle. Clin Chem 43:1397–1407[Abstract/Free Full Text]
  37. Morineau G, Pascoe L, Marc JM, Caillette A, Krozowski Z, Corvol P, Fiet J 1997 A case of apparent mineralocorticoid excess caused by type 2 11 beta-hydroxysteroid dehydrogenase deficiency. Arch Mal Coeur Vaiss 90:1111–1115[Medline]



This article has been cited by other articles:


Home page
 J. Am. Soc. Nephrol.Home page
G. Morineau, V. Sulmont, R. Salomon, B. Fiquet-Kempf, X. Jeunemaitre, J. Nicod, and P. Ferrari
Apparent Mineralocorticoid Excess: Report of Six New Cases and Extensive Personal Experience
J. Am. Soc. Nephrol., November 1, 2006; 17(11): 3176 - 3184.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
C. A. O'Brien, D. Jia, L. I. Plotkin, T. Bellido, C. C. Powers, S. A. Stewart, S. C. Manolagas, and R. S. Weinstein
Glucocorticoids Act Directly on Osteoblasts and Osteocytes to Induce Their Apoptosis and Reduce Bone Formation and Strength
Endocrinology, April 1, 2004; 145(4): 1835 - 1841.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carvajal, C. A.
Right arrow Articles by Fardella, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carvajal, C. A.
Right arrow Articles by Fardella, C. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals