help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bildirici, I.
Right arrow Articles by Sadovsky, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bildirici, I.
Right arrow Articles by Sadovsky, Y.
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 12 6056-6062
Copyright © 2003 by The Endocrine Society

The Lipid Droplet-Associated Protein Adipophilin Is Expressed in Human Trophoblasts and Is Regulated by Peroxisomal Proliferator-Activated Receptor-{gamma}/Retinoid X Receptor

Ibrahim Bildirici, Cheong-Rae Roh, W. Timothy Schaiff, Beth M. Lewkowski, D. Michael Nelson and Yoel Sadovsky

Departments of Obstetrics and Gynecology (I.B., C.-R.R., W.T.S., B.M.L., D.M.N., Y.S.) and Cell Biology and Physiology (I.B., C.-R.R., W.T.S., Y.S.), Washington University School of Medicine, St. Louis, Missouri 63110

Address all correspondence and requests for reprints to: Yoel Sadovsky, M.D., Washington University School of Medicine, Department of Obstetrics and Gynecology, Campus Box 8064, 4566 Scott Avenue, St. Louis, Missouri 63110. E-mail: sadovskyy{at}msnotes.wustl.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Uptake and transplacental transfer of fatty acids is essential for fetal development. Human adipophilin and its murine ortholog adipocyte differentiation-related protein are lipid droplet-associated proteins that are implicated in cellular fatty acid uptake in adipocytes. The nuclear receptor peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) stimulates lipid uptake by adipocytes and enhances differentiation of placental trophoblasts. We therefore hypothesized that adipophilin is expressed in human trophoblasts and that its expression is regulated by PPAR{gamma}. We initially determined that adipophilin is expressed in human villous trophoblasts and that adipophilin expression is enhanced during differentiation of cultured primary term human trophoblasts. We also found that exposure of cultured human trophoblasts to the PPAR{gamma} ligand troglitazone resulted in a concentration-dependent increase in adipophilin expression. We observed a similar increase with LG268, a ligand for retinoid X receptor (RXR), the heterodimeric partner of PPAR{gamma}. Lastly, we demonstrated that ligand-activated PPAR{gamma} and RXR stimulated the transcriptional activity of adipophilin promoter in CV-1 cells and in the placental JEG3 cell line. We conclude that the expression of adipophilin is enhanced during trophoblast differentiation and is up-regulated by ligand-activated PPAR{gamma}/RXR. Enhanced adipophilin expression may contribute to fatty acid uptake by the placenta.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
MATERNAL SUPPLY OF nutrients is obligatory for intrauterine fetal development and growth. Among the essential nutrients, lipids from lipoproteins are used as substrates for the growing fetus, an energy source, and precursors for steroid hormone synthesis. Nutrients transported from the maternal to the fetal circulation cross the villous trophoblast. The trophoblast consists of two surface membranes: a microvillous membrane that faces the maternal blood space and a basal membrane that faces the fetal blood vessels within the villous core. Although triglycerides do not directly cross the placental barrier (1), the presence of lipoprotein lipase activity in trophoblast cells allows placental hydrolysis and uptake of maternal plasma triglycerides (2, 3, 4). In contrast, fatty acids can cross trophoblast surface membranes by simple diffusion and facilitated transport, mediated by membrane-bound and cytosolic fatty acid binding proteins (5, 6, 7).

Adipophilin is the human ortholog of murine adipose differentiation-related protein (ADRP), a 50-kDa protein that was initially cloned from a mouse adipocyte cDNA library (8). The N terminus of ADRP is highly homologous to the N-terminal end of perilipin A and TIP47/pp17 (9, 10, 11). Another recently identified protein, S3–12 (12), contains a 33-amino acid repeat sequence that exhibits strong homology to ADRP. Previous studies showed that ADRP mRNA is expressed primarily in adipose tissue and is induced early during adipocyte differentiation (13, 14). Adipophilin colocalizes with the surface of neutral lipid droplets in adipocytes and in a wide range of cells and tissues that store or synthesize lipids, including milk-secreting mammary epithelial cells, testicular Leydig and Sertoli cells, adrenal cortex cells, and hepatocytes with fatty changes associated with alcoholism (15, 16, 17). Unlike adipophilin, perilipin expression is more restricted and localizes primarily to triacylglycerol-rich lipid droplets in adipocytes and the cholesterol ester-rich droplets in steroidogenic cells (18, 19). Adipophilin expression is enhanced on incubation of preadipocytes with long-chain fatty acids (17). By increasing the initial uptake rate, adipophilin facilitates the uptake of long-chain free fatty acids in COS-7 cells, supporting the role of adipophilin as a fatty acid carrier protein (20).

Peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) is a member of the steroid receptor superfamily of nuclear receptors. PPAR{gamma} is expressed predominantly in adipose tissue (21, 22), monocytes, macrophages (23, 24), and the placenta (25, 26, 27, 28). Known ligands for PPAR{gamma} include fatty acids, oxidized low-density lipoprotein derivatives, the prostaglandin metabolite 15-deoxy-{Delta}12, 14-prostaglandin J2, and the antidiabetic thiazolidinediones (24, 29, 30, 31, 32, 33). Stimulation of PPAR{gamma} activity by natural or synthetic ligands results in adipogenesis in target tissues through the induction of genes mediating fatty acid uptake, metabolism, and storage (25, 31, 34). PPAR{gamma} is also indispensable for murine placental development. The placentas of PPAR{gamma}-deficient murine embryos exhibit failed maturation of labyrinthine trilaminar trophoblast epithelium along with vascular defects. These defects compromise maternal-fetal exchange and result in embryonic death by E10.5 (25, 26). The placental labyrinth in PPAR{gamma}-deficient mice also expresses fewer and markedly smaller lipid droplets, compared with wild type (25). We demonstrated that PPAR{gamma} modulates differentiation of human cytotrophoblast into syncytiotrophoblast in a ligand-specific manner and that the activity of PPAR{gamma} is enhanced by oxidized lipids (27, 35). Taken together, these data suggest that PPAR{gamma} may regulate the expression of fatty acid transporters in human trophoblasts. In a recent microarray screen for PPAR{gamma} targets in trophoblasts, we found that adipophilin is markedly up-regulated by ligand-activated PPAR{gamma} (36 , and Roh, C. R. and Y. Sadovsky, manuscript in preparation). We therefore hypothesized that adipophilin is expressed in human trophoblasts and that its expression is influenced by PPAR{gamma}. Here we demonstrate that adipophilin is expressed in primary term human trophoblasts and that ligand-activated PPAR{gamma} enhances the expression of adipophilin in trophoblasts and the activity of adipophilin promoter in the trophoblast cell line JEG3.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture

Our study was approved by the human studies committee of Washington University in St. Louis. Primary human cytotrophoblasts were prepared from normal term human placentas using the trypsin-deoxyribonuclease-dispase/Percoll method as described by Kliman et al. (37) with previously published modifications (27, 38). Cultures were plated at a density of 300,000 cells/cm2 and maintained in Earl’s medium 199 containing 10% fetal bovine serum (HyClone Laboratories, Inc., Logan, UT), 20 mmol/liter HEPES (pH 7.4), 0.5 mmol/L-glutamine (Sigma, St. Louis, MO), penicillin (10 U/ml), streptomycin (10 µg/ml), and fungizone (0.25 µg/ml). All cultures were maintained at 37 C in a 5% CO2 atmosphere. Medium was changed 4 h after initial plating and every 24 h thereafter. Where indicated, cultures were supplemented with 10 µM troglitazone (Biomol, Plymouth Meeting, PA) and/or 0.1 µM LG268 (a gift from Ligand Pharmaceuticals, San Diego, CA). These ligands were added either after 4 h in culture or at the time points indicated. The time point of 4 h, selected to allow cells to adhere, was defined as time 0. In ligand time course immunoblotting experiments all cells were harvested for western analysis after 72 h. The time points indicate the period of ligand exposure such that 24 h indicates ligand exposure from 48–72 h in culture, 48 h indicates ligand exposure from 24 to 72 h in culture, and 72 h indicates ligand exposure for the entire culture period. The concentrations of PPAR{gamma} and retinoid X receptor (RXR) ligands in the culture media were previously optimized to yield maximal responses in vitro and were consistent with published reports (24, 39). Overall, more than 15 freshly isolated placental preparations contributed to the results.

Immunohistochemistry and Western immunoblotting

Placental biopsies from term uncomplicated pregnancies were collected immediately after delivery, fixed for 2–4 h in 10% neutral buffered formalin, and embedded in paraffin. Five-micron sections were deparaffinized in xylene and rehydrated in an ethanol gradient. Endogenous peroxidase activity was quenched by incubating the specimens in 3% H2O2 in methanol for 30 min. After equilibrating for 5 min in distilled water, the samples were heated in a microwave at maximum power for 10 min. The slides were washed, blocked for 30 min with normal goat serum, and incubated for 2 h at room temperature in the absence or presence of antiadipophilin guinea pig polyclonal antibody (1:500, Research Diagnostics Inc, Flanders, NJ). After washes, the slides were incubated for 30 min with a biotinylated goat antiguinea pig secondary antibody (1:2000, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), followed by 30-min incubation with avidin/biotin-horseradish peroxidase complex (Vector Laboratories, Inc., Burlingame, CA) and 3-min incubation with diaminobenzidene (Zymed Laboratories, Inc., South San Francisco, CA). The slides were rinsed and counterstained with Mayer’s hematoxylin (Sigma), dehydrated in ethanol, cleared with xylene, and mounted with glass cover slips using Histomount (Zymed Laboratories, Inc.). The results were verified using similarly prepared slides stained with antiadipophilin mouse monoclonal antibody (Research Diagnostics Inc.) according to the manufacturer’s protocol or isotype matched IgG1. After washes the slides were incubated for 30 min with horseradish peroxidase-conjugated donkey antimouse antibody (1:400, Santa Cruz Biotechnology).

Cell lysis, sonication, electrophoresis, and transfer for Western immunoblotting were performed as previously described (27). Membranes were incubated overnight at 4 C with antiadipophilin mouse monoclonal antibody (1:1000, Progen Biotechnik, Heidelberg, Germany). The blot was subsequently washed, incubated for 1 h with horseradish peroxidase-conjugated donkey antimouse antibody (1:3000, Santa Cruz Biotechnology), washed, and processed for luminescence using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech, Arlington Heights, IL). Differences in protein expression were quantified using densitometry.

RNA extraction and real-time quantitative PCR

Total RNA was prepared from cultured trophoblasts using TriReagent (MRC, Cincinnati, OH) as recommended by the manufacturer. RNA was digested with DNase I, quantified by absorbance at 260 nm, and quality determined by electrophoresis. For reverse transcription, 2 µg total RNA were added into reverse transcriptase buffer, 5.5 mM MgCl2, 2.5 µM random hexamers, 500 µM deoxynucleotide triphosphate mixture, 20 U Rnasin, and 50 U MultiScribe reverse transcriptase in a final volume of 50 µl. Reverse transcriptase reactions were performed by incubation for 10 min at 25 C, 30 min at 48 C and inactivation for 5 min at 95 C. Relative expression of adipophilin RNA was assessed using the SYBRGreen I assay on the GeneAmp 5700 sequence detection system (Applied Biosystems, Foster City, CA). Each PCR was performed in duplicates with 50-µl volumes of 2 µl cDNA, 25 µl SYBRGreen PCR master mix (Applied Biosystems), and 0.3 µM of each primer, including forward, GGCAGAGAACGGTGTGAAGAC, and reverse, TCTGGATGATGGGCAGAGC. PCR was conducted using the following cycle parameters: 2 min at 50 C, 10 min at 95 C, and 40 two-step cycles of 15 sec at 95 C and 1 min at 60 C. Analysis was carried out using the GeneAmp 5700 sequence detection software, which calculates the threshold cycle (Ct) for each reaction. A difference in Ct values ({Delta}Ct) was calculated by subtracting the mean Ct of the reference 18S for each Ct of duplicates, and then {Delta}{Delta}Ct was calculated by subtracting the reference mean Ct from each {Delta}Ct value for each condition.

Adipophilin promoter and transient transfection

We used human adipophilin coding sequences (NM001122, GenBank, National Center for Biotechnology Information) (14) to probe the human genome database and identified contig NT037733.1 (chromosome 9p21.3) that harbors sequences identical to adipophilin. Using PCR primers forward 5'-TGGCGCAACTTGTCTGCTCAAATAA-3' and reverse 5'-CTGCAATCAAAGTAGGGAGGGTATG-3', we amplified genomic sequences from nt 538846 to 536349 within contig NT037733.1, which correspond to promoter sites -2381 to +117 of adipophilin. We cloned this promoter fragment, which includes adipophilin’s first intron, between KpnI and XhoI sites upstream of luciferase in pGL-Basic vector (Promega, Madison, WI).

JEG3 or CV-1 cells were plated in 12-well plates (50,000 cells/well) 1 d before transfection. Transfection was performed using the calcium-phosphate coprecipitation method, as previously described (27, 40). Cells in each well were transfected with 0.5 µg of adipophilin-Luc promoter plasmid, 0.2 µg of pCDNA3.1 expression vector, or pCDNA3.1-PPAR{gamma}, which expresses human PPAR{gamma}1 (a gift from Tom Mariani, Washington University) as well as 0.05 µg cytomegalovirus-ß-galactosidase reporter plasmid (incorporated to normalize for cell viability and transfection efficiency). Ligands were added after overnight transfection, and luciferase assay was performed 24 h later. Cells were lysed and luciferase activity determined using a Lumistar luminometer (BMG Lab Technologies, Durham, NC), and ß-galactosidase assay performed using a plate reader (Anthos htIII, Salzburg, Austria) as we previously described (27, 35). All experiments were performed in duplicate and repeated at least three times. Results (mean ± SD) were expressed as relative luciferase units, corrected to ß-galactosidase.

Differences were analyzed using either t test or one-way ANOVA and post hoc Student-Newman-Keuls test, with P < 0.05 determined significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
We initially examined the expression of adipophilin in the term human placenta. For this purpose we prepared sections of placental villi derived from uncomplicated term deliveries. Using immunohistochemistry, we detected adipophilin expression in villous trophoblasts (Fig. 1Go), with highest expression along the microvillous membrane (Fig. 1CGo). A lower level of adipophilin expression was also detected in villous stromal cells and endothelial cells. Using Western immunoblotting, we confirmed the expression of adipophilin in cultured primary term human trophoblasts. As shown in Fig. 2Go, adipophilin expression in trophoblasts was enhanced over 72 h of culture, corresponding to differentiation of these cells into syncytium, as we have previously shown (38). We concluded that adipophilin is expressed in villous trophoblasts, and its expression increases during cytotrophoblast differentiation into syncytiotrophoblasts.



View larger version (155K):
[in this window]
[in a new window]
  		FIG. 1. Adipophilin is expressed in human villous syncytiotrophoblasts. Formalin-fixed sections of normal term human placenta were stained for adipophilin (A, x400, and C, x1000) and counterstained with Mayer’s hematoxylin. Adipophilin expression in A was detected using antiadipophilin guinea pig polyclonal antibody as described in Materials and Methods, and B was similarly stained, but the primary antibody was omitted. Adipophilin expression in C was detected using antiadipophilin mouse polyclonal antibody, and D was similarly stained with isotype matched nonspecific IgG as a primary antibody (bar, 100 µM). Results represent three independent experiments.

 


View larger version (53K):
[in this window]
[in a new window]
  		FIG. 2. Western immunoblotting depicting the expression of adipophilin in differentiating trophoblasts in vitro. Primary trophoblasts were cultured for the indicated times, with adipophilin detected as described in Materials and Methods. Results represent three independent experiments, in which maximum adipophilin increase by 72 h (1.9-fold) was significantly different from the other two time points (P < 0.05).

 
Ligand activation of PPAR{gamma} enhances adipogenesis in undifferentiated fibroblasts and other tissues (31, 34). In addition, activation of PPAR{gamma} by thiazolidinediones enhances differentiation of cytotrophoblasts into syncytiotrophoblasts (27). We therefore examined the role of the thiazolidinedione troglitazone in regulation of adipophilin expression in cultured trophoblasts. We have previously shown that PPAR{gamma} is expressed in human villous trophoblasts in vivo and plated term human trophoblasts in vitro and that expression of PPAR{gamma} in cultured trophoblasts is unchanged between 24 and 72 h of culture (27). As shown in Fig. 3AGo, 24 h of troglitazone was sufficient to enhance adipophilin. Similarly, addition of troglitazone to the culture medium of plated trophoblasts resulted in a concentration-dependent increase in adipophilin expression (Fig. 3BGo). Because RXR heterodimerizes with PPAR{gamma} (41, 42) and RXR{alpha} is expressed in term human trophoblasts (43, 44, 45), we examined the effect of RXR activation on adipophilin expression. As shown in Fig. 4Go, LG268, a selective RXR agonist, enhanced the expression of adipophilin. This enhancement was concentration dependent, with maximum effect observed at 0.01–0.1 µM, and declined at a higher concentration (Fig. 4BGo). Taken together, our data indicate that PPAR{gamma} and RXR enhance the expression of adipophilin in term human trophoblasts.



View larger version (42K):
[in this window]
[in a new window]
  		FIG. 3. The PPAR{gamma} agonist troglitazone enhances the expression of adipophilin in cultured term human trophoblasts. Adipophilin expression was assessed using Western immunoblotting. Results represent three independent experiments. A, Trophoblasts were cultured for 72 h and exposed to troglitazone (10 µM) for the last 24, 48, or the entire 72 h of culture, as described in Materials and Methods. Adipophilin expression was similar among troglitazone-exposed cultures and was significantly different from control (2-fold, P < 0.05). B, Primary trophoblasts were cultured for 72 h in the presence of troglitazone (0.01–10 µM) and adipophilin expression determined using Western immunoblotting, as described in Materials and Methods.

 


View larger version (44K):
[in this window]
[in a new window]
  		FIG. 4. The RXR{alpha} agonist LG268 enhances the expression of adipophilin in cultured term human trophoblasts. A, Trophoblasts were cultured for 72 h and exposed to LG268 (0.1 µM) for the last 24, 48, or the entire 72 h of culture, as described in Materials and Methods. Adipophilin expression was assessed using Western immunoblotting. Results represent three independent experiments. Adipophilin expression was similar among LG268 exposed cultures and was significantly different from control (3-fold, P < 0.05). B, Primary trophoblasts were cultured for 72 h in the presence of LG268 (0.001–1 µM) and adipophilin expression determined using Western immunoblotting, as described in Materials and Methods.

 
To obtain additional support for the influence of PPAR{gamma}/RXR activation on expression of adipophilin in term human trophoblasts, we examined the effect of troglitazone and LG268 on adipophilin RNA expression, assessed using real-time quantitative PCR. Interestingly, basal level of adipophilin RNA gradually decreased during the culture period (Fig. 5Go). Nevertheless, exposure of cultured cells to troglitazone, LG268, or both ligands markedly increased adipophilin RNA expression, providing further support to the influence of PPAR{gamma}/RXR on adipophilin gene expression.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 5. Regulation of adipophilin RNA by PPAR{gamma} and RXR agonists. Trophoblasts were plated in the presence or absence of troglitazone (10 µM) and/or LG268 (0.1 µM). Ligands were added after 4 h in culture (defined as 0 h) and cells harvested after either 24, 48, or 72 h time points. RNA was isolated and quantified using real-time quantitative PCR as detailed in Materials and Methods. Each experiment was performed in duplicate and repeated at least twice. The difference between each ligand and control at each time point was significant at P < 0.05.

 
PPAR{gamma} regulates the transcriptional activity of diverse genes (46) and increases the level of placental adipophilin mRNA. We therefore sought to examine the effect of PPAR{gamma} on adipophilin promoter. For this purpose we used the human genome database (GenBank) to clone the adipophilin promoter from 5' promoter sequences (-2381/+117) within contig NT037733.1, as described in Materials and Methods. This fragment was then cloned into pGL3-basic to generate the adipophilin-luciferase reporter construct. We initially transfected the adipophilin-luc reporter plasmid into CV-1 cells, an undifferentiated line derived from monkey kidney cells, selected because of absent endogenous PPAR{gamma} expression. Although basal activity was higher than the activity of the parental pGL3 vector, we found that neither troglitazone nor LG268 influenced reporter activity (Fig. 6AGo). In contrast, upon cotransfection of PPAR{gamma} into CV-1 cells, we observed a greater than 2-fold stimulation of reporter activity by either troglitazone or LG268, with even greater activity when both ligands were present (Fig. 6AGo). We repeated these experiments in JEG3 cells, which express RXR as well as a low level of PPAR{gamma} (43, 44, 45). As shown in Fig. 6BGo, in the absence of cotransfected PPAR{gamma} the activity of adipophilin promoter was not stimulated by troglitazone but was stimulated by LG268. Similar to the results with CV-1 cells, cotransfection of PPAR{gamma} into JEG3 cells resulted in enhancement of adipophilin reporter activity by either troglitazone or LG268, with a higher degree of activity using both ligands simultaneously (Fig. 6BGo). These results suggest that PPAR{gamma} and RXR up-regulate the transcription of adipophilin promoter.



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 6. Regulation of adipophilin promoter by PPAR{gamma} and RXR agonists. A, CV-1 cells were transfected with the reporter plasmid pGL3 or pGL3-adipophilin-Luc, as well as pCDNA3.1 or pCDNA3.1-PPAR{gamma}, as shown in the figure and described in Materials and Methods. Cells were exposed to troglitazone (10 µM) and/or LG268 (0.1 µM) for 24 h before being assayed for luciferase activity. Results (mean ± SD), normalized to ß-galactosidase activity, are expressed as relative luciferase activity (cRLU), and represent three to four independent experiments, each performed in duplicate. A, Regulation of adipophilin promoter in CV-1 cells. B, Regulation of adipophilin promoter in JEG3 cells. {ddagger}, P < 0.05, compared with all ligands. *, P < 0.05, compared with no ligand control.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
PPAR{gamma} plays a pivotal role in differentiation of murine and human placental trophoblasts (25, 26, 27, 28). PPAR{gamma} also regulates fatty acid metabolism in adipocytes through induction of genes that govern fatty acid uptake, storage, and metabolism (21, 22). Building on these observations, we studied the expression of adipophilin, a lipid droplet-associated protein, in term human trophoblasts, and determined the role of PPAR{gamma} in this process. We initially demonstrated that adipophilin is expressed in human placental villous trophoblasts in vivo as well as in cultured primary trophoblast cells in vitro. This observation adds the trophoblasts to several other steroid-producing cells known to express adipophilin (15, 16). Using immunohistochemical analysis, we localized the highest expression of adipophilin to the trophoblast microvillous membrane. This surface, which is bathed in maternal blood, is positioned to mediate uptake of nutrients, including fatty acids, to the developing fetoplacental unit (47). Because adipophilin and its murine ortholog ADRP are associated with lipid droplets and implicated in facilitating cellular fatty acid uptake and storage of neutral lipids in adipocytes (16, 17, 20), it is likely that adipophilin plays a role in placental fatty acid uptake and transport. In addition, we found that the expression of adipophilin increased during cytotrophoblast differentiation into syncytiotrophoblast in vitro. Consistent with our observation, Tarrade et al. (48) demonstrated an increase in accumulation of fatty acids in differentiated syncytiotrophoblasts, compared with cytotrophoblasts, providing further support to the potential role of adipophilin in fatty acid uptake by trophoblasts. Interestingly, the expression of ADRP mRNA is induced very early during adipocyte differentiation (8, 13). We determined that adipophilin mRNA was expressed as early as 4 h of trophoblast culture, and its level was reduced afterward. Whereas differentiation of 3T3-L1 adipocytes was accompanied by a decrease in levels of ADRP protein (15), we found that the expression of adipophilin protein was enhanced during 72 h in culture. This finding may point to regulation of adipophilin protein at the level of translation or protein degradation.

We also demonstrated that troglitazone-activated PPAR{gamma} enhances adipophilin expression. We made a similar observation in a microarray screen for PPAR{gamma} targets in trophoblasts (36 , and Roh, C. R. and Y. Sadovsky, manuscript in preparation). These findings correspond to the central role of PPAR{gamma} in adipogenesis, glucose homeostasis, and trophoblast differentiation (25, 26, 27, 31, 34, 35) and supported by Buechler et al. (49), who demonstrated the induction of adipophilin mRNA by PPAR{gamma} agonists in human blood monocytes. The expression pattern of adipophilin in human placental villi largely parallels that of PPAR{gamma}, which is expressed primarily in trophoblasts and mostly absent from villous mesenchymal core (27, 28, 48). Interestingly, another member of the PPAR family of proteins, PPAR{delta}, also enhances the expression of adipophilin and other fatty acid transporters in the THP-1 monocytic cell line, and up-regulates uptake of fatty acids in these cells (50).

PPAR{gamma} and RXR heterodimers coregulate diverse aspects of placental development and function. For example, PPAR{gamma} and RXR modulate invasion of human trophoblasts and up-regulate the expression of total human chorionic gonadotropin as well as human chorionic gonadotropin ß-subunit (48, 51). Consistent with this notion, we found that the selective RXR ligand LG268 enhances adipophilin expression in cultured human trophoblasts, thus supporting the proadipogenic effect of PPAR{gamma} (52, 53). The effect of LG268 was concentration dependent, with maximum effect at 0.01–0.1 µM. It is possible that a high concentration of LG268 exhibit nonspecific influence on trophoblasts, thus mitigating the enhancement of adipophilin expression. Whereas deficiency of either PPAR{gamma} or RXR{alpha} results in a similar defect in the placental labyrinthine zone, the defect in PPAR{gamma}-/- mice manifests before embryonic d 10.5, and that of RXR{alpha}-/- mice is observed after embryonic d 12.5 (54, 55, 56). Null mutations of both RXR{alpha} and RXRß results in embryonic death by embryonic d 10.5, with a defect similar to that of PPAR{gamma} (57). Together, these results point to the functional interaction of PPAR{gamma} and RXR in regulation of placental development and to partial redundancy between the RXR isoforms.

The transcriptional mechanisms that regulate adipophilin expression are presently unknown. Although in an initial scan of our promoter fragment we could not identify the presence of canonical PPAR{gamma} binding elements, our results indicate that PPAR{gamma} and RXR play a role in regulating adipophilin promoter. It is possible that this regulation reflects interaction of PPAR{gamma}/RXR with additional DNA binding proteins. In our studies we used CV-1 cells, which express RXR endogenously (58). We also used JEG3 cells, which express a relatively low level of PPAR{gamma} as well as a high level of RXR (43, 44, 45, 59). Whereas the influence of endogenous RXR on adipophilin promoter in JEG3 was apparent, overexpression of PPAR{gamma} was needed to uncover the influence of troglitazone on this promoter. Further confirmation of the role of PPAR{gamma} and RXR in regulating adipophilin gene expression awaits detailed promoter analysis in primary trophoblasts.


   Acknowledgments
 
We thank Elena Sadovsky, K. Beth Mattingly, and Lori Rideout for their assistance during these studies. We also thank Mark Leibowitz and Andres Negro-Vilar from Ligand Pharmaceuticals for generously providing LG268 and Tom Mariani for the human PPAR{gamma} expression plasmid.


   Footnotes
 
This work was supported by TUBITAK 1528-3208 (to I.B.), National Institutes of Health-Building Interdisciplinary Research Careers in Women’s Health (to W.T.S., a part of K12 HD 01459), NIH HD-29190 (to D.M.N.) and NIH ES-11597 (to Y.S.).

This study was presented, in part, at the 50th Annual Meeting of the Society for Gynecologic Investigation, Washington, D.C., March 2003.

Abbreviations: ADRP, Adipose differentiation-related protein; Ct, threshold cycle; {Delta}Ct, Ct values; PPAR{gamma}, peroxisome proliferator-activated receptor-{gamma}; RXR, retinoid X receptor.

Received April 11, 2003.

Accepted August 26, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Herrera E, Bonet B, Lasunción A 1998 Maternal-fetal transfer of lipid metabolites. In: Polin RA, Fox WW, eds. Fetal and neonatal physiology, 2nd ed. Philadelphia: W. B. Saunders; 447–458
  2. Rothwell JE, Elphick MC 1982 Lipoprotein lipase activity in human and guinea-pig placenta. J Dev Physiol 4:153–159[Medline]
  3. Shafrir E, Barash V 1987 Placental function in maternal-fetal fat transport in diabetes. Biol Neonate 51:102–112[Medline]
  4. Kaminsky S, Sibley CP, Maresh M, Thomas CR, D’Souza SW 1991 The effects of diabetes on placental lipase activity in the rat and human. Pediatr Res 30:541–543[Medline]
  5. Campbell FM, Dutta-Roy AK 1995 Plasma membrane fatty acid-binding protein (FABPpm) is exclusively located in the maternal facing membranes of the human placenta. FEBS Lett 375:227–230[CrossRef][Medline]
  6. Campbell FM, Bush PG, Veerkamp JH, Dutta-Roy AK 1998 Detection and cellular localization of plasma membrane-associated and cytoplasmic fatty acid-binding proteins in human placenta. Placenta 19:409–415[Medline]
  7. Dutta-Roy AK 2000 Transport mechanisms for long-chain polyunsaturated fatty acids in the human placenta. Am J Clin Nutr 71:315S–322S
  8. Jiang HP, Serrero G 1992 Isolation and characterization of a full-length cDNA coding for an adipose differentiation-related protein. Proc Natl Acad Sci USA 89:7856–7860[Abstract/Free Full Text]
  9. Greenberg AS, Egan JJ, Wek SA, Moos Jr MC, Londos C, Kimmel AR 1993 Isolation of cDNAs for perilipins A and B: sequence and expression of lipid droplet-associated proteins of adipocytes. Proc Natl Acad Sci USA 90:12035–12039[Abstract/Free Full Text]
  10. Diaz E, Pfeffer SR 1998 TIP47: a cargo selection device for mannose 6-phosphate receptor trafficking. Cell 93:433–443[CrossRef][Medline]
  11. Than NG, Sumegi B, Than GN, Kispal G, Bohn H 1998 Cloning and sequence analysis of cDNAs encoding human placental tissue protein 17 (PP17) variants. Eur J Biochem 258:752–757[Medline]
  12. Scherer PE, Bickel PE, Kotler M, Lodish HF 1998 Cloning of cell-specific secreted and surface proteins by subtractive antibody screening. Nat Biotechnol 16:581–586[CrossRef][Medline]
  13. Eisinger DP, Serrero G 1993 Structure of the gene encoding mouse adipose differentiation-related protein (ADRP). Genomics 16:638–644[CrossRef][Medline]
  14. Heid HW, Schnolzer M, Keenan TW 1996 Adipocyte differentiation-related protein is secreted into milk as a constituent of milk lipid globule membrane. Biochem J 320(Pt 3):1025–1030.
  15. Brasaemle DL, Barber T, Wolins NE, Serrero G, Blanchette-Mackie EJ, Londos C 1997 Adipose differentiation-related protein is an ubiquitously expressed lipid storage droplet-associated protein. J Lipid Res 38:2249–2263[Abstract]
  16. Heid HW, Moll R, Schwetlick I, Rackwitz HR, Keenan TW 1998 Adipophilin is a specific marker of lipid accumulation in diverse cell types and diseases. Cell Tissue Res 294:309–321[CrossRef][Medline]
  17. Gao J, Ye H, Serrero G 2000 Stimulation of adipose differentiation related protein (ADRP) expression in adipocyte precursors by long-chain fatty acids. J Cell Physiol 182:297–302[CrossRef][Medline]
  18. Blanchette-Mackie EJ, Dwyer NK, Barber T, Coxey RA, Takeda T, Rondinone CM, Theodorakis JL, Greenberg AS, Londos C 1995 Perilipin is located on the surface layer of intracellular lipid droplets in adipocytes. J Lipid Res 36:1211–1226[Abstract]
  19. Servetnick DA, Brasaemle DL, Gruia-Gray J, Kimmel AR, Wolff J, Londos C 1995 Perilipins are associated with cholesteryl ester droplets in steroidogenic adrenal cortical and Leydig cells. J Biol Chem 270:16970–16973[Abstract/Free Full Text]
  20. Gao J, Serrero G 1999 Adipose differentiation related protein (ADRP) expressed in transfected COS-7 cells selectively stimulates long chain fatty acid uptake. J Biol Chem 274:16825–16830[Abstract/Free Full Text]
  21. Chawla A, Schwarz EJ, Dimaculangan DD, Lazar MA 1994 Peroxisome proliferator-activated receptor (PPAR) {gamma}: adipose-predominant expression and induction early in adipocyte differentiation. Endocrinology 135:798–800[Abstract]
  22. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf DJ, Umesono K, Evans RM 1994 Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci USA 91:7355–7359[Abstract/Free Full Text]
  23. Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans RM 1998 PPAR{gamma} promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell 93:241–252[CrossRef][Medline]
  24. Nagy L, Tontonoz P, Alvarez JG, Chen H, Evans RM 1998 Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR{gamma}. Cell 93:229–240[CrossRef][Medline]
  25. Barak Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozano P, Chien KR, Koder A, Evans RM 1999 PPAR{gamma} is required for placental, cardiac, and adipose tissue development. Mol Cell 4:585–595[CrossRef][Medline]
  26. Kubota N, Terauchi Y, Miki H, Tamemoto H, Yamauchi T, Komeda K, Satoh S, Nakano R, Ishii C, Sugiyama T, Eto K, Tsubamoto Y, Okuno A, Murakami K, Sekihara H, Hasegawa G, Naito M, Toyoshima Y, Tanaka S, Shiota K, Kitamura T, Fujita T, Ezaki O, Aizawa S, Kadowaki T, et al 1999 PPAR{gamma} mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol Cell 4:597–609[CrossRef][Medline]
  27. Schaiff WT, Carlson MG, Smith SD, Levy R, Nelson DM, Sadovsky Y 2000 Peroxisome proliferator-activated receptor-{gamma} modulates differentiation of human trophoblast in a ligand-specific manner. J Clin Endocrinol Metab 85:3874–3881[Abstract/Free Full Text]
  28. Waite LL, Person EC, Zhou Y, Lim K-H, Scanlan TH, Taylor RN 2000 Placental peroxisome proliferator-activated receptor-{gamma} is up-regulated by pregnancy serum. J Clin Endocrinol Metab 85:3808–3814[Abstract/Free Full Text]
  29. Kliewer SA, Sundseth SS, Jones SA, Brown PJ, Wisely GB, Koble CS, Devchand P, Wahli W, Willson TM, Lenhard JM, Lehmann JM 1997 Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors {alpha} and {gamma}. Proc Natl Acad Sci USA 94:4318–4323[Abstract/Free Full Text]
  30. Kliewer SA, Lenhard JM, Willson TM, Patel I, Morris DC, Lehmann JM 1995 A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor {gamma} and promotes adipocyte differentiation. Cell 83:813–819[CrossRef][Medline]
  31. Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM 1995 15-Deoxy-{Delta}12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR{gamma}. Cell 83:803–812[CrossRef][Medline]
  32. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). J Biol Chem 270:12953–12956[Abstract/Free Full Text]
  33. Willson TM, Cobb JE, Cowan DJ, Wiethe RW, Correa ID, Prakash SR, Beck KD, Moore LB, Kliewer SA, Lehmann JM 1996 The structure-activity relationship between peroxisome proliferator-activated receptor {gamma} agonism and the antihyperglycemic activity of thiazolidinediones. J Med Chem 39:665–668[CrossRef][Medline]
  34. Tontonoz P, Hu E, Spiegelman BM 1994 Stimulation of adipogenesis in fibroblasts by PPAR{gamma} 2, a lipid-activated transcription factor. Cell 79:1147–1156[CrossRef][Medline]
  35. Schild RL, Schaiff WT, Carlson MG, Cronbach EJ, Nelson DM, Sadovsky Y 2002 The activity of PPAR gamma in primary human trophoblasts is enhanced by oxidized lipids. J Clin Endocrinol Metab 87:1105–1110[Abstract/Free Full Text]
  36. Mariani TJ, Budhraja V, Mecham BH, Gu CC, Watson MA, Sadovsky Y 2003 A variable fold change threshold determines significance for expression microarrays. FASEB J 17:321–323[Abstract/Free Full Text]
  37. Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss JM 1986 Purification, characterization and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology 118:1567–1582[Abstract/Free Full Text]
  38. Nelson DM, Johnson RD, Smith SD, Anteby EY, Sadovsky Y 1999 Hypoxia limits differentiation and up-regulates expression and activity of prostaglandin H synthase 2 in cultured trophoblast from term human placenta. Am J Obstet Gynecol 180:896–902[CrossRef][Medline]
  39. Huang JT, Welch JS, Ricote M, Binder CJ, Willson TM, Kelly C, Witztum JL, Funk CD, Conrad D, Glass CK 1999 Interleukin-4-dependent production of PPAR-{gamma} ligands in macrophages by 12/15-lipoxygenase. Nature 400:378–382[CrossRef][Medline]
  40. Chen C, Okayama H 1987 High-efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol 7:2745–2752[Abstract/Free Full Text]
  41. Kliewer SA, Umesono K, Mangelsdorf DJ, Evans RM 1992 Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature 355:446–449[CrossRef][Medline]
  42. Kliewer SA, Umesono K, Noonan DJ, Heyman RA, Evans RM 1992 Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors. Nature 358:771–774[CrossRef][Medline]
  43. Stephanou A, Sarlis NJ, Richards R, Handwerger S 1994 Expression of retinoic acid receptor subtypes and cellular retinoic acid binding protein-II mRNAs during differentiation of human trophoblast cells. Biochem Biophys Res Commun 202:772–780[CrossRef][Medline]
  44. Guibourdenche J, Alsat E, Soncin F, Rochette-Egly C, Evain-Brion D 1998 Retinoid receptors expression in human term placenta: involvement of RXR alpha in retinoid-induced hCG secretion. J Clin Endocrinol Metab 83:1384–1387[Abstract/Free Full Text]
  45. Wang Q, Fujii H, Knipp GT 2002 Expression of PPAR and RXR isoforms in the developing rat and human term placentas. Placenta 23:661–671[CrossRef][Medline]
  46. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  47. Haggarty P 2002 Placental regulation of fatty acid delivery and its effect on fetal growth—a review. Placenta 23(Suppl A):S28–S38
  48. Tarrade A, Schoonjans K, Guibourdenche J, Bidart JM, Vidaud M, Auwerx J, Rochette-Egly C, Evain-Brion D 2001 PPAR{gamma}/RXR{alpha} heterodimers are involved in human CGß synthesis and human trophoblast differentiation. Endocrinology 142:4504–4514[Abstract/Free Full Text]
  49. Buechler C, Ritter M, Duong CQ, Orso E, Kapinsky M, Schmitz G 2001 Adipophilin is a sensitive marker for lipid loading in human blood monocytes. Biochim Biophys Acta 1532:97–104[Medline]
  50. Vosper H, Patel L, Graham TL, Khoudoli GA, Hill A, Macphee CH, Pinto I, Smith SA, Suckling KE, Wolf CR, Palmer CN 2001 The peroxisome proliferator-activated receptor {delta} promotes lipid accumulation in human macrophages. J Biol Chem 276:44258–44265[Abstract/Free Full Text]
  51. Tarrade A, Schoonjans K, Pavan L, Auwerx J, Rochette-Egly C, Evain-Brion D, Fournier T 2001 PPAR{gamma}/RXR{alpha} heterodimers control human trophoblast invasion. J Clin Endocrinol Metab 86:5017–5024[Abstract/Free Full Text]
  52. Mukherjee R, Davies PJ, Crombie DL, Bischoff ED, Cesario RM, Jow L, Hamann LG, Boehm MF, Mondon CE, Nadzan AM, Paterniti Jr, Heyman RA 1997 Sensitization of diabetic and obese mice to insulin by retinoid X receptor agonists. Nature 386:407–410[CrossRef][Medline]
  53. Tontonoz P, Singer S, Forman BM, Sarraf P, Fletcher JA, Fletcher CD, Brun RP, Mueller E, Altiok S, Oppenheim H, Evans RM, Spiegelman BM 1997 Terminal differentiation of human liposarcoma cells induced by ligands for peroxisome proliferator-activated receptor gamma and the retinoid X receptor. Proc Natl Acad Sci USA 94:237–241[Abstract/Free Full Text]
  54. Kastner P, Grondona JM, Mark M, Gansmuller A, LeMeur M, Decimo D, Vonesch JL, Dolle P, Chambon P 1994 Genetic analysis of RXR{alpha} developmental function: convergence of RXR and RAR signaling pathways in heart and eye morphogenesis. Cell 78:987–1003[CrossRef][Medline]
  55. Sucov HM, Dyson E, Gumeringer CL, Price J, Chien KR, Evans RM 1994 RXR{alpha} mutant mice establish a genetic basis for vitamin A signaling in heart morphogenesis. Genes Dev 8:1007–1018[Abstract/Free Full Text]
  56. Sapin V, Dolle P, Hindelang C, Kastner P, Chambon P 1997 Defects of the chorioallantoic placenta in mouse RXR{alpha} null fetuses. Dev Biol 191:29–41[CrossRef][Medline]
  57. Wendling O, Chambon P, Mark M 1999 Retinoid X receptors are essential for early mouse development and placentogenesis. Proc Natl Acad Sci USA 96:547–551[Abstract/Free Full Text]
  58. Nunez SB, Medin JA, Braissant O, Kemp L, Wahli W, Ozato K, Segars JH 1997 Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor. Mol Cell Endocrinol 127:27–40[CrossRef][Medline]
  59. Guibourdenche J, Roulier S, Rochette-Egly C, Evain-Brion D 1998 High retinoid X receptor expression in JEG-3 choriocarcinoma cells: involvement in cell function modulation by retinoids. J Cell Physiol 176:595–601[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
B. Fan, S. Ikuyama, J.-Q. Gu, P. Wei, J.-i. Oyama, T. Inoguchi, and J. Nishimura
Oleic acid-induced ADRP expression requires both AP-1 and PPAR response elements, and is reduced by Pycnogenol through mRNA degradation in NMuLi liver cells
Am J Physiol Endocrinol Metab, July 1, 2009; 297(1): E112 - E123.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
A. Bugge, L. Grontved, M. M. Aagaard, R. Borup, and S. Mandrup
The PPAR{gamma}2 A/B-Domain Plays a Gene-Specific Role in Transactivation and Cofactor Recruitment
Mol. Endocrinol., June 1, 2009; 23(6): 794 - 808.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
E. Capobianco, V. White, R. Higa, N. Martinez, and A. Jawerbaum
Effects of natural ligands of PPAR{gamma} on lipid metabolism in placental tissues from healthy and diabetic rats
Mol. Hum. Reprod., August 1, 2008; 14(8): 491 - 499.
[Abstract] [Full Text] [PDF]

Home page
 Reproductive SciencesHome page
B.-Y. Kang, S. Tsoi, Shan Zhu, Shenghui Su, and H. H. Kay
Differential Gene Expression Profiling in HELLP Syndrome Placentas
Reproductive Sciences, March 1, 2008; 15(3): 285 - 294.
[Abstract] [PDF]

Home page
 Biol. Reprod.Home page
J. A Desmarais, F. L Lopes, H. Zhang, S. K Das, and B. D Murphy
The Peroxisome Proliferator-Activated Receptor Gamma Regulates Trophoblast Cell Differentiation in Mink (Mustela vison)
Biol Reprod, November 1, 2007; 77(5): 829 - 839.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
W. T. Schaiff, F. F. Knapp Jr., Y. Barak, T. Biron-Shental, D. M. Nelson, and Y. Sadovsky
Ligand-Activated Peroxisome Proliferator Activated Receptor {gamma} Alters Placental Morphology and Placental Fatty Acid Uptake in Mice
Endocrinology, August 1, 2007; 148(8): 3625 - 3634.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
R. Nielsen, L. Grontved, H. G. Stunnenberg, and S. Mandrup
Peroxisome Proliferator-Activated Receptor Subtype- and Cell-Type-Specific Activation of Genomic Target Genes upon Adenoviral Transgene Delivery
Mol. Cell. Biol., August 1, 2006; 26(15): 5698 - 5714.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
K. T. Dalen, S. M. Ulven, B. M. Arntsen, K. Solaas, and H. I. Nebb
PPAR{alpha} activators and fasting induce the expression of adipose differentiation-related protein in liver
J. Lipid Res., May 1, 2006; 47(5): 931 - 943.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
K. Nadra, S. I. Anghel, E. Joye, N. S. Tan, S. Basu-Modak, D. Trono, W. Wahli, and B. Desvergne
Differentiation of Trophoblast Giant Cells and Their Metabolic Functions Are Dependent on Peroxisome Proliferator-Activated Receptor {beta}/{delta}
Mol. Cell. Biol., April 15, 2006; 26(8): 3266 - 3281.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
K. A. R. Tobin, N. K. Harsem, K. T. Dalen, A. C. Staff, H. I. Nebb, and A. K. Duttaroy
Regulation of ADRP expression by long-chain polyunsaturated fatty acids in BeWo cells, a human placental choriocarcinoma cell line
J. Lipid Res., April 1, 2006; 47(4): 815 - 823.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
B. H.-J. Chang, L. Li, A. Paul, S. Taniguchi, V. Nannegari, W. C. Heird, and L. Chan
Protection against Fatty Liver but Normal Adipogenesis in Mice Lacking Adipose Differentiation-Related Protein
Mol. Cell. Biol., February 1, 2006; 26(3): 1063 - 1076.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
W. T. Schaiff, I. Bildirici, M. Cheong, P. L. Chern, D. M. Nelson, and Y. Sadovsky
Peroxisome Proliferator-Activated Receptor-{gamma} and Retinoid X Receptor Signaling Regulate Fatty Acid Uptake by Primary Human Placental Trophoblasts
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4267 - 4275.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bildirici, I.
Right arrow Articles by Sadovsky, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bildirici, I.
Right arrow Articles by Sadovsky, Y.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals