| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Molecular Medicine (A.P., A.O., H.N., N.M., S.Y.), Urology (S.T.), International Health and Radiation Research (V.S.), and Molecular Pathology (M.N.), and Division of Endothelial Cell Biology (S.K.), Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8523, Japan; and Department of Breast and Thyroid Surgery, Kawasaki Medical School (J.K.), Kurashiki 701-0192, Japan
Address all correspondence and requests for reprints to: Akira Ohtsuru, M.D., Ph.D., Department of Molecular Medicine, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan. E-mail: ohtsuru{at}net.nagasaki-u.ac.jp.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The c-ABL gene was initially identified as the cellular homolog of the transforming gene of Abelson murine leukemia virus (v-ABL) and subsequently shown to be expressed as a part of the chimeric BCR/ABL gene on the Philadelphia chromosome. c-ABL is a ubiquitous nonreceptor tyrosine kinase that is located in both the nucleus and cytoplasm and participates in the regulation of the cell cycle and of genotoxic stress response pathways (5, 6, 7, 8). c-ABL interacts with the retinoblastoma protein, whose hyperphosphorylation correlates with the release of c-ABL from a complex and activation of the c-ABL tyrosine kinase in S phase (9). The activity of c-ABL kinase contributes to MAPK activation induced by integrin or platelet-derived growth factor stimulation (10, 11). Importantly, fibroblasts lacking both c-ABL and p53 have a reduced growth rate in culture compared with fibroblasts lacking only p53 or with normal fibroblasts (12). In the light of these findings we hypothesized that inhibition of c-ABL activation might suppress the growth of p53-defective or mutated cancer cells.
The tyrosine kinase inhibitor, STI571, selectively suppresses the activity of ABL, platelet-derived growth factor receptor (PDGFR), and c-KIT (13). In chronic myelogenous leukemia (CML), the proliferation and growth of BCR/ABL-expressing tumor cells can be blocked by STI571. In clinical trials, treatment with STI571 led to the remission of CML, with minimal side-effects (14).
The present study was therefore designed to examine whether STI571 can selectively suppress the proliferation of p53-defective or mutant anaplastic thyroid carcinoma cell lines as opposed to cell lines harboring wild-type p53. To clarify further the mechanism by which STI571 induces growth inhibition of p53-defective cell lines, we analyzed its effect on the expression of currently known STI571-sensitive tyrosine kinases and focused on changes in the cell cycle and in levels of some of its key mediators.
| Materials and Methods |
|---|
|
|
|---|
In this study, we used human anaplastic thyroid carcinoma cell lines FRO and ARO with, respectively, undetectable or mutant p53 in codon 273 (2). The human papillary carcinoma cell line NPA has p53 mutations in codons 223 and 226 (2), whereas TPC-1 and KTC-1 papillary thyroid carcinoma cell lines are wild type for p53 (15). Stable transfection with a vector expressing wild-type p53 was used to produce the 1F3 cell line from FRO cells (16). Cells were cultured in RPMI 1640 medium supplemented with 5% fetal bovine serum at 37 C in a humidified atmosphere with 5% CO2. Primary human thyroid cell cultures were established as described previously (17) and maintained in a 2:1 mixture of F-12 nutrient mixture and DMEM supplemented with 3% fetal bovine serum and penicillin-streptomycin (all reagents from Invitrogen/Life Technologies, Inc., Paisley, UK).
RT-PCR
Total RNA was extracted from thyroid carcinoma cell lines with Isogen (Wako, Tokyo, Japan) according to the manufacturers protocol. One microgram of total RNA was subjected to RT in the presence of random primers. PCR (35 cycles) was performed with the following primer pairs: PDGFR
(sense, gaacgtggtcaacctgttgg; antisense, aaagttgctcggcaggtcct; amplicon size, 413 bp), PDGFRß (sense, ctggccagagacatcatgca; antisense, ctgagtccacacgcatgcgt; amplicon size, 423 bp), c-ABL (sense, gcctcagggtctgagtgaag; antisense, agcagatactcagcggcatt; amplicon size, 309 bp), c-KIT (sense, tgacttacgacaggctcgtg; antisense, aaggagtgaacagggtgtgg; amplicon size, 327 bp), and PBGD (sense, tcctccctggagaagagcta; antisense, agtacttgcgctcaggagga; amplicon size, 534 bp) as a loading control. Total RNA from thyroid tissue was used as a positive control.
Cell growth assays
Cells were seeded at a density of 1 x 103 cells/well in 96-well microtiter plates. One day later (d 1), cells were treated with 1, 5, 10, 20, or 50 µM STI571 diluted in dimethylsulfoxide (DMSO) or 0.1% DMSO (control) in 100 µl fresh medium (six wells for each drug concentration). The cell number in each well was determined by means of water-soluble tetrazolium salt, 4-[-3(4-iodophenyl)-2-4-nitrophenyl]-2H-5-tetrazolio-1,3-benzene disulfonate (WST) assay (Cell Counting Kit; Wako, Tokyo, Japan) after 72 h of incubation. The IC50 values, defined as the concentrations of STI571 producing a 50% reduction in cell growth, were estimated by linear interpolation at r = 0.5. The kinetics of cell growth were examined using a cytometer as follows. Cells were seeded at a density of 0.5 or 0.1 x 105 cells/well in 12-well culture plates. One day later (d 1), they were given medium containing 10 µM STI571 or 0.1% DMSO and were counted on d 2, 3, 4, and 5. Both experiments were performed at least three times.
Western blotting analysis
Cell lysates were prepared in RIPA buffer [0.15 mM NaCl, 0.05 mM Tris-HCl (pH 7.2), 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 2 mM Na3VO4, 10 nm ocadaic acid, 40 µg/ml leupeptin, 40 µg/ml aprotinin, 0.5 mM phenylmethylsulfonyl fluoride] and resolved by SDS-PAGE (40 µg proteins/lane). After transfer onto nitrocellulose membranes (Pall Corp., Ann Arbor, MI), blots were probed with the appropriate antibodies. The antibodies used were anti-p21waf1 (Ab-1, Calbiochem, Darmstadt, Germany), anti-p27 (F-8, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anticyclin A (C88020, BD Biosciences, Mountain View, CA), anti-cyclin B1 (C23420, BD Biosciences), anticyclin-dependent kinase 1 (anti-CDK1)/Cdc2 (C12720, BD Biosciences), anti-cyclin D3 (C28620, BD Biosciences), anti-phospho-c-ABL (Tyr245, Cell Signaling Technology, Beverly, MA), anti-c-ABL (24-11, Santa Cruz Biotechnology, Inc.), anti-c-KIT (C-14, Santa Cruz Biotechnology, Inc.), anti-PDGFR
(C-20, Santa Cruz Biotechnology, Inc.), anti-PDGFRß (P-20, Santa Cruz Biotechnology, Inc.), antiextracellular signal-regulated kinase 1/2 (anti-ERK1/2; Cell Signaling Technology), anti-p-ERK (Cell Signaling Technology), and antiactin (C-11, Santa Cruz Biotechnology, Inc.). Detection was performed with an enhanced chemiluminescence kit (Amersham Life Sciences, Little Chalfont, UK). Immunoblotting experiments were performed at least twice.
In vitro kinase assay
ABL was immunoprecipitated from cell lysates using the indicated antibody. In vitro kinase assay was performed as described previously (18). Radiolabeled glutathione-S-transferase (GST)-Crk (substrate of c-Abl tyrosine kinase) was quantified using a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA).
Immunohistochemical staining of c-ABL and p53
The use of archived fixed tissue sections for immunohistological studies was approved by the ethics committee of Nagasaki University Hospital. Informed consent was obtained from each individual.
Immunohistochemistry was performed as described previously (19). Briefly, 4-µm sections of formalin-fixed, paraffin-embedded tissue were deparaffinized, heat antigen demasked (0.01 mol/liter citrate buffer, pH 6.0), and exposed to primary antibodies for 1 h at room temperature. The following antibodies were used: murine monoclonal anti-p53 antibody, clone DO-7 (DAKO Corp., Copenhagen, Denmark; dilution, 1:100) and murine monoclonal anti-c-ABL antibody (24-11, Santa Cruz Biotechnology, Inc.; dilution, 1:200). Bound antibodies were visualized with a biotin-conjugated secondary goat antimouse IgG/IgM F(ab)2 antiserum and peroxidase-conjugated streptavidin (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). The slides were examined by two independent observers who were not cognizant of the pathological or clinical data for the cases under investigation. For evaluation of p53 staining, we assessed four high-power fields (x400) with regard to the percentage of positively stained tumor cells. Tumors with more than 10% stained cells were assigned as strongly positive, and those with 10% or fewer stained cells were designated weakly positive, as previously described (19). The c-ABL immunostaining was semiquantified by means of a visual grading system in which staining intensity was categorized as grade 0, 1+, 2+, or 3+ according to the previously reported criteria (20). To simplify the correlation of c-ABL level with the histological features of the thyroid cancers, these groups were further classified into weakly positive (grade 0, grade 1+) and strongly positive (grade 2+, grade 3+) groups.
Cell cycle analysis
Subconfluent cells were incubated for 48 h in the presence of 10 µM STI571 or 0.1% DMSO. For flow cytometry, cells were fixed with 70% ethanol and washed with PBS. After preincubation with ribonuclease A (0.1 mg/ml, 30 min) at room temperature, they were stained with propidium iodide (25 µg/ml). Fluorescence was measured with a FACScan flow cytometer (BD Biosciences). The experiment was performed at least twice.
Mouse xenograft model
All mice were maintained at the Nagasaki University (Nagasaki, Japan) animal facility, and all animal experiments described in this study were conducted in accordance with the principles and procedures outlined in the Guide for the Care and Use of Laboratory Animals of Nagasaki University School of Medicine. Five million FRO cells suspended in RPMI 1640 were injected sc into the flanks of 8-wk-old female BALB/c
/
mice (Charles River Laboratories, Inc., Tokyo, Japan). Tumor sizes were measured every other day with calipers, and tumor volumes were calculated according to the formula: a2 x b x 0.4, where a is the smallest diameter, and b is the diameter perpendicular to a. After the tumors had reached at least 100 mm3, the mice were randomly assigned to experimental or control groups, five animals per group. STI571 solution in sterile water was injected ip daily for 2 wk at a dose of 50 mg/kg. Mice in the control group received injections of pure water. The body weight, feeding behavior, and motor activity of each animal were monitored as indicators of general health.
Statistical analysis
Data are presented as the mean ± SD unless otherwise specified. The t test and Mann-Whitney U test were used for comparisons between two groups for parametric and nonparametric data, respectively. Fishers exact test was used for analysis of immunohistological results. P < 0.05 is considered statistically significant.
| Results |
|---|
|
|
|---|
The effect of STI571 on five thyroid cancer cell lines and on primary cultures of human thyrocytes was measured by means of the standard WST assay. As shown in Fig. 1A
, the IC50 for the p53-mutant cell lines FRO, ARO, and NPA was significantly lower than that for the wild-type p53 cell lines TPC-1 and KTC-1 and for primary thyrocytes.
|
Expression of c-ABL, PDGFRs, and c-KIT
The tyrosine kinase activity of c-ABL, PDGFR, and c-KIT can be selectively inhibited by STI571 (14). To determine the possible targets of STI571 in thyroid cancer cells, we first examined the level of the mRNA of these genes by RT-PCR (Fig. 2A
). Expression of c-ABL mRNA was observed in all cell lines. A band corresponding to PDGFR
was visible in KTC-1, TPC-1, and NPA cells, but not in FRO and ARO. No expression of PDGFRß and c-KIT mRNA was detected in the ARO and FRO cell lines.
|
Immunohistological analysis of c-ABL and p53
To gain more information about c-ABL and p53 expression in different types of human thyroid tumors, we carried out immunohistochemical staining for these proteins in different types of surgically resected tumors (Fig. 3
). High expression of c-ABL (combined nuclear and cytoplasmic immunostaining) was detected in five of six (83%) anaplastic carcinomas, whereas a significantly smaller proportion [two of nine (22%) and one of eight (12%); P = 0.041 and P = 0.026, by Fishers exact test] was observed in follicular and papillary carcinomas (Table 1
). A low level of expression of c-ABL was observed in the normal tissue surrounding the tumor lesions and in cases of adenomatous goiter.
|
|
Phosphorylation of c-ABL and MAPK kinase activity
As shown in Fig. 4A
, ARO and FRO cells cultured in normal conditions have high levels of c-ABL and its Tyr245 phosphorylated form, which has been previously associated with significant activation of c-ABL kinase activity (21). STI571 in concentrations up to 50 µM did not appreciably affect the level of c-ABL protein in these cell lines over the time interval examined. However, 12 h of continuous treatment did decrease the tyrosine phosphorylation of c-ABL (Fig. 4A
). The inhibition of c-ABL kinase activity, assayed with GST-Crk fusion protein, as a result of treatment of ARO and FRO with STI571 was correlated with the level of c-ABL phosphorylation. In contrast, STI571 induced accumulation of c-ABL in wt-p53 cell lines (1F3 and KTC-1), and did not reduce the level of phospho-c-ABL. The mechanism underlying the accumulation of c-ABL after STI571 treatment of wt-p53 thyroid cell lines needs further elucidation.
|
and -Rß, did not alter MAPK activity, and PDGFRß was not affected by STI571 treatment in ARO and FRO cells (data not shown). These results indicate that c-ABL is likely to be the only STI571 target kinase active in the anaplastic cancer cell lines used in our experiments. STI571 promotes differential growth arrest
Fluorescent-activated cell sorting cell cycle analysis showed that treatment with STI571 increased more than 2-fold the proportion of cells in G2/M phase (9.28% vs. 3.78%) in the ARO cell line and elevated the number of cells in S phase (54% vs. 43%) in FRO cells (Fig. 5
). No such changes were observed in TPC-1, KTC-1, and 1F3 cells. In those cell lines there was a tendency for the proportion of cells in G1 phase to increase. However, we do not interpret this as cell cycle arrest because no growth inhibition was observed in the cultures treated with STI571. Thus, our data indicate that treatment with STI571 causes G2/M and S phase arrest in ARO and FRO cells, respectively, and this may be the cause of the observed growth inhibition in these cell lines.
|
Expression of cell cycle regulators
The CDK inhibitors, p21cip1 and p27kip1, can block CDK activity in the S to G2 as well as in the G1 to S phase transition of the cell cycle (23, 24). Expression of p21cip1 in FRO cells was markedly increased after 12 h of exposure to STI571, but did not change in ARO, KTC-1, and 1F3 cells (Fig. 6
). Expression of p27kip1 increased in ARO and FRO cells after 24 and 48 h of exposure, respectively. The activity of CDKs is dependent in part on the relative abundance of cyclin subunits and the presence of CDK inhibitors. Among the cyclins and CDKs, cyclin A, cyclin B, and CDC2 are involved in the progression from G2 to M phase. As shown in Fig. 6
, 24 h of STI571 treatment reduced levels of cyclin A, cyclin B1, and CDC2 in the ARO and FRO cell lines and levels of cyclin D3 in ARO cells, but had no effect in KTC-1 and 1F3. Under same conditions, levels of ß-actin were not significantly affected.
|
To examine a possible antitumor effect of STI571 on thyroid anaplastic cancer in vivo, FRO cells were implanted in athymic mice, and STI571 or vehicle (H2O) was injected ip. As shown in Fig. 7
, single daily administration of 50 mg/kg STI571 over 14 consecutive d resulted in a strong antitumor effect. The body weight and physical activity of the mice exposed to STI571 were not significantly affected.
|
| Discussion |
|---|
|
|
|---|
In the p53-mutated anaplastic cancer cell lines, ARO and FRO, a cytostatic effect was observed at concentrations that are clinically achievable (IC50, 5.9 and 7.8 µM, respectively) (25). These IC50 values were lower than those in NPA cells (IC50, 16 µM) and other papillary carcinoma cell lines. We therefore, focused on anaplastic cancer cells. Flow cytometry revealed that growth suppression by STI571 was due to arrest in G2/M or late S phase in such cell lines.
The cytostatic effect of STI571 has been demonstrated not only in CML, but also in small cell lung cancer characterized by increased activity of PDGFR and in gastrointestinal stromal tumors that show strong c-KIT tyrosine kinase activation (26). The question, however, remains as to which tyrosine kinase(s) is the target of inhibition responsible for the suppression of growth of undifferentiated thyroid cancer cell lines. RT-PCR analysis revealed the presence of c-ABL mRNA in all cell lines. Expression of PDGFR
, PDGFRß, and c-KIT was undetectable or very low in anaplastic cell lines and exhibited various patterns in other cell lines. Using Western blotting, we found that the level of c-ABL was significantly higher in the anaplastic thyroid cancer cell lines ARO and FRO compared with primary thyrocytes and papillary carcinoma cell lines. In the p53-mutant papillary cancer cell line NPA, the c-ABL level was also higher than in the wt-p53 papillary cancer cell lines TPC-1 and KTC-1. Moreover, stable transfection of wt-p53 into the anaplastic thyroid cancer cell line FRO reduced c-ABL protein expression. Coincident with these in vitro data, the immunohistochemical study revealed that a high level of c-ABL-positive immunostaining was observed in most of the anaplastic carcinoma cases that were strongly positive for p53. These data suggest that p53 status may influence the level of c-ABL protein in thyroid cancer cells. This idea is further supported by the observation of down-regulation of c-ABL evoked by the transfection of wt-p53 into the K562 chronic myeloid leukemia cell line (27).
To clarify the mechanism of cell growth inhibition by STI571, we examined its effect on the phosphorylation status of c-ABL and ERK1/2, a MAPK. STI571 inhibited the kinase activity of c-ABL in dose- and time-dependent manner in ARO and FRO, but failed to reduce the level of phospho-c-ABL in wt-p53 cell lines. MAPK activity was not inhibited by STI571 in any of the cell lines tested. Therefore, drug-induced growth suppression in anaplastic cancer cells is not mediated by the receptor-type tyrosine kinase-Ras-MAPK pathway, but, rather, is associated with inhibition of c-ABL kinase.
The expression of the CDK inhibitors, p21cip1 and p27kip1, was increased and the expression of cyclin A and B1 was decreased in STI571-treated FRO cells. Similar changes in the expression of p27kip1 and cyclins A and B1 and a reduction in the expression of cyclin D3 were observed in another anaplastic cancer cell line, ARO, but not in KTC-1 and 1F3 wt-p53 cells. As a consequence, treatment with STI571 induced late S or G2/M transition arrest in the p53-deficient thyroid cell lines. It is worth noting that p21cip1 overexpression has been linked to S phase arrest in several other model systems, including p53 null/mutant T98G cells (23). Consistent with our findings, exposure to STI571 increased mRNA and protein levels of p27kip1 in the IL-3-deprived pro-B cell line, BaF3-p210, which overexpresses BCR/ABL (24). It is therefore plausible to suggest that inhibition of c-ABL kinase activity by STI571 may cause cell growth inhibition via alteration of the expression/activity of cell cycle modulators.
A possible explanation of how STI571 up-regulates p21cip1 and p27kip1 is as follows. c-ABL kinase can phosphorylate phosphokinase C
(PKC
), leading to an increase in c-Jun NH2-terminal kinase (JNK) activity (28). Our recent work has also shown that the intracellular signaling cascade PKC-
-MKK7-JNK is activated in ARO cells (22), and JNK-specific antisense oligonucleotides have been shown to induce S phase arrest accompanied by the induction of p21cip1 (23). Therefore, inhibition of the c-ABL-PKC-
-MKK7-JNK cascade by STI571 may be responsible for the growth inhibition of p53-mutated thyroid cancer cell lines.
In conclusion, our results demonstrate that c-ABL is overexpressed in p53-mutated/deficient anaplastic thyroid carcinoma cell lines, and selective inhibition of c-ABL activity by STI571 has a marked cytostatic effect in such cells. Also, STI571 effectively suppresses the in vivo growth of FRO cells implanted into immunocompromised mice without evident side-effects. Thus, the use of STI571 is a potential anticancer modality for human anaplastic thyroid carcinomas.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: CDK, Cyclin-dependent kinase; CML, chronic myelogenous leukemia; Crk, CT10 chicken retrovirus protein; DMSO, dimethylsulfoxide; ERK, extracellular signal-regulated kinase; GST, glutathione-S-transferase; IC50, 50% inhibitory concentration; JNK, c-Jun NH2-terminal kinase; PDGFR, platelet-derived growth factor receptor; PKC
, phosphokinase C
; wt, wild type.
Received August 6, 2002.
Accepted January 20, 2003.
| References |
|---|
|
|
|---|
mediates ionizing radiation-induced activation of c-Jun NH2-terminal kinase through MKK7 in human thyroid cells. Oncogene 20:989996[CrossRef][Medline]
and the c-ABL tyrosine kinase in the cellular response to oxidative stress. J Biol Chem 275:74707473This article has been cited by other articles:
![]() |
R. C Smallridge, L. A Marlow, and J. A Copland Anaplastic thyroid cancer: molecular pathogenesis and emerging therapies Endocr. Relat. Cancer, March 1, 2009; 16(1): 17 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Gioni, T. Karampinas, G. Voutsinas, A. E. Roussidis, S. Papadopoulos, N. K. Karamanos, and D. Kletsas Imatinib Mesylate Inhibits Proliferation and Exerts an Antifibrotic Effect in Human Breast Stroma Fibroblasts Mol. Cancer Res., May 1, 2008; 6(5): 706 - 714. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Malaguarnera, V. Vella, G. Pandini, M. Sanfilippo, V. Pezzino, R. Vigneri, and F. Frasca TAp73{alpha} Increases p53 Tumor Suppressor Activity in Thyroid Cancer Cells via the Inhibition of Mdm2-Mediated Degradation Mol. Cancer Res., January 1, 2008; 6(1): 64 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Wiseman, H. Masoudi, P. Niblock, D. Turbin, A. Rajput, J. Hay, S. Bugis, D. Filipenko, D. Huntsman, and B. Gilks Anaplastic Thyroid Carcinoma: Expression Profile of Targets for Therapy Offers New Insights for Disease Treatment Ann. Surg. Oncol., February 1, 2007; 14(2): 719 - 729. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Leibowitz-Amit, G. Tsarfaty, Y. Abargil, G. M. Yerushalmi, J. Horev, and I. Tsarfaty Mimp, a Mitochondrial Carrier Homologue, Inhibits Met-HGF/SF-Induced Scattering and Tumorigenicity by Altering Met-HGF/SF Signaling Pathways. Cancer Res., September 1, 2006; 66(17): 8687 - 8697. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Frasca, A. Rustighi, R. Malaguarnera, S. Altamura, P. Vigneri, G. Del Sal, V. Giancotti, V. Pezzino, R. Vigneri, and G. Manfioletti HMGA1 Inhibits the Function of p53 Family Members in Thyroid Cancer Cells. Cancer Res., March 15, 2006; 66(6): 2980 - 2989. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Rao, N. Kremenevskaja, R. von Wasielewski, V. Jakubcakova, S. Kant, J. Resch, and G. Brabant Wnt/{beta}-Catenin Signaling Mediates Antineoplastic Effects of Imatinib Mesylate (Gleevec) in Anaplastic Thyroid Cancer J. Clin. Endocrinol. Metab., January 1, 2006; 91(1): 159 - 168. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Bravo, M. E.R. Garcia-Rendueles, R. Seoane, V. Dosil, J. Cameselle-Teijeiro, L. Lopez-Lazaro, J. Zalvide, F. Barreiro, C. M. Pombo, and C. V. Alvarez Plitidepsin Has a Cytostatic Effect in Human Undifferentiated (Anaplastic) Thyroid Carcinoma Clin. Cancer Res., November 1, 2005; 11(21): 7664 - 7673. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Landriscina, A. Fabiano, S. Altamura, C. Bagala, A. Piscazzi, A. Cassano, C. Spadafora, F. Giorgino, C. Barone, and M. Cignarelli Reverse Transcriptase Inhibitors Down-Regulate Cell Proliferation in Vitro and in Vivo and Restore Thyrotropin Signaling and Iodine Uptake in Human Thyroid Anaplastic Carcinoma J. Clin. Endocrinol. Metab., October 1, 2005; 90(10): 5663 - 5671. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Dziba and K. B. Ain Imatinib Mesylate (Gleevec; STI571) Monotherapy Is Ineffective in Suppressing Human Anaplastic Thyroid Carcinoma Cell Growth in Vitro J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2127 - 2135. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Burman A New Paradigm in the Treatment of Carcinoma: Specific Molecular Targeting Endocrinology, March 1, 2004; 145(3): 1027 - 1030. [Full Text] [PDF] |
||||
![]() |
C. S. Mitsiades, D. Sykoutri, C. McMullan, V. Poulaki, and N. Mitsiades Effect of Imatinib Mesylate (Gleevec) on Anaplastic Thyroid Carcinoma Cell Lines J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 5043 - 5044. [Full Text] [PDF] |
||||
![]() |
A. Podtcheko, A. Ohtsuru, H. Namba, V. Saenko, and S. Yamashita Authors' Response: Effect of Imatinib Mesylate (Gleevec) on Anaplastic Thyroid Carcinoma Cell Lines J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 5044 - 5044. [Full Text] |
||||
![]() |
R. J. Robbins Statins Sentence Thyroid Cancer Cells to Death Rho J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3019 - 3020. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |