| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Clinical and Experimental Medicine, University of Padova, 35128 Padova, Italy
Address all correspondence and requests for reprints to: Angelo Avogaro, M.D., Department of Clinical and Experimental Medicine, University of Padova, School of Medicine, Via Giustiniani 2, 35128 Padova, Italy. E-mail: angelo.avogaro{at}unipd.it.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The role of vascular NAD(P)H oxidase as an enzymatic source of superoxide and hydrogen peroxide (3) has recently been emphasized. This oxidase has been identified and characterized not only in neutrophils but also in adventitial fibroblasts, endothelial cells, and vascular smooth muscle cells; it has also been shown that in nonphagocytic cells their activity contributes substantially to the pathogenesis and progression of the atherosclerotic lesion.
A major contribution to vascular oxidative stress is given by macrophages that derive from recruited and activated circulating monocytes in the vessel wall; here activated macrophage-associated NAD(P)H oxidase generates oxidative stress, induces growth factor secretion, and activates matrix metalloproteinase (4). All these processes appear to be relevant for the induction of atherogenesis; however, in humans the prominent role of NAD(P)H oxidase in nonphagocytic cells is difficult to ascertain in vivo. With this background in mind, we wished to evaluate whether, in type 2 diabetes, a clinical condition characterized by increased oxidative stress, monocyte NAD(P)H oxidase is activated. We approached this goal through the determination of p22phox gene expression. p22phox, a 22-kDa
-subunit of cytochrome b558 included in the NAD(P)H oxidase, is an integral subunit of the final electron transport from NAD(P)H to heme- and molecular oxygen in generating O2-; the up-regulation of p22phox contributes to NADH/NADPH oxidase activation and the development of hypertension (5, 6, 7, 8, 9).
The assessment of p22phox in monocytes appears to be particularly important; we have shown that these cells present the same negative intracellular responses of both endothelial cells and vascular smooth muscle cells, such as an increased protein kinase C and ERK activation, in response to hyperglycemia (10, 11).
Another aim of this study was to compare the p22phox monocyte gene expression with that of the inducible form of hemeoxygenase (HO-1), a stress enzyme induced by and protective from oxidative stress, which is responsible for the catabolism of the heme molecule into biliverdin and further to bilirubin, both potent antioxidants themselves (12, 13).
| Patients and Methods |
|---|
|
|
|---|
We recruited for this study 25 patients with a known diagnosis of type 2 diabetes who were free from clinical and instrumental evidence of atherosclerotic cardiovascular disease. In these patients diabetic control was achieved with diet alone or with diet plus sulfonylurea or biguanide preparations or both. Pharmacological treatment for hyperglycemia was stopped at least 3 d before the study; antihypertensive drugs were continued. All participants were asked to fast for at least 12 h before the examination.
We also studied 10 additional type 2 diabetic patients who were referred to our outpatients clinic because of their poor metabolic control because of incongruous antidiabetic therapy; none had evidence of pathological conditions that could potentially affect the indexes under scrutiny. Five of them were on insulin therapy and five were treated with diet alone (Table 1
).
|
Experimental procedures
On the day of the study, at 0700 h after an overnight fast, 25 type II diabetic patients and the normal subjects were admitted to the Divisione di Malattie del Metabolismo of the University of Padova. A 20-gauge butterfly needle was inserted into a dorsal hand vein at 0730 h. The hand was heated to 60 C to arterialize venous blood. Subjects had a blood sampling (50 ml) for the determination of circulating glucose, insulin, C-peptide, and lipids and p22phox and HO-1 gene expression. Diabetic patients were evaluated at their spontaneous fasting plasma glucose concentration.
In 10 type 2 diabetic patients, who were referred from the Emergency Unit to our outpatients clinic because of their poor metabolic control because of incongruous antidiabetic therapy, blood samples were obtained, as previously described, for the determination of plasma glucose, creatinine, and electrolytes and p22phox and HO-1 gene expression. They were fasting for at least 8 h. None of them had prominent distress or significant volume depletion. Blood samples were again obtained in fasting state at least 7 d after the euglycemia was reestablished with an appropriate antidiabetic therapy (either adjusted insulin dosage or oral therapy). Blood samples were obtained without discontinuation of antidiabetic therapy.
Analytical methods
Plasma glucose was measured with the glucose oxidase method on a glucose analyzer (Beckman, Albertville, MN). Plasma insulin and C-peptide were measured by conventional RIA (CV = 6% ± 4% and 5.3% ± 3.2%, respectively). Total cholesterol and triglycerides were assayed with an enzymatic assay, and high-density lipoprotein (HDL) cholesterol was measured using polyethylene glycol precipitation with enzymatic quantitation. Hemoglobin A1c (HbA1c) (reference range, 4.56%) was measured by a chromatographic method.
Determination of p22phox and HO-1 gene expression in circulating monocytes: monocyte preparation
Cells were prepared from heparinized blood by centrifugation (400 x g for 30 min at room temperature) over Histopaque-1077 (Sigma, St. Louis, MO), as previously described (14). They were washed once with PBS and twice with RPMI 1640 and then resuspended in RPMI 1640 supplemented with 10% fetal calf serum, 2 mmol/liter L-glutamine, 100 U/ml penicillin, and 10 µg/ml streptomycin (complete medium). Cells were plated in 60-mm culture dishes and incubated for 30 min at 37 C in a humidified atmosphere with 5% CO2. Nonadherent cells were removed by washing with PBS, and adherent cells were incubated in the same fresh RPMI 1640 for 34 h. More than 90% of adherent cells were monocytes by morphological examination and staining with Diff-Quik (IMEB Inc., San Marcos, CA). More than 95% of monocytes were viable as determined by trypan blue exclusion.
RNA extraction
RNA from peripheral blood monocytes was extracted using a commercially available kit (RNA Ble, RNA extraction, Eurobio, Les Ulis, France) with l ml product per approximately 5 x 106 cells. The extracted RNA had a 280/260 OD ratio between 1.8 and 2.0.
RT-PCR
Reverse transcription of RNA was performed with Gene Amp RNA PCR kit, essentially as described by the manufacturer (Gene Amp RNA PCR kit; Perkin-Elmer Corp., Norwalk, CT). RNA (
1 µg) was reverse transcribed using random hexamer primers and murine leukemia virus reverse transcriptase in a 2400 thermocycler (Perkin-Elmer) (15 min at 42 C, 5 min at 99 C, and 5 min at 5 C) as previously reported (14).
The p22phox mRNA expression PCR was performed using specific primers designed with the aid of Primer3 software (15), and their sequence is 5'-3': TGGGCGGCTGCTTGATGGT (nucleotide sequence position 169188) and GTTTGTGTGCCTGCTGGAGT (465485). The conditions of amplification were: 95 C for 1 min, 60 C for 1 min, and 72 C for 1 min for 30 cycles of amplification as previously reported (16).
The oligomer primers used for HO-1 gene expression were: 5'-3': CAGGCAGAGAATGCTGAGTTC (nucleotide sequence position: 7999) and GCTTCACATAGCGCTGCA (332349). They have also been designed using Primer3 software (15). The conditions of amplification were: 94 C for 30 sec, 58 C for 1 min, and 72 C for 1 min for 26 cycles of amplification.
The number of cycles used for the amplifications of both p22phox and HO-1 oligomers primers, carried out in the present study, was obtained from the analysis of a kinetic curve set for each gene using an increasing number of cycles from 10 to 40, in the order of 2, to determine the number of cycles corresponding to the exponential phase of the amplification (Fig. 1
).
|
The ß-actin PCR products obtained by amplifying primers (CLONTECH Laboratories, Inc., Palo Alto, CA) were used as a control gene.
Evaluation of p22phox and HO-1 gene products
The p22phox, HO-1, and ß-actin gene expressions were quantified using a PCR-based densitometric semiquantitative analysis using NIH image software, as previously reported (14). The ratio of p22phox and HO-1 to ß-actin PCR products, expressed as pixel density, was used as indexes of p22phox and HO-1 gene expression (in densitometric units).
Western blot analysis
Protein extracts were obtained from lymphomonocytes isolated from 20 ml peripheral blood by sonication of cells in lysis buffer [20 mM HEPES (pH 7.5), 2 mM EGTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 40 mM ß-glycerophosphate, 2.5 mM MgCl2, 2.0 mM Na3VO4, 20 µg/ml aprotinin, 20 µg/ml leupeptin]. The cell extract was centrifuged (5 min, 10,000 x g) and the supernatant was stored at -80 C. Protein concentration of the samples was determined using the BCA assay (Pierce Chemical Co., Rockford, IL). Before analysis, 20 µg protein were boiled for 5 min in sample buffer [20 mM Tris HCl (pH 6.8), 2-mercaptoethanol 2%, SDS 2%, bromophenol blue 0.1%, glycerol 10%]. The proteins were separated by 12% SDS-PAGE, transferred to nitrocellulose membrane, and incubated overnight in PBS-0.1% Tween 20 buffer containing 5% nonfat dry milk. The membrane was then incubated with goat anti-p22phox antibody (Santa Cruz Biotechnology, Santa Cruz, CA) diluted 1:500 in blocking solution for 3 h at room temperature. The membrane was washed extensively with PBS-0.1% Tween 20 buffer and incubated with donkey antigoat IgG-horseradish peroxidase-conjugated antibody for 1 h at room temperature. The membrane was washed again and membrane-bound antibodies were visualized by SuperSignal West Pico chemiluminescent substrate (Pierce Chemical Co.) according to the manufacturers protocol. Immunoblotting with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Chemicon International, Temecula, CA) was performed as loading control.
Quantification of p22phox protein expression
The p22phox protein expression was quantified using a densitometric semiquantitative analysis using NIH image software. The ratio of p22phox to GAPDH Western blot products, expressed as pixel density, has been used as indexes of p22phox protein expression (in densitometric units).
Statistics
To evaluate the differences between the controls and the type 2 diabetic patients, the unpaired t test was used and a P value of less than 0.05 was considered to be significant. The paired t test was used to determine the statistical significance between variables in diabetics during hyperglycemia and euglycemia, respectively. Stepwise regression analysis was used to investigate relationships between the p22phox vs. age, fasting plasma glucose, HbA1c, smoking status, total cholesterol, HDL cholesterol, triglycerides, low-density lipoprotein cholesterol, and microalbuminuria. Test statistics were computed with statistical software (release 10.0.5; SPSS, Inc., Chicago, IL).
| Results |
|---|
|
|
|---|
As shown in Fig. 2
, p22phox gene expression was significantly higher (0.71 ± 0.09 p22phox/ß-actin gene expression ratio) in monocyte from type 2 diabetic patients than in controls (0.56 ± 0.09, P < 0.001). Similarly, HO-1 gene expression was significantly higher in type 2 diabetic patients (0.77 ± 0.12 HO-1/ß-actin gene expression ratio) than in controls (0.41 ± 0.14, P < 0.001) (Fig. 3
).
|
|
|
|
|
Similarly, p22phox protein expression was significantly higher in the hyperglycemic condition (Fig. 6
); the protein expression of p22phox assessed by Western blot analysis and adjusted for the expression of the housekeeping gene GAPDH was significantly higher (Fig. 4
) in hyperglycemic conditions than during euglycemia (0.73 ± 0.01 vs. 0.45 ± 0.03 p22phox/GAPDH protein expression ratio, P < 0.001).
|
| Discussion |
|---|
|
|
|---|
Recent studies from our and other laboratories indicated that diabetes induces several abnormalities in monocytes, which play a major role in the earliest events of atherosclerotic lesion (11). The increased production of mRNA for p22phox in mononuclear cells from type 2 diabetic patients adds further information to the mechanistic events that could take place in these cells leading to clinical complications such as cardiovascular remodeling and atherogenesis. Moreover, in terms of atherosclerotic lesion, it has been recently shown that oxidative stress increases the levels of monocyte chemoattractant protein-1 in patients with unstable angina (21). One limitation of this study is that we did not assess activity and biological relevance of this enzyme; however, the increased gene expression strongly suggest that the metabolic conditions present in the diabetic patients are likely to activate this oxidase. The relationship between the metabolic milieu and induction of the oxidative stress is further substantiated by the finding of a positive correlation between HbA1c and the p22phox gene expression in the diabetic population. Clearly, future studies are needed to determine whether the activation of this gene in these cells is comparable with that of other cell lineages and add proofs of its biological relevance.
In most of our type 2 diabetic patients, these indexes of oxidative stress were performed after 3 d of discontinuation of their antidiabetic therapy; this could potentially affect our results. It has been shown by Mohanty et al. (22) that the p47phox, a key protein of the NAD(P)H oxidase, and ROS generation are increased during the glucose challenge. Moreover, 1 wk of antihyperglycemic therapy with troglitazone suppresses ROS generation and p47phox in mononuclear cells independent of any lowering of blood glucose concentration (23). For these reasons we also assessed the effect of metabolic control of diabetes on the monocyte p22phox and HO-1 gene expressions and p22phox protein. Our data indicate that the metabolic decompensation was associated with an increase of these parameters; this defect significantly improved but could not be completely abolished, once the metabolic control was reestablished. These findings, although they confirm that leukocytes could be the site of active ROS generation (24), indicate that the activation of p22phox and HO-1 gene expressions is dependent not only on metabolic decompensation but also the presence of diabetes per se.
From the multivariate analysis performed in 25 diabetic patients, age was significantly and independently associated with monocyte p22phox gene expression. This finding has not been confirmed in the control subjects (data not shown). Without any inference of causality, these data would support the findings that aging is associated with an increased oxidative stress (25) and diabetes may be an important bond between these two events. In our patients age was correlated also with the duration of the disease (r2 = 0.218, P = 0.0081), and the effect of this variable on the observed results cannot be excluded.
It must be stressed that other factors could activate NAD(P)H oxidase. Inoguchi et al. (26) have shown that in cultured vascular cells, besides high glucose levels, free fatty acids also activate this oxidase through protein kinase C-dependent mechanisms. Thus, the activation of NAD(P)H may be mediated by a complex web of hormonal and metabolic factors that are not necessarily identified by the clinical variables. Possible culprits could be increased levels of nonesterified fatty acids. It has been recently shown by Tripathy et al. (27) that these substrates induce an acute increase in oxidative stress and proinflammatory process at the cellular and molecular levels through the activation of nuclear factor
-B.
It should be pointed out, however, that in our patients hypertension was slightly more prevalent than in matched controls; thus, we acknowledge that the concomitant antihypertensive treatment could have invalided the possibility of such a relationship. Angiotensin 2 is, in fact, one of the major regulators of NAD(P)H oxidase activity (28, 29); thus, antihypertensive treatment could have influenced the angiotensin 2 effect on NAD(P)H oxidase activity and p22phox gene expression in those patients treated with angiotensin-converting enzyme inhibitors or angiotensin 2 receptor blockers (24).
We also compared the p22phox gene expression with that of another protein, HO-1, a ubiquitous cellular protein that is up-regulated in response to oxidative stress (30). As for p22phox, the HO-1 gene expression was significantly higher in the monocytes from type 2 diabetics. As for the p22phox, the HO-1 gene expression was significantly affected by the metabolic controls; furthermore, this gene also may be activated by diabetes per se because near-complete euglycemia could not normalize its gene expression.
This finding testifies not only that monocytes from diabetic patients have a prooxidant intracellular milieu but supports the hypothesis that HO-1 expression is increased in diabetes both in vitro and in vivo as cell first-line defense. HO-1 is in fact regulated by oxidative stress and nonoxidant mediators and has been linked to long-term antiinflammatory and antiproliferative effects; therefore, it may represent an additive compensatory mechanism toward oxidative stress, hypertension, and remodeling (31). Moreover, it has been shown that both NAD(P)H and HO-1 activities are simultaneously activated in other cell types in response to stressful environment such as infections (32).
In conclusion, our data show that circulating monocytes from type 2 diabetic patients show increased gene expression of p22phox, a major component of NAD(P)H oxidase, which testifies its increased activity and an increased gene expression of HO-1 as well. These findings suggest that these cells, which play a crucial role in the earliest events of atherosclerotic lesion, are subjected to an increased oxidative stress.
The results of this study might represent the basis for a working hypothesis to establish the clinical relevance of the increased p22phox gene expression, NAD(P)H activity, and the status of protective mechanisms toward atherosclerosis and vascular remodeling such as HO-1 in diabetic patients.
| Footnotes |
|---|
Received July 2, 2002.
Accepted January 3, 2003.
| References |
|---|
|
|
|---|
B suppressive and inhibitor-
B stimulatory effects of troglitazone in obese patients with type 2 diabetes: evidence of an anti-inflammatory action? J Clin Endocrinol Metab 86:32503256
B (NF-
B) and impair brachial artery reactivity in healthy subjects. Diabetes 51:12991309This article has been cited by other articles:
![]() |
N. K. Idriss, A. D. Blann, and G. Y.H. Lip Hemoxygenase-1 in Cardiovascular Disease J. Am. Coll. Cardiol., September 16, 2008; 52(12): 971 - 978. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Sorrentino, F. H. Bahlmann, C. Besler, M. Muller, S. Schulz, N. Kirchhoff, C. Doerries, T. Horvath, A. Limbourg, F. Limbourg, et al. Oxidant Stress Impairs In Vivo Reendothelialization Capacity of Endothelial Progenitor Cells From Patients With Type 2 Diabetes Mellitus: Restoration by the Peroxisome Proliferator-Activated Receptor-{gamma} Agonist Rosiglitazone Circulation, July 10, 2007; 116(2): 163 - 173. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Fadini, S. Sartore, C. Agostini, and A. Avogaro Significance of Endothelial Progenitor Cells in Subjects With Diabetes Diabetes Care, May 1, 2007; 30(5): 1305 - 1313. [Full Text] [PDF] |
||||
![]() |
G. P. Fadini, S. Sartore, M. Albiero, I. Baesso, E. Murphy, M. Menegolo, F. Grego, S. Vigili de Kreutzenberg, A. Tiengo, C. Agostini, et al. Number and Function of Endothelial Progenitor Cells as a Marker of Severity for Diabetic Vasculopathy Arterioscler. Thromb. Vasc. Biol., September 1, 2006; 26(9): 2140 - 2146. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Davis, E. Pagnin, A. Semplicini, A. Avogaro, and L. A. Calo Insulin Signaling, Glucose Metabolism, and the Angiotensin II Signaling System: Studies in Bartter's/Gitelman's syndromes Diabetes Care, February 1, 2006; 29(2): 469 - 471. [Full Text] [PDF] |
||||
![]() |
N. Wijayanti, T. Kietzmann, and S. Immenschuh Heme Oxygenase-1 Gene Activation by the NAD(P)H Oxidase Inhibitor 4-(2-Aminoethyl) Benzenesulfonyl Fluoride via a Protein Kinase B, p38-dependent Signaling Pathway in Monocytes J. Biol. Chem., June 10, 2005; 280(23): 21820 - 21829. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rask-Madsen and G. L. King Proatherosclerotic Mechanisms Involving Protein Kinase C in Diabetes and Insulin Resistance Arterioscler. Thromb. Vasc. Biol., March 1, 2005; 25(3): 487 - 496. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Pagnin, G. Fadini, R. de Toni, A. Tiengo, L. Calo, and A. Avogaro Diabetes Induces p66shc Gene Expression in Human Peripheral Blood Mononuclear Cells: Relationship to Oxidative Stress J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1130 - 1136. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sumi and L. J. Ignarro Regulation of Inducible Nitric Oxide Synthase Expression in Advanced Glycation End Product-Stimulated RAW 264.7 Cells: The Role of Heme Oxygenase-1 and Endogenous Nitric Oxide Diabetes, July 1, 2004; 53(7): 1841 - 1850. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kusaka, G. Kusaka, C. Zhou, M. Ishikawa, A. Nanda, D. N. Granger, J. H. Zhang, and J. Tang Role of AT1 receptors and NAD(P)H oxidase in diabetes-aggravated ischemic brain injury Am J Physiol Heart Circ Physiol, June 1, 2004; 286(6): H2442 - H2451. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |