help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Orio, F.
Right arrow Articles by Lombardi, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Orio, F., Jr.
Right arrow Articles by Lombardi, G.
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 12 5887-5892
Copyright © 2003 by The Endocrine Society

Exon 6 and 2 Peroxisome Proliferator-Activated Receptor-{gamma} Polymorphisms in Polycystic Ovary Syndrome

Francesco Orio, Jr., Giuseppe Matarese, Sebastiano Di Biase, Stefano Palomba, Donato Labella, Veronica Sanna, Silvia Savastano, Fulvio Zullo, Annamaria Colao and Gaetano Lombardi

Department of Molecular & Clinical Endocrinology and Oncology (F.O., S.S., A.C., G.L.), University "Federico II", 80131 Naples, Italy; Immunoendocrinology Group (G.M., V.S.), Institute of Endocrinology and Experimental Oncology, National Research Council, 80131 Naples, Italy; MeriGen Molecular Biology Laboratory (S.D.B., D.L.), 80131 Naples, Italy; and Chair of Obstetrics and Gynecology (S.P., F.Z.), University of Catanzaro "Magna Graecia", 88100 Catanzaro, Italy

Address all correspondence and requests for reprints to: Dr. Francesco Orio, Via Giovanni Santoro 14, 84123 Salerno, Italy. E-mail: f.orio{at}tin.it.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Obesity affects about 44% of women with polycystic ovary syndrome (PCOS). Peroxisome proliferator-activated receptor-{gamma} (PPAR-{gamma}) is one of the genes involved in the differentiation of adipose tissue. In an attempt to shed light on the high percentage of obesity in PCOS, we examined polymorphisms at exons 6 and 2 of the PPAR-{gamma} gene in 100 PCOS patients and in 100 healthy controls matched for age and body mass index (BMI). The T allele frequency of exon 6 was significantly higher (P < 0.05) in PCOS patients compared with control women. In addition, the BMI and leptin levels were significantly higher (P < 0.05) in PCOS patients carrying the C->T substitution than in controls. There was no significant difference in leptin levels after normalization for BMI. The Pro12Ala polymorphism at exon 2 was unrelated to BMI and/or leptin levels in PCOS women. In conclusion, the higher frequency of the C->T substitution in exon 6 of the PPAR-{gamma} gene in PCOS women suggests that it plays a role in the complex pathogenetic mechanism of obesity in PCOS, whereas the Pro12Ala polymorphism does not seem to affect BMI in PCOS women.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
POLYCYSTIC OVARY SYNDROME (PCOS) is a widespread endocrine-metabolic disorder characterized by obesity, hyperandrogenism, and insulin resistance (1). Although it primarily affects fertility, PCOS is a plurimetabolic syndrome (2). Obesity, which is a complex metabolic disorder with a strong genetic component (3), affects about 44% of PCOS women (4). Many determinants and/or genetic factors are involved in adipocyte differentiation (5), among which is peroxisome proliferator-activated receptor-{gamma} (PPAR-{gamma}) (6, 7, 8, 9).

PPAR-{gamma} is expressed mainly in adipose tissue and is also involved in lipid and glucose metabolism (9). It is a candidate gene for the development of obesity and regulation of adipose tissue metabolism in humans (10, 11). Because single gene defects are very rarely associated with obesity (12), it is likely that a combination of polymorphisms in one or more candidate genes may contribute to the development of obesity (13). In fact, enhanced PPAR-{gamma} signaling, owing to a mutation that increases its intrinsic activity, is associated with human obesity (14).

A body of evidence implicates PPAR-{gamma} gene variants in metabolic disorders (15, 16, 17, 18). A silent C->T substitution in exon 6 of the PPAR-{gamma} gene affects plasma leptin levels in obese humans (15). PPAR-{gamma} is a susceptibility gene for both diabetes and obesity (16). Moreover, the Pro12Ala variant in PPAR-{gamma} exon 2 is associated with an increased body mass index (BMI) (17) and attenuated insulin resistance (18).

Numerous genes have been tested in relation to the etiopathogenesis of PCOS (19). Moreover, the mechanism and cause of obesity in this syndrome are unknown. In an attempt to understand the high percentage of obesity in PCOS, we examined polymorphisms in exons 6 and 2 of the PPAR-{gamma} gene in patients affected by PCOS and in healthy women.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects

One hundred women with PCOS and 100 healthy young volunteer females, matched for age and BMI, were enrolled in this case-control study protocol.

PCOS was diagnosed from anovulatory infertility (confirmed by luteal progesterone assay), normal serum FSH levels (normal range, 1.0–10.0 IU/liter), and at least two of the following: hirsutism (Ferriman and Gallwey score > 8) (20); elevated serum androgen levels [total testosterone (T) > 2 nmol/liter); and/or androstenedione (A) above 15 nmol/liter; and/or dehydroepiandrosterone sulfate (DHEA-S) above 10 µmol/liter; a LH/FSH ratio above 2; and polycystic ovaries identified with transvaginal ultrasonography (TV-USG) (21). All patients fulfilled the National Institute of Child Health and Human Development criteria for PCOS (22).

The healthy state of the controls was determined by medical history, physical and pelvic examination, and blood chemistry tests. Their normal ovulatory state was confirmed by TV-USG and plasma progesterone (P) levels during the luteal phase of the cycle. Women with clinical and/or biochemical hyperandrogenism were excluded from the control group. The controls were not genetically related to the PCOS group.

Exclusion criteria for both groups were pregnancy, hypothyroidism, hyperprolactinemia, Cushing’s syndrome, nonclassical congenital adrenal hyperplasia, and current or previous (within the last 6 months) use of oral contraceptives, glucocorticoids, antiandrogens, ovulation induction agents, antidiabetic and antiobesity drugs, and other hormonal drugs. Subjects with glucose intolerance, as evaluated according to World Health Organization criteria (23) with the oral glucose tolerance test (OGTT), were excluded from the study. No patient had diabetes, or renal, neoplastic, metabolic, hepatic, cardiovascular, or malabsorptive disorders. All subjects were nonsmokers and had a normal physical activity level, and none drank alcoholic beverages.

Hyperprolactinemia was diagnosed when a single assay showed a serum prolactin (PRL) concentration below 25 ng/ml (24). It was excluded when the average of three serum PRL measurements, taken at 15-min intervals starting at 0800 h, was above 25 ng/ml. Nonclassical congenital adrenal hyperplasia was excluded with a single assay of serum 17-hydroxyprogesterone (17 OH-P) levels (normal value less than 6.0 nmol/liter) (25).

Study protocol

The procedures used in this study were in accordance with the guidelines of the Helsinki Declaration on human experimentation. The Institutional Review Board of the University of Naples "Federico II" approved the study. The purpose of the protocol was explained to patients and control women, and written consent was obtained from them before beginning the study.

At study entry, venous blood was withdrawn from both groups for the genetic study and for hormonal (including leptin), lipid profile, glucose, insulin, and homocysteine assays. Glucose and insulin values were measured also after the OGTT. Blood samples were obtained between 0800 and 0900 h after an overnight fast with the individual resting in bed, during the early follicular phase (second to fifth days) of the spontaneous or progesterone-induced menstrual cycle. During the same visit, subjects underwent TV-USG, anthropometric measurements, including BMI (kilograms per square meter), and waist-to-hip ratio (WHR), systolic and diastolic blood pressure, adiponectin measurements (26), echocardiographic assessment, and echocolor-Doppler with evaluation of intima media thickness.

Herein we report the results concerning PPAR-{gamma} exons 6 and 2 and the hormonal assessment.

Biochemical assay

The following hormone levels were measured in basal blood samples: LH, FSH, 17ß-estradiol (E2), P, T, A, DHEA-S, PRL, TSH, and SHBG. Blood samples for each woman were assayed in duplicate and immediately centrifuged, and the serum was stored at -80 C until analysis. The mean of two hormonal results was calculated.

Plasma PRL, LH, TSH, FSH, E2, P, T, A, and DHEA-S were measured by specific RIA, as previously described (24, 27). Serum 17 OH-P levels were determined with a RIA (Diagnostic Systems Laboratories 5000, Webster, TX) that has a sensitivity of 0.5 nmol/liter and intraassay and interassay coefficients of variation (CV) of 8.9 and 9.0%, respectively (25). Levels of SHBG were measured with an immunoradiometric assay (Radim S.p.A, Pomezia, Rome, Italy) that has a sensitivity of 2.5 nmol/liter and intraassay and interassay CV of 5.1 and 5.2%, respectively (28). Leptin concentrations were determined with human leptin ELISA kits (Alexis Corporation, Laüfelfingen, Switzerland) and calculated from standard curves generated for each assay using recombinant human leptin, according to the manufacturer’s instructions, with the four- parameter function (29). The minimum detection limit of the assay was 0.2 ng/ml. The intra- and interassay CV were below 5%. Samples were measured in duplicate at 450 nm, using an ELISA plate reader (Bio-Rad Laboratories, Inc., Hercules, CA).

Glucose and insulin concentrations were measured 30 min after insertion of the iv catheter to evaluate the fasting levels (time 0) before OGTT. Successively, each subject received a 75-g glucose oral load. Other blood samples (10 ml each) were obtained at 30-min intervals for the next 3 h during infusion (at 30, 60, 90, and 120 min), and glucose and insulin concentrations were determined. Plasma glucose levels were determined by the glucose oxidase method on a Beckman Glucose Analyzer (Beckman Coulter, Inc., Fullerton, CA) that has a sensitivity of 0.3 mmol/liter, and intraassay and interassay CV of 1.0 and 1.2%, respectively. Serum insulin was measured by a solid-phase chemiluminescent enzyme immunoassay using commercially available kits (Immunolite Diagnostic Products Co, Los Angeles, CA) that have a sensitivity of 2.0 µU/ml and intraassay and interassay CV of 5.5 and 5.8%, respectively. The glucose and insulin response to the OGTT was also analyzed by calculating the area under curve (AUC). The AUCs for glucose (AUCglucose) and insulin (AUCinsulin) were determined according to the Tai procedure (30) for the metabolic curves. The AUCglucose/AUCinsulin ratio was also calculated (31).

DNA analysis

Blood samples were collected in tubes containing disodium-EDA as anticoagulant and stored at 4 C until DNA extraction. DNA was extracted by the salt phenol chloroform method from the buffy coat cells (32). The extracted DNA was stored at -20 C until analysis. We used the restriction fragment length polymorphism technique and the PCR to examine the C to T substitution in exon 6 of the PPAR-{gamma} gene. The primers used for exon 6 (5'CCAGAAAATGACAGACCTCAGACA3' forward and 5'CAGAATAGTGCAACTGGAAGAAGG3' reverse) generated a 181-bp DNA fragment. The C sequence is recognized by the PmlI restriction enodonulease, which digested the 181-bp fragment into 142- and 39-bp fragments. The most common allele has a C residue at 142 bp, whereas the variant allele has a T at this position. Exon 2 of the PPAR-{gamma} gene was amplified by PCR using the primers G2F (5'CTGATGTCTTGACTCATGGG3') and G2R (GGAAGACAAACTACAAGAGC3'). The 295-bp PCR product was digested overnight with HgaI, which cleaves the G allele to generate two DNA fragments of 178 and 117 bp, respectively (18). The DNA fragments and the PCR products were separated on 3% agarose gel electrophoresis and visualized under UV light after ethidium bromide staining. Genotypes were expressed in exon 6 as CC, CT, and TT for homozygous normal, heterozygous, and homozygous mutant, respectively, and in exon 2 as CC and CG for homozygous normal and heterozygous, respectively.

Statistical analysis

The data were analyzed with the SPSS 11.0 (SPSS Inc., Chicago, IL) package. Continuous data were expressed as mean ± SD. A P < 0.05 value was considered statistically significant. The demographic characteristics and the hormone concentrations in the two groups were compared by the Student t test for unpaired data. The data between and within the PPAR-{gamma} genotype groups were compared by ANOVA. The Student t test for unpaired data was also used to evaluate the differences in mean serum leptin levels between the PCOS and control groups. Allelic and genotypic frequencies were determined from observed genotype counts. Differences in the allelic and genotypic frequencies of exons 6 and 2 PPAR-{gamma} polymorphisms were assessed by the one- sized Fisher’s exact test when appropriate. The differences in mean AUCglucose, AUCinsulin, and the AUCglucose/AUCinsulin ratio after OGTT between and within the different groups of PPAR-{gamma} genotypes were studied with ANOVA. A multivariate two-way ANOVA was also used to evaluate the possible interactions between variables.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Table 1Go shows the clinical and biochemical diagnostic features of the PCOS group. Table 2Go shows the demographic, hormonal, and metabolic characteristics of the PCOS patients and controls. Both groups were Caucasians of European ancestry (Campania region, southern Italy). The two groups were closely matched for BMI and age. The PCOS group had higher (P < 0.05) circulating levels of LH, E2, 17 OH-P, T, A, DHEA-S, and IGF-I, and significantly lower (P < 0.05) circulating concentrations of P and SHBG. Ferriman-Gallwey scores were significantly (P < 0.05) increased in PCOS vs. the control population. Serum leptin levels were similar in the two groups. Fasting glucose levels and AUCglucose were also similar in the two groups, whereas fasting insulin levels, AUCinsulin, and the AUCglucose/AUCinsulin ratio were significantly (P < 0.05) higher in PCOS patients than in controls. There was a significant (P < 0.05) relation between BMI and leptin levels in both PCOS (R= 0.81) and controls (R= 0.84).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Clinical and biochemical diagnostic features of the 100 PCOS women studied

 

View this table:
[in this window]
[in a new window]
 
TABLE 2. Clinical, hormonal, and metabolic characteristics of women with PCOS and controls

 
Table 3Go shows the allelic and genotypic frequencies of PPAR-{gamma} exons 6 and 2. Genotype frequencies for both exons were similar and conformed to the Hardy-Weinberg equilibrium (33). For exon 6, the CC genotype was significantly (P < 0.05) more frequent than genotypes CT and TT in both groups. Furthermore, the T allele was significantly (P < 0.05) more frequent in PCOS patients than in control women. For exon 2, the CC genotype was not significantly more frequent than the CG genotype in both groups. The frequency of the G allele of the exon 2 (Pro12Ala polymorphism) was similar in PCOS and controls.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Allelic and genotypic frequencies of exons 6 and 2 of the PPAR-{gamma} gene

 
As regards exon 6, in PCOS patients, BMI and leptin levels were significantly (P < 0.05) higher in the CT/TT genotype vs. the CC genotype (Table 4Go). They were also higher in the CT/TT genotype in patients vs. both the CC and CT/TT genotypes in controls (Table 4Go). Differently, BMI, leptin levels, and the leptin/BMI ratio did not differ between the CC and CT/TT genotypes in control women (Table 4Go). On the contrary, considering exon 2, BMI, leptin levels, and leptin/BMI ratio did not differ significantly between or within the PCOS and control groups (Table 4Go).


View this table:
[in this window]
[in a new window]
 
TABLE 4. BMI, leptin, and the leptin/BMI ratio according to different genotypes of exons 6 and 2 of PPAR-{gamma} gene polymorphisms in PCOS and controls

 
No difference in fasting glucose and insulin levels, AUCglucose, AUCinsulin, and in the AUCglucose/AUCinsulin ratio was detected between the CC and CT/TT genotypes of exon 6 in either group (Table 5Go). Similarly, there was no difference in fasting glucose and insulin levels, AUCglucose, AUCinsulin, and in the AUCglucose/AUCinsulin ratio between the CC and CG genotypes of exon 2 in either group (Table 5Go).


View this table:
[in this window]
[in a new window]
 
TABLE 5. Glucose metabolism in PCOS women and controls according to different genotypes of exons 6 and 2 of PPAR-{gamma} gene polymorphisms

 
Multivariate two-way ANOVA showed a significant interaction only for the genotypes of exon 6 with regard to BMI (P = 0.0415) and leptin (P = 0.0322). Furthermore, no significant interaction was detected concerning the leptin/BMI ratio (P = 0.3956).


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Our study is the first to evaluate the role of exons 6 and 2 PPAR-{gamma} polymorphisms in the complex pathogenetic mechanism of obesity in PCOS. Here, we show the silent CAC478CAT exon 6 polymorphism (34) and the result of a CCA-to-CGA missense mutation in codon 12 corresponding to the Pro12Ala exon 2 polymorphism of PPAR-{gamma} gene (34). We confirm that serum leptin levels did not differ between PCOS women and healthy controls closely matched for age and BMI (35, 36, 37, 38). In accordance with Meirhaeghe et al. (15), who showed that the C to T substitution is related with BMI and leptin levels only in obese women, we demonstrate that in healthy control women, serum leptin levels and BMI do not differ between CT/TT and CC. On the contrary, in PCOS women with the CT/TT genotypes, the serum leptin levels and BMI were significantly higher with respect to the CC genotype and to the CC and CT/TT genotypes of controls. After normalization of leptin for BMI, in CT/TT PCOS subjects the serum leptin concentrations were similar to the other genotype group, which indicates that the enhanced leptin level is probably due to BMI, although we cannot exclude an effect of the C to T substitution in this subpopulation.

The T allelic frequency observed in our control group was similar to that detected in healthy nonobese and obese women (15). In addition, the CT/TT polymorphism was more frequent in the PCOS group than in healthy BMI-matched women. These findings could explain, indeed, the high frequency of obesity in women with PCOS. In fact, this polymorphism could affect the ability of PPAR-{gamma} to induce differentiation of fibroblasts or other undifferentiated cells into mature fat cells (39). Furthermore, Meirhaeghe et al. (15) did not find any difference in C and T allelic frequency between obese and nonobese women. Thus, it is probable that PCOS women present a different genetic pattern also compared with obese subjects. In addition, in PCOS women, as in obese healthy women (15), the CT/TT genotype is associated with significantly higher serum leptin concentrations compared with CC women.

Differently, we did not find a significant difference between the CC and CG genotypes of exon 2 as regards BMI, leptin, and the leptin/BMI ratio between and within the PCOS and control groups. Consequently, it seems that the Pro12Ala variant plays a minor role, if any, in the pathogenesis of obesity. It has been suggested that this polymorphism contributes to the genetic susceptibility for obesity (17, 40, 41, 42, 43). Beamer et al. (43) found higher BMI in two independent Caucasian populations with the Pro12Ala polymorphism, and Valve et al. (17) reported that this polymorphism is associated with increased BMI, fat mass, and WHR in obese women. The Ala allele has been variously reported to be associated with both a higher BMI (15, 44) and a lower BMI (45, 46, 47, 48, 49), and to be unrelated to BMI (50, 51, 52, 53). By considering haplotypes, Doney et al. (45) reported opposite associations of the linked Pro12Ala and C1431T polymorphisms of the PPAR-{gamma} gene. In fact, the T1431 and Ala12 alleles were associated with an increased and decreased BMI, respectively (45). Therefore these two polymorphisms in the PPAR-{gamma} locus are in close linkage disequilibrium and have an opposite association with body weight.

In the PCOS group, although the TT polymorphism was associated with a higher BMI, AUCinsulin and the AUCglucose/AUCinsulin ratio were not significantly higher in the CT/TT genotype compared with the CC genotype. Consequently, either the increased TT frequency in PCOS women does not affect insulin sensitivity or insulin resistance does not affect this phenotype in women with PCOS. As recently reported by Azziz (54), insulin resistance in PCOS generally refers to the impaired action of insulin on glucose transport and lipolysis, principally in adipocytes, in the presence of relatively normal insulin binding (55, 56, 57, 58). Nonetheless, the mechanism underlying the abnormal insulin signaling observed in women with PCOS, both obese and nonobese, remains unknown.

Although Barroso et al. (59) showed that subjects affected by loss of function PPAR-{gamma} mutations share common elements of the insulin-resistance syndrome, improved insulin sensitivity has been associated with the Pro12Ala polymorphism in (Caucasian) healthy populations (17, 41, 46, 60), and the association of this polymorphism with type 2 diabetes is controversial (16, 34, 40, 47, 61, 62, 63, 64). Our findings show that Pro12Ala does not influence glucose metabolism in PCOS and healthy women. In fact, we found no difference in AUCinsulin and in the AUCglucose/AUCinsulin ratio in the two groups regarding the Pro12Ala polymorphism. Most studies of the association between the PPAR-{gamma} Pro12Ala polymorphism and type 2 diabetes were conducted with a small sample. Altshuler et al. (16) combined samples to achieve adequate power and found that although PPAR-{gamma} Pro12Ala was reproducibly associated with type 2 diabetes, this polymorphism could not be the etiologic variant, but rather in linkage disequilibrium with it (16).

Hara et al. (18) showed an association between the Ala allele and increased insulin sensitivity only in Caucasian women with PCOS. Furthermore, their study population had a significantly higher BMI than our PCOS patients (36.3 ± 0.8 vs. 30.1 ± 9.0 kg/m2). In fact, our PCOS group included normal, overweight, and obese PCOS women, whereas Hara et al. (18) enrolled exclusively obese PCOS women. In addition, six diabetic women were included in their analysis of the Pro/Pro group, whereas metabolic disorders and glucose intolerance were exclusion criteria in our study protocol.

We found no relationship between exon 2 and exon 6 in our study population. Therefore, further studies are needed to clarify better the role, if any, of these two polymorphisms in PCOS. The exact mechanisms by which PPAR-{gamma} polymorphisms could affect adipose tissue mass are unknown. Other epidemiological and genetic studies on the PPAR-{gamma} gene locus, and the screening of the whole PPAR-{gamma} gene to identify other mutations responsible for the effect of the C/T polymorphism studied and nearby polymorphisms, are needed to advance our understanding of the complex scenario governing the pathogenesis of PCOS and its relationship with obesity.


    Acknowledgments
 
We thank Dr. Benito Chinea for valuable assistance in the statistical analysis and Mr. Christian Siatka ("Ecole de l’ADN", Nimes, France) for the analysis and elaboration of the data. We are indebted to Jean Ann Gilder for editing the text, and to the patients and controls for having agreed to participate in this study.


    Footnotes
 
F.O. and S.P. contributed equally to the preparation and final version of this manuscript.

This work was supported by a grant from the "Progetto Giovani Ricercatori" of the University of Naples "Federico II" (Ministero dell’Università e della Ricerca Scientifica e Tecnologica, Nota prot. n. 400/14.3.2001).

Abbreviations: A, Androstenedione; AUC, area under curve; BMI, body mass index; CV, coefficient(s) of variation; DHEA-S, dehydroepiandrosterone sulfate; E2, 17ß-estradiol; OGTT, oral glucose tolerance test; 17 OH-P, 17-hydroxyprogesterone; P, progesterone; PCOS, polycystic ovary syndrome; PPAR-{gamma}, peroxisome proliferator-activated receptor-{gamma}; PRL, prolactin; T, testosterone; TV-USG, transvaginal ultrasonography; WHR, waist-to-hip ratio.

Received November 19, 2002.

Accepted September 5, 2003.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Franks S 1995 Polycystic ovary syndrome. N Engl J Med 333:853–861[Free Full Text]
  2. Scarpitta AM, Sinagra D 2000 Polycystic ovary syndrome: an endocrine and metabolic disease. Gynecol Endocrinol 14:392–395[Medline]
  3. Rosenbaum M, Leibel RL, Hirsch J 1997 Obesity. N Engl J Med 337:396–407[Free Full Text]
  4. Carmina E, Lobo RA 1999 Polycystic ovary syndrome (PCOS): arguably the most common endocrinopathy is associated with significant morbidity in women. J Clin Endocrinol Metab 84:1897–1899[Free Full Text]
  5. Maeda K, Okubo K, Shimomura I, Mizuno K, Matsuzawa K 1997 Analysis of an expression profile of genes in the human adipose tissue. Gene 190:227–235[CrossRef][Medline]
  6. Rocchi S, Auwerx J 2000 Peroxisome proliferator-activated receptor {gamma}, the ultimate liaison between fat and transcription. Br J Nutr 84:S223–S227
  7. Sewter C, Blows F, Considine R, Vidal-Puig A, O’Rahilly S 2002 Differential effects of adiposity on peroxisomal proliferator-activated receptor {gamma} 1 and {gamma} 2 messenger ribonucleic acid expression in human adipocytes. J Clin Endocrinol Metab 87:4203–4207[Abstract/Free Full Text]
  8. Tamori Y, Masugi J, Nishino N, Kasuga M 2002 Role of peroxisome proliferator-activated receptor-{gamma} in maintenance of the characteristics of mature 3T3–L1 adipocytes. Diabetes 51:2045–2055[Abstract/Free Full Text]
  9. Fajas L, Auboeuf D, Raspé E, Schoonjans K, Lefebvre A-M, Saladin R, Najib J, Laville M, Fruchart J-C, Deeb S, Vidal-Puig A, Flier J, Briggs MR, Staels B, Vidal H, Auwerx J 1997 The organization, promoter analysis, and expression of the human PPAR{gamma} gene. J Biol Chem 272:18779–18789[Abstract/Free Full Text]
  10. Vidal-Puig AJ, Considine RV, Jimenez-Linan M, Werman A, Pories WJ, Caro JF, Flier JS 1997 Peroxisome proliferator-activated receptor gene expression in human tissues. Effects of obesity, weight loss, and regulation by insulin and glucocorticoids. J Clin Invest 99:2416–2422[Medline]
  11. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM 1994 PPAR{gamma}2: tissue-specific regulator of an adipocyte enhancer. Gene Dev 8:1224–1234[Abstract/Free Full Text]
  12. Montague CT, Sadaf Farooqi I, Whitehead JP, Soos MA, Rau H, Wareham NJ, Sewter CP, Cigby JE, Mohammed SN, Hurst JA, Cheetham CH, Early AR, Barnett AH, Prins JB, O’Rahilly S 1997 Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387:903–908[CrossRef][Medline]
  13. Evans D, Mann WA, de Heer J, Michel U, Wendt D, Kortner B, Wolf A, Beisiegel U 2000 Variation in the gene for human peroxisome proliferator activated receptor {gamma} (PPAR{gamma}) does not play a major role in the development of morbid obesity. Int J Obes 24:647–651
  14. Ristow M, Muller-Wieland D, Pfeiffer A, Krone W, Kahn C 1998 Obesity associated with a mutation in a genetic regulator of adipocyte differentiation. N Engl J Med 339:953–959[Abstract/Free Full Text]
  15. Meirhaeghe A, Fajas L, Helbecque N, Cottel D, Lebel, Dallongeville J, Deeb S, Auwerx J, Amouyel P 1998 A genetic polymorphism of the peroxisome proliferator-activated receptor {gamma} gene influences plasma leptin levels in obese humans. Hum Mol Genet 7:435–440[Abstract/Free Full Text]
  16. Altshuler D, Hirschhorn JN, Klannemark M, Lindgren CM, Vohl MC, Nemesh J, Lane CR, Schaffner SF, Bolk S, Brewer C, Tuomi T, Gaudet D, Hudson TJ, Daly M, Groop L, Lander ES 2000 The common PPAR{gamma} Pro12Ala polymorphism is associated with decreased risk of type 2 diabetes. Nat Genet 26:76–80[CrossRef][Medline]
  17. Valve R, Sivenius K, Miettinen R, Pihlajamaki J, Rissanen A, Deeb SS, Auwerx J, Uusitupa M, Laakso M 1999 Two polymorphisms in the peroxisome proliferator-activated receptor-{gamma} gene are associated with severe overweight among obese women. J Clin Endocrinol Metab 84:3708–3712[Abstract/Free Full Text]
  18. Hara M, Alcoser SY, Qaadir A, Beiswenger KK, Cox NJ, Ehrmann DA 2002 Insulin resistance is attenuated in women with polycystic ovary syndrome with the Pro12Ala polymorphism in the PPAR{gamma} gene. J Clin Endocrinol Metab 87:772–775[Abstract/Free Full Text]
  19. Urbanek M, Legro RS, Driscoll DA, Azziz R, Ehrmann DA, Norman RJ, Strauss JF, Spielman RS, Dunaif A 1999 Thirty-seven candidate genes for polycystic ovary syndrome: strongest evidence for linkage is with follistatin. Proc Natl Acad Sci USA 96:8573–8578[Abstract/Free Full Text]
  20. Ferriman D, Gallwey JD 1961 Clinical assessment of body hair growth in women. J Clin Endocrinol Metab 21:1440–1447
  21. Fulghesu AM, Ciampelli M, Belosi C, Apa R, Pavone V, Lanzone A 2001 A new ultrasound criterion for the diagnosis of polycystic ovary syndrome: the ovarian stroma/total area ratio. Fertil Steril 76:326–331[CrossRef][Medline]
  22. Zawdaki JK, Dunaif A 1992 Diagnostic criteria for polycystic ovary syndrome: towards a rationale approach. In: Dunaif A, Given JR, Haseltine F, Merriam GR, eds. Polycystic ovary syndrome. Boston: Blackwell; 377–384
  23. Modan M, Harris MI, Halkin H 1989 Evaluation of WHO and NDDG criteria for impaired glucose tolerance. Results from two national samples. Diabetes 38:1630–1635[Abstract]
  24. Orio Jr F, Palomba S, Colao A, Tenuta M, Dentico C, Petretta M, Lombardi G, Nappi C, Orio F 2001 Growth hormone secretion after baclofen administration in different phases of the menstrual cycle in healthy women. Horm Res 55:131–136[CrossRef][Medline]
  25. Azziz R, Zacur HA 1989 21-Hydroxylase deficiency in female hyperandrogenism: screening and diagnosis. J Clin Endocrinol Metab 69:577–584[Abstract/Free Full Text]
  26. Orio Jr F, Palomba S, Cascella T, Milan G, Mioni R, Pagano C, Zullo F, Colao A, Lombardi G, Vettor R 2003 Adiponectin levels in women with polycystic ovary syndrome. J Clin Endocrinol Metab 88:2619–2623[Abstract/Free Full Text]
  27. Orio Jr F, Palomba S, Di Biase S, Colao A, Tauchmanovà L, Savastano S, Labella D, Russo T, Zullo F, Lombardi G 2003 Homocysteine levels and C677T polymorphism of methilenetetrahydrofolate reductase in women with polycystic ovary syndrome. J Clin Endocrinol Metab 88:942–945[Abstract]
  28. Orio Jr F, Lucidi P, Palomba S, Tauchmanovà L, Cascella T, Russo T, Zullo F, Colao A, Lombardi G, De Feo P 2003 Circulating ghrelin concentrations in the polycystic ovary syndrome. J Clin Endocrinol Metab 88:673–679[Abstract/Free Full Text]
  29. Matarese G, Alviggi C, Sanna V, Howard JK, Lord GM, Carravetta C, Fontana S, Lechler RI, Bloom SR, De Placido G 2000 Increased leptin levels in serum and peritoneal fluid of patients with pelvis endometriosis. J Clin Endocrinol Metab 85:2483–2487[Abstract/Free Full Text]
  30. Tai MM 1994 A mathematic model for the determination of total area under glucose tolerance and other metabolic curves. Diabetes Care 17:152–154[Abstract]
  31. Legro RS, Fineggod D, Dunaif A 1998 A fasting glucose to insulin ratio is a useful measure of insulin sensitivity in women with polycystic ovary syndrome. J Clin Endocrinol Metab 83:2694–2698[Abstract/Free Full Text]
  32. Miller SA, Dykes DD, Polesky HF 1988 A simple salting-out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16:1215[Free Full Text]
  33. Ott J 1999 Analysis of human genetic linkage. 3rd ed. Baltimore: The Johns Hopkins University Press; 85–88
  34. Stumvoll M, Haring H 2002 The peroxisome proliferators-activated receptor-{gamma} 2 Pro12Ala polymorphism. Diabetes 51:2341–2347[Abstract/Free Full Text]
  35. Caro JF 1997 Editorial: leptin is normal in PCOS, an editorial about three "negative" papers. J Clin Endocrinol Metab 82:1685–1686[Free Full Text]
  36. Mantzoros CS, Dunaif A, Flier JS 1997 Leptin concentrations in the polycystic ovary syndrome. J Clin Endocrinol Metab 82:1687–1691[Abstract/Free Full Text]
  37. Laughlin GA, Morales AJ, Yen SSC 1997 Serum leptin levels in women with polycystic ovary syndrome: the role of insulin resistance/hyperinsulinemia. J Clin Endocrinol Metab 82:1692–1696[Abstract/Free Full Text]
  38. Rouru J, Anttila L, Koskinen P, Penttila T-A, Irjala K, Huupponen R, Koulu M 1997 Serum leptin concentrations in women with polycystic ovary syndrome. J Clin Endocrinol Metab 82:1697–1700[Abstract/Free Full Text]
  39. Auwerx J 1999 PPAR{gamma}, the ultimate thrifty gene. Diabetologia 42:1033–1049[CrossRef][Medline]
  40. Meirhaeghe A, Fajas L, Helbecque N, Cottel D, Auwerx J, Deeb SS, Amouyel P 2000 Impact of the peroxisome proliferator activated receptor {gamma}2 Pro12Ala polymorphism on adiposity, lipids and non-insulin-dependent diabetes mellitus. Int J Obes Relat Metab Disord 24:195–199[CrossRef][Medline]
  41. Gonzalez Sanchez JL, Serrano Rios M, Fernandez Perez C, Laakso M, Martinez Larrad MT 2002 Effect of the Pro12Ala polymorphism of the peroxisome proliferator-activated receptor {gamma}-2 gene on adiposity, insulin sensitivity and lipid profile in the Spanish population. Eur J Endocrinol 147:495–501[Abstract]
  42. Hasstedt SJ, Ren Q-F, Teng K, Elbein SC 2001 Effect of the peroxisome proliferator-activated receptor-{gamma}2 Pro12Ala variant on obesity, glucose homeostasis, and blood pressure in members of familial type 2 diabetic kindreds. J Clin Endocrinol Metab 86:536–541[Abstract/Free Full Text]
  43. Beamer BA, Yen C-J, Andersen RE, Muller D, Elahi D, Cheskin LJ, Andres R, Roth J, Shuldiner AR 1998 Association of the Pro12Ala variant in the peroxisome proliferators-activated receptor-{gamma}2 gene with obesity in two Caucasian populations. Diabetes 47:1806–1808[Medline]
  44. Swarbrick MM, Chapman CM, McQuillan BM, Hung J, Thompson PL, Beilby JP 2001 A Pro12Ala polymorphism in the human peroxisome proliferators-activated receptor-{gamma} 2 is associated with combined hyperlipidemia in obesity. Eur J Endocrinol 144:277–282[Abstract]
  45. Doney A, Fischer B, Frew D, Cumming A, Flavell DM, World M, Montgomery HE, Boyle D, Morris A, Palmer CNA 2002 Haplotype analysis of the PPAR{gamma} Pro12Ala and C1431T variants reveals opposing associations with body weight. BMC Genet 3:21[CrossRef][Medline]
  46. Deeb S, Fajas L, Nemoto M, Pihlajamaki J, Mykkanen L, Kuusisto J, Laakso M, Fujimoto W, Auwerx J 1998 A Pro12Ala substitution in PPAR-{gamma}2 associated with decreased receptor activity, lower body mass index and improved insulin sensitivity. Nat Genet 20:284–287[CrossRef][Medline]
  47. Ek J, Andersen G, Urhammer SA, Hansen L, Carstensen B, Borch-Johnsen K, Drivsholm T, Berglund L, Hansen T, Lithell H, Pedersen O 2001 Studies of the Pro12Ala polymorphism of the peroxisome proliferator-activated receptor-{gamma}2 (PPAR-{gamma}2) gene in relation to insulin sensitivity among glucose tolerant Caucasians. Diabetologia 44:1170–1176[CrossRef][Medline]
  48. Vigouroux C, Fajas L, Khallouf E, Meier M, Gyapay G, Lascols O, Auwerx J, Weissenbach J, Capeau J, Magre J 1998 Human peroxisome proliferators-activated receptor-{gamma} 2: genetic mapping, identification of a variant in the coding sequence, and exclusion as the gene responsible for lipoatrophic diabetes. Diabetes 47:490–492[Medline]
  49. Pihlajamaki J, Miettinen R, Valve R, Karjalainen L, Mykkanen L, Kuusisto J, Deeb S, Auwerx J, Laakso M 2000 The Pro12Ala substitution in the peroxisome proliferators activated receptor {gamma} 2 is associated with an insulin-sensitive phenotype in families with familial combined hyperlipidemia and in nondiabetic elderly subjects with dyslipidemia. Atherosclerosis 151:567–574[CrossRef][Medline]
  50. Hamann A, Munzberg H, Buttron P, Busing B, Hinney A, Mayer H, Siegfried W, Hebebrand J, Greten H 1999 Missense variants in the human peroxisome proliferators-activated receptor-{gamma} 2 gene in lean and obese subjects. Eur J Endocrinol 141:90–92[Abstract]
  51. Ringel J, Engeli S, Distler A, Sharma AM 1999 Pro12Ala missense mutation of the peroxisome proliferator activated receptor {gamma} and diabetes mellitus. Biochem Biophys Res Commun 254:450–453[CrossRef][Medline]
  52. Mori Y, Kim-Motoyama H, Katakura T, Yasuda K, Kadowaki H, Beamer BA, Shuldiner AR, Akanuma Y, Yazaki Y, Kadowaki T 1998 Effect of the Pro12Ala variant of the human peroxisome proliferator-activated receptor {gamma} 2 gene on adiposity, fat distribution, and insulin sensitivity in Japanese men. Biochem Biophys Res Commun 251:195–198[CrossRef][Medline]
  53. Koch M, Rett K, Maerker E, Volk A, Haist K, Deninger M, Renn W, Haring HU 1999 The PPAR{gamma}2 amino acid polymorphism Pro 12 Ala is prevalent in offspring of type II diabetic patients and is associated to increased insulin sensitivity in a subgroup of obese subjects. Diabetologia 42:758–762[CrossRef][Medline]
  54. Azziz R 2002 Polycystic ovary syndrome, insulin resistance, and molecular defects of insulin signaling. J Clin Endocrinol Metab 87:4085–4087[Free Full Text]
  55. Ciaraldi TP, el-Roeiy A, Madar Z, Reichart D, Olefsky JM, Yen SS 1992 Cellular mechanisms of insulin resistance in polycystic ovarian syndrome. J Clin Endocrinol Metab 75:577–583[Abstract]
  56. Marsden PJ, Murdoch AP, Taylor R 1994 Severe impairment of insulin action in adipocytes from amenorrheic subjects with polycystic ovary syndrome. Metabolism 43:1536–1542[CrossRef][Medline]
  57. Dunaif A, Xia J, Book CB, Schenker E, Tang Z 1995 Excessive insulin receptor serine phosphorylation in cultured fibroblasts and in skeletal muscle. A potential mechanism for insulin resistance in the polycystic ovary syndrome. J Clin Invest 96:801–810
  58. Ciaraldi TP, Morales AJ, Hickman MG, Odom-Ford R, Olefsky JM, Yen SS 1997 Cellular insulin resistance in adipocytes from obese polycystic ovary syndrome subjects involves adenosine modulation of insulin sensitivity. J Clin Endocrinol Metab 82:1421–1425[Abstract/Free Full Text]
  59. Barroso I, Gurnell M, Crowley VE, Agostini M, Schwabe JW, Soos MA, Maslen GL, Williams TD, Lewis H, Schafer AJ, Chatterjee VK, O’Rahilly S 1999 Dominant negative mutations in human PPAR{gamma} associated with severe insulin resistance, diabetes mellitus and hypertension. Nature 402:880–883[Medline]
  60. Frederiksen L, Brodbaek K, Fenger M, Jorgensen T, Borch-Johnsen K, Madsbad S, Urhammer SA 2002 Studies of the Pro12Ala polymorphism of the PPAR-{gamma} gene in the Danish MONICA cohort: homozygosity of the Ala allele confers a decreased risk of the insulin resistance syndrome. J Clin Endocrinol Metab 87:3989–3992[Abstract/Free Full Text]
  61. Jacob S, Stumvoll M, Becker R, Koch M, Nielsen M, Loblein K, Maerker E, Volk A, Renn W, Balletshofer B, Machicao F, Rett K, Haring H 2000 The PPAR-{gamma}2 polymorphism Pro12Ala is associated with better insulin sensitivity in the offspring of type 2 diabetic patients. Horm Metab Res 32:413–416[Medline]
  62. Kadowaki T, Hara K, Kubota N, Tobe K, Terauchi Y, Yamauchi T, Eto K, Kadowaki H, Noda M, Hagura R, Akanuma Y 2002 The role of PPAR{gamma} in high-fat diet-induced obesity and insulin resistance. J Diabetes Complications 16:41–45[CrossRef][Medline]
  63. Mancini FP, Vaccaro O, Sabatino L, Tufano A, Rivellese AA, Riccardi G, Colantuoni V 1999 Pro12Ala substitution in the peroxisome proliferator- activated receptor-{gamma}2 is not associated with type 2 diabetes. Diabetes 48:1466–1468[Abstract]
  64. Zietz B, Barth N, Spiegel D, Schmitz G, Scholmerich J, Schaffler A 2002 Pro12Ala polymorphism in the peroxisome proliferator-activated receptor-{gamma}2 (PPAR{gamma}2) is associated with higher levels of total cholesterol and LDL- cholesterol in male Caucasian type 2 diabetes patients. Exp Clin Endocrinol Diabetes 110:60–66[CrossRef][Medline]



This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
M. Simoni, C.B. Tempfer, B. Destenaves, and B.C.J.M. Fauser
Functional genetic polymorphisms and female reproductive disorders: Part I: polycystic ovary syndrome and ovarian response
Hum. Reprod. Update, September 1, 2008; 14(5): 459 - 484.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
J. E Cecil, C. N. Palmer, B. Fischer, P. Watt, D. J Wallis, I. Murrie, and M. M Hetherington
Variants of the peroxisome proliferator-activated receptor {gamma}- and {beta}-adrenergic receptor genes are associated with measures of compensatory eating behaviors in young children
Am. J. Clinical Nutrition, July 1, 2007; 86(1): 167 - 173.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Azziz, E. Carmina, D. Dewailly, E. Diamanti-Kandarakis, H. F. Escobar-Morreale, W. Futterweit, O. E. Janssen, R. S. Legro, R. J. Norman, A. E. Taylor, et al.
Criteria for Defining Polycystic Ovary Syndrome as a Predominantly Hyperandrogenic Syndrome: An Androgen Excess Society Guideline
J. Clin. Endocrinol. Metab., November 1, 2006; 91(11): 4237 - 4245.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
M. Kiyomizu, J. Kitawaki, H. Obayashi, M. Ohta, H. Koshiba, H. Ishihara, and H. Honjo
Association of Two Polymorphisms in the Peroxisome Proliferator-Acativated Receptor-{gamma} Gene With Adenomyosis, Endometriosis, and Leiomyomata in Japanese Women
Reproductive Sciences, July 1, 2006; 13(5): 372 - 377.
[Abstract] [PDF]


Home page
Am J EpidemiolHome page
V. Paracchini, P. Pedotti, and E. Taioli
Genetics of Leptin and Obesity: A HuGE Review
Am. J. Epidemiol., July 15, 2005; 162(2): 101 - 114.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
H. F. Escobar-Morreale, M. Luque-Ramirez, and J. L. San Millan
The Molecular-Genetic Basis of Functional Hyperandrogenism and the Polycystic Ovary Syndrome
Endocr. Rev., April 1, 2005; 26(2): 251 - 282.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
D. A. Ehrmann
Polycystic Ovary Syndrome
N. Engl. J. Med., March 24, 2005; 352(12): 1223 - 1236.
[Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. Jansen, J. S. E. Laven, H. B. R. Dommerholt, J. Polman, C. van Rijt, C. van den Hurk, J. Westland, S. Mosselman, and B. C. J. M. Fauser
Abnormal Gene Expression Profiles in Human Ovaries from Polycystic Ovary Syndrome Patients
Mol. Endocrinol., December 1, 2004; 18(12): 3050 - 3063.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. S.F. Doney, B. Fischer, G. Leese, A. D. Morris, and C. N.A. Palmer
Cardiovascular Risk in Type 2 Diabetes Is Associated With Variation at the PPARG Locus: A Go-DARTS Study
Arterioscler Thromb Vasc Biol, December 1, 2004; 24(12): 2403 - 2407.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. Orio Jr., S. Palomba, T. Cascella, S. Di Biase, D. Labella, T. Russo, S. Savastano, F. Zullo, A. Colao, R. Vettor, et al.
Lack of an Association between Peroxisome Proliferator-Activated Receptor-{gamma} Gene Pro12Ala Polymorphism and Adiponectin Levels in the Polycystic Ovary Syndrome
J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5110 - 5115.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. Orio Jr., S. Palomba, T. Cascella, B. De Simone, S. Di Biase, T. Russo, D. Labella, F. Zullo, G. Lombardi, and A. Colao
Early Impairment of Endothelial Structure and Function in Young Normal-Weight Women with Polycystic Ovary Syndrome
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4588 - 4593.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Orio, F.
Right arrow Articles by Lombardi, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Orio, F., Jr.
Right arrow Articles by Lombardi, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals