The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 10 4967-4976
Copyright © 2003 by The Endocrine Society
The Expression of Smads in Human Endometrium and Regulation and Induction in Endometrial Epithelial and Stromal Cells by Transforming Growth Factor-ß
Xiaoping Luo,
Jingxia Xu and
Nasser Chegini
Department of Obstetrics/Gynecology, University of Florida, Gainesville, Florida 32610
Address all correspondence and requests for reprints to: Dr. Nasser Chegini, Department of Obstetrics and Gynecology, University of Florida, Box 100294, Gainesville, Florida 32610. E-mail: cheginin{at}obgyn.ufl.edu.
 |
Abstract
|
|---|
Human endometrium expresses TGF-ß and TGF-ß receptors where they regulate several endometrial biological activities implicated in embryo implantation, irregular bleeding, endometriosis, and cancer. In the present study, we determined the expression of Smads, intracellular signals that mediate TGF-ß receptors signals from the cell surface to the nucleus, in the endometrium as well as isolated endometrial epithelial (EEC) and stromal (ESC) cells. We also determined whether TGF-ß regulates the expression Smads and activates Smad3 in these cells and endometrial surface epithelial cell line (HES). Using semiquantitative RT-PCR, Western blot analysis, and immunohistochemistry, we found that endometrium, EEC, ESC, and HES express Smad3, -4, and -7 mRNA and protein and contain phosphorylated Smad3 (pSmad3). Smads and pSmad3 were localized in the epithelial and stromal cells with cytoplasmic/nuclear localization. TGF-ß in a dose- and time-dependent manner increased the expression of Smads mRNA and protein, the rate of pSmad3 activation, and Smad3 translocation into the nucleus in ESC and HES. The effect of TGF-ß on pSmad3 induction was, in part, abrogated by the pretreatment of HES and ESC with TGF-ß type II receptor antisense oligonucleotides. We conclude that human endometrium expresses the necessary components of Smad signaling pathway, whose expression and induction in endometrial epithelial and stromal cells are regulated by TGF-ß.
 |
Introduction
|
|---|
HUMAN ENDOMETRIUM UNDERGOES extensive biochemical and morphological alterations during the menstrual cycle under the control of ovarian steroids. The ovarian steroids are believed to mediate their actions, at least in part, through differential regulation of many growth factors, cytokines, and chemokines expression, where they influence a wide range of normal endometrial activities and associated abnormalities (1, 2, 3, 4, 5). TGF-ß is a multifunctional cytokine whose expression is documented in the human endometrium throughout the menstrual cycle and is regulated by ovarian steroids (6, 7, 8, 9, 10, 11). TGF-ß is known to regulate various cellular activities including cell growth, differentiation, apoptosis, inflammatory, and immune responses, extracellular matrix deposition, adhesion molecules, proteases, and protease inhibitor expression (6, 7, 12, 13, 14, 15). Altered expression of TGF-ß has also been associated with manifestation of various abnormalities (7, 16), which include endometriosis, abnormal uterine bleeding, and endometrial cancer (14, 17, 18, 19, 20). In the endometrium, TGF-ß regulates its own expression, and that of extracellular matrix, adhesion molecules and proteases that are implicated in trophoblast invasion, angiogenesis and tumor metastasis during embryo implantation, endometriosis, irregular uterine bleeding, and endometrial cancer, respectively (2, 9, 12, 13, 14, 15, 16).
Diverse cellular response elicited by TGF-ß is mediated from the cell surface to the nucleus through the activation of serine/threonine kinase receptors that are expressed in human endometrium (8, 11, 21, 22, 23). Activated TGF-ß receptors induce recruitment of multiple intracellular signals, specifically Smads, whose activation and subsequent translocation into the nucleus results in gene expression in response to TGF-ß (23, 24, 25). Smads are comprised of receptor-activated/pathway-specific Smad1, -2, -3, -5, and -8 (R-Smads), common Smad (Smad4), and the inhibitory Smad (Smad6 and -7) (23). Activated TGF-ß receptor phosphorylates Smad2 and -3, and following a complex formation with Smad4 translocates into the nucleus where they mediate the transcription of target genes. The inhibitory Smad interacts with TGF-ß type I receptor and prevents RSmads phosphorylation, interrupting TGF-ß-induced signaling (23). Smads are expressed in various cell and tissues whose altered expression has been associated with several abnormalities and cellular resistance to growth inhibitory action of TGF-ß (22, 23, 24).
Given the importance of TGF-ß in regulating several endometrial cellular activities, the expression and regulation of Smads is necessary to mediate these actions. However, the components of Smad signaling pathway have not been investigated in the endometrium. In the present study, we determined the expression and cellular localization of Smad3, Smad4, Smad7, and phosphorylated Smad3 (pSmad3) in the endometrium. Using isolated endometrial epithelial and stromal cells and a human surface epithelial cell line (HES), we further investigated whether Smads expression is regulation by TGF-ß in these cells, and if TGF-ß mediates its action through the induction of this pathway.
 |
Materials and Methods
|
|---|
All the materials used for isolation and culturing of endometrial epithelial and stromal cells were purchased from Sigma (St. Louis, MO), for semiquantitative RT-PCR from Invitrogen (Carlsbad, CA), for Western blotting from Bio-Rad (Hercules, CA) and for immunohistochemistry from Vector Laboratories (Burlingame, CA). Recombinant human TGF-ß1 was purchased from R&D System (Minneapolis, MN). Affinity purified monoclonal anti-Smad4, rabbit anti-Smad3, anti-Smad7, and anti-phospoSmad2/3 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). A monoclonal antibody specific to human ß actin, cytokeratin 19, and vimentin were purchased from Sigma.
Portions of endometrial tissues were collected from premenopausal women who were undergoing hysterectomy for medically indicated reasons excluding endometrial cancer. These patients were not taking any medication during the previous 3 months before surgery. The tissues were collected at the University of Florida-affiliated Shands Hospital with the approval of the Institutional Review Board. Immediately after collection, small portions of endometrial tissues were either snapped frozen and stored in liquid nitrogen, fixed in Bouins solution for immunohistochemistry, or prepared for isolation of endometrial epithelial (EEC) and stromal (ESC) cells as previously described (25). The isolated EEC and ESC were cultured in DMEM:F12 until reaching visual confluence. Before use in these experiments the primary culture of EEC and ESC were seeded in eight-well culture slides. After 24 h of culturing, they were characterized using immunofluorescence microscopy and antibodies to cytokeratin 19 and vimentin as previously described (25, 26). In addition, a human endometrial epithelial cell line (HES), derived from spontaneous transformation of isolated endometrial surface epithelial cells from benign proliferative endometrium (27), and kindly provided by Dr. Douglas Kniss (Ohio State University, Columbus, OH) were used in parallel with ESC. The cells were cultured in M-199 containing 10% FBS.
To determine the expression of Smad-3, -4, and -7, mRNA and protein in endometrial tissues total RNA and protein was extracted and subjected to RT-PCR and Western blot analysis, or fixed and paraffin embedded for immunohistochemistry as previously described (8, 26, 28). To determine whether EEC, ESC, and HES express Smads, the cells were cultured in six-well dishes at approximate density of 106 cells/well. After 48 h of incubation, total cellular RNA and protein were isolated to determine Smad3, -4, and -7 expression. Total RNA was isolated from the tissues and cells using Trizol (Invitrogen), and equal amount of RNA (2 µg) was used to coamplify Smads and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) mRNA by RT-PCR. Oligonucleotide primers derived from the nucleotide sequences encompassing the coding region of human Smads and G3PDH (28). To obtain an optimal amplification condition within the logarithmic phase (Mastercycler-Gradient, Eppendorf Scientific, Westbury, NY), PCR was performed over a range of 2535 cycles with primers for Smads and G3PDH used at equal concentrations with identical PCR buffer containing 1.5 mM MgCl2. The PCR temperature profile consist of cycle denaturation (95 C for 1 min), annealing (5561 C for 30 sec), and extension (72 C for 1 min) followed by an additional 5min extension at 72 C in the presence of Taq polymerase added at the first annealing incubation. Controls included omission of the reverse transcription step before PCR amplification, coamplification of G3PDH mRNA, and inclusion of water blanks. After a 3035 cycle of amplification the coamplified Smad:G3PDH PCR products were separated on 1% agarose gels. The images were captured on Kodak EDAS 290 digital camera (Eastman Kodak, Rochester, NY) and stored as TIFF files. The relative band intensity of Smad and G3PDH was determined using Kodak EDAS and/or NIH Image (version 1.6) densitometry software and relative abundance of Smads mRNA was estimated as the ratios of Smad:G3PDH band intensity and reported as fold change.
For Western blotting endometrial tissue pieces were homogenized using Polytron homogenizer (Brinkmann, Eppendorf Scientific) in a buffer containing 50 mM HEPES (pH 7.4), 1% Nonidet P-40, 0.5% deoxycholate, 5 mM EDTA, 1 mM sodium Ortho-vanadate, 5 mM NaF, and phosphatase and protease inhibitor cocktails (Sigma) (28). The EEC, ESC, and HES were directly lysed in the above buffer. Cell lysates and tissue homogenates were centrifuged at 14,000 x g for 15 min at 4 C, the supernatants were collected, and following determination of their total protein content (Pierce, Rockford, IL), aliquots were stored at -80 C until assayed. An equal amount of sample proteins were subjected to SDS-PAGE and transferred to polyvinyldiene difluoride membrane by electroblotting in a buffer containing Tris-HCl (25 mM), glycine (192 mM) and methanol (20%, vol/vol). After transfer the blots were incubated in 5% powdered milk in TTBS [10 mM Tris-HCl (pH 7.5), 0.15 M NaCl, 0.1% Tween 20] at room temperature for 1 h and then incubated with anti-Smad3, -Smad4, -Smad7 and phosphospecific Smad2/3 as well as ß actin (control) antibodies overnight at 4 C. The membranes were washed with TTBS three times and Triton-free buffer once and exposed to corresponding horseradish peroxidase-conjugated IgG for 1 h. Immunostained proteins were visualized using enhanced chemiluminescence reagents (Amersham Pharmacia Biotech, Piscataway, NJ). The images were captured and the band intensities were determined using Kodak and NIH Image software.
For immunohistochemistry, paraffin-embedded tissue sections 35 µm thick were prepared and incubated with anti-Smad3, -4, and -7 antibodies at 5 µg/ml of IgG prepared in PBS (pH 7.4), containing 0.01% BSA (28). The sections were then exposed to biotinylated secondary antibodies and avidin horseradish peroxidase (Vector Laboratories), and following development of chromogenic reaction with diaminobenzidine, the sections were counterstained with hematoxylin. Tissue sections incubated with either preabsorbed antibodies with competing peptides (Santa Cruz) or with normal IgG instead of primary antibodies during immunostaining served as controls.
To determine whether EEC, ESC, and HES express Smads, the cells were cultured in six-well dishes at an approximate density of 106 cells/well. After 48 h of incubation, total cellular RNA and protein were isolated and subjected to semiquantitative RT-PCR and Western blot analysis as described above. Due to limited availability, EEC was only used in this part of the experiments. To determine whether TGF-ß regulates Smad mRNA and protein expression, HES and ESC were cultured as above, and following 24 h of incubation in serum-free media, the cells were washed and treated with 2.5 ng/ml of TGF-ß1 for 2, 4, 6, and 12 h (mRNA), or 18, 24, and 36 h (protein). Total RNA and protein were isolated from the respective experiments and subjected to semiquantitative RT-PCR and Western blot analysis as described above. To determine whether TGF-ß induces Smad, serum-starved HES and ESC were treated with 2.5 ng/ml of TGF-ß1 for 5, 15, and 30 min (time dependent), or 1, 2.5, 5, and 10 ng/ml (dose dependent) of TGF-ß for 15 min. Total protein was isolated and subjected to Western blot analysis to determine the rate of pSmad3 and total Smad3, -4, and -7. To determine whether TGF-ß-induced Smad translocation into the nucleus, HES and ESC were cultured in eight-well slides (Nalge Nunc, Naperville, IL) for 24 h in a medium containing 10% serum, and 24 h in a serum-free media; washed and treated with 2.5 ng/ml of TGF-ß1 for 5, 15, and 30 min. The cells were washed in PBS, fixed in methanol and immunostained with anti-Smad3 and pSmad2/3 antibodies by fluorescein isothiocyanate (FITC)-labeled-indirect method (25, 26). After incubation, the cells were washed with PBS and Vectashield with 4',6-diamidino-2-phenylindole (DAPI) (Vector Laboratories) as the mounting medium. Images were captured using an Olympus IX70 microscope configured with DAPI and FITC fluorescent excitation filters, and equipped with digital camera and software image analysis package (Olympus Inc., Melville, NY).
To determine TGF-ß receptor-mediated Smad activation, HES and ESC were treated with 1 µM of TGF-ß type II receptor antisense 5' GATCTTGACTGCCACTGTCTC 3' or sense 5' TGTGTTCCTGTAGCTCTGATG 3' 21mer oligonucleotides for 24 h (28). The antisense and sense oligomers were designed according to the nucleotide sequences encoding human TGF-ß type II receptor cDNA with nucleotide 11691149 as targets. The antisense and sense oligomers were modified at both 5' and 3' end by phosphorothioation to improve their stability and used following high performance liquid chromatography purification, and in aqueous solution to achieve a correct final concentration. Following treatments, the cells were washed and treated with 2.5 ng/ml of TGF-ß1 for 15 min. Total protein was isolated and subjected to Western blot analysis. In all the experiments, untreated cells served as control.
All the experiments were performed at least two to three times in duplicate using independent cell cultures. Where appropriate, the data are expressed as mean ± SEM and statistically analyzed using unpaired Students t test and Kruskal-Wallis one-way ANOVA with Dunn test using computer software program SigmaStat (Jandel Co., San Rafael, CA). A probability level of P < 0.05 was considered significant.
 |
Results
|
|---|
Before isolation of endometrial epithelial and stromal cells, endometrial tissues were examined for the expression of Smad3, Smad4, and Smad7 mRNA and protein, and if they contained activated Smad (phosphorylated Smad3) using semiquantitative RT-PCR, Western blotting and immunohistochemistry. As shown in Fig. 1
endometrium express mRNA (Fig. 1A
) and protein (Fig. 1B
) for Smad3, Smad4, and Smad7 and contain phosphorylated Smad3 (pSmad2/3). The immunoreactive Smads were localized in the endometrial surface epithelial, glandular epithelial, and stromal cells (Fig. 1C
) with cytoplasmic (Smad3 and Smad4, Fig. 1C
, a and b), cytoplasmic/nuclear (Smad7, Fig. 1C
, c) and nuclear (pSmad2/3, Fig. 1C
, d) association. Endometrial epithelial (EEC) and stromal (ESC) cells isolated and maintained in culture, as well as HES cell line, also express Smad3, Smad4, and Smad7 mRNA and protein and contain pSmad2/3 (Fig. 2
shown for EES and ESC).

View larger version (120K):
[in this window]
[in a new window]
|
FIG. 1. The expression of Smad3, Smad4, and Smad7 mRNA (A) and protein (B), as well as phospho-Smad2/3 (pSmad2/3) in endometrial tissues (n = 3) from early-mid secretory phase of the menstrual cycle. Total RNA was extracted, and Smads and G3PDH (lower bands) were coamplified by RT-PCR (M, DNA marker). Total protein was analyzed by Western blotting. C, Immunohistochemical localization of Smad3 (a), Smad4 (b), Smad7 (c), and pSmad2/3 (d) in endometrial tissue sections with immunoreactive protein associated with glandular epithelial and stromal cells cytoplasm (a and b), cytoplasmic/ nuclear (c) and nuclear (d) regions. Magnification, x110.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2. The expression of Smad3, Smad4, and Smad7 mRNA (upper panel) and protein (lower panel) in EEC and ESC. Total RNA and protein was extracted from primary culture of EEC and ESC and analyzed by RT-PCR and Western blotting, respectively. Immunoreactive pSmad3 is shown in the lower panel.
|
|
To evaluate the effect of TGF-ß on Smads expression, HES and ESC were maintained under a serum-free condition for 24 h and then were treated with TGF-ß1 (2.5 ng/ml) for 2, 4, 6, and 12 h (mRNA), or 18, 24, and 36 h (protein), respectively. The results show that TGF-ß1, in a time-dependent manner moderately increased Smad3 and Smad7 expression, and showed a trend toward an increase in Smad4 mRNA expression in HES and ESC. The highest increase was seen for Smad7 expression in ESC after 6 h of treatment compared with untreated control (Fig. 3
). TGF-ß1 also increased the expression of Smad proteins in HES and ESC after 18, 24, and 36 h of treatments, which varied with time of incubation, cell types and Smads (Fig. 4
). These results indicate that under the condition of our study Smads are constitutively expressed in the endometrial cells and TGF-ß1 differentially regulates their expression in a time-, cell-, and Smad-specific manner.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3. The effect of TGF-ß1 on Smad3, Smad4 and Smad7 mRNA expression in HES and ESC. Serum-starved HES and ESC were treated with TGF-ß1 (2.5 ng/ml) for 212 h and total RNA was isolated from treated and untreated control (Ctrl) and Smad and G3PDH (lower bands) were coamplified by RT-PCR (M, DNA marker). The bar graphs show the mean ± SEM of fold change of ratio of Smad:G3PDH mRNA expression from three different experiments. d, b', c' and e' (Smad3), b' and e' (Smad4), b, c, and d, as well as b', c', d and e' (Smad7) are significantly different from a and a', respectively (P < 0.05).
|
|

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4. The effect of TGF-ß1 on Smad3, Smad4, and Smad7 protein expression in HES and ESC. Serum-starved HES and ESC were treated with TGF-ß1 (2.5 ng/ml) for 1836 h, the cell lysates were prepared from TGF-ß1-treated and untreated control (Ctrl) cells and analyzed by Western blotting shown from a representative assay. Bar graphs show the mean ± SEM of fold change in Smads expression from three different experiments. The denotes b, c', and d (Smad3); b, c, and d' (Smad4); and b, b', c, d, and d' (Smad7) are significantly different from a and a', respectively (P < 0.05).
|
|
Because endometrial epithelial and stromal cells express the necessary components of TGF-ß receptors (8, 11) and Smad-signaling pathway, we determined whether TGF-ß mediate its action through the activation of this pathway. HES and ESC maintained under a serum-free condition for 24 h and treated with TGF-ß1 (2.5 ng/ml) for 5, 15, and 30 min (time dependency), or TGF-ß1 (110 ng/ml) for 15 min (dose dependency), resulted in a time- and dose-dependent induction of pSmad3 in HES and ESC (Fig. 5
). The effect of TGF-ß1 on pSmad3 induction in HES and ESC varied with a maximal increase of 2- to 3-fold after 530 min of treatment (Fig. 5
) and at doses of 1 and 5 ng/ml (Fig. 6
). Because Smad3, Smad4, and Smad7 are constitutively expressed in HES and ESC, their total protein content displayed a trend toward an increase and/or decreased in both cell types following TGF-ß treatment (data not shown). The immunoreactive Smad3 was primarily localized in the cytoplasm of untreated HES and ESC, with increased nuclear translocation following TGF-ß treatment for 5, 15, and 30 min (Fig. 7
; micrographs show representative after 15 min of exposure). The effect of TGF-ß on pSmad3 induction was in part abrogated following pretreatment of HES and ESC with TGF-ß type II receptor antisense, but not sense oligonucleotides (Fig. 8
). In addition, antisense treatment resulted in an increase in Smad7 content compared with untreated or sense-treated control. These results suggest that TGF-ß action in the endometrium is mediated, at least in part, through the activation of Smad pathway.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 5. The effect of TGF-ß1 (2.5 ng/ml) on Smad3 activation in HES and ESC. Serum-starved cells were treated with TGF-ß for 5, 15, and 30 min then lysed and immunoblotted with antibody specific for phospho-Smad2/3 (pSmad2/3), total Smad3, and ß-actin. Bar graph shows the mean ± SEM of fold change in pSmad3 band intensity from three independent experiments with b', c, c', and d indicating significant difference with their respective controls (Ctrl, a and a') (P < 0.05).
|
|

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 6. Dose response action of TGF-ß1 on Smad3 induction in HES and ESC. Serum-starved cells were treated with TGF-ß (1, 2.5, 5, and 10 ng/ml) for 15 min then lysed and immunoblotted with antibody specific for phospho-Smad2/3 (pSmad2/3), total Smad3 and ß-actin. Bar graph shows the mean ± SEM of fold change in pSmad3 band intensity from three independent experiments with b, b', c, c', and d and d' indicating significant difference with their respective controls (Ctrl, a and a') (P < 0.05).
|
|

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 7. Immunofluorescence localization of Smad3 protein in HES (upper panel) and ESC (lower panel). The cells were incubated under serum-free condition for 24 h then treated with 2.5 ng/ml of TGF-ß for 5, 15, and 30 min. Note subcellular localization of Smad3 in untreated control with cytoplasmic localization and increased nuclear translocation in TGF-ß1-treated cells after 15 min. FITC staining was used to localize Smad3 and DAPI staining for the nuclei, and figures are shown after FITC/DAPI merge and DAPI.
|
|

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 8. The effect of TGF-ß1 on Smad3 activation in HES and ESC pretreated with TGF-ß type II receptor antisense or sense oligonucleotides for 24 h. The antisense- and sense-treated (+) cells were treated with TGF-ß1 (2.5 ng/ml) for 5, 15, and 30 min lysed and immunoblotted with antibody specific for phospho-Smad2/3 (pSmad2/3), Smad7 and ß-actin. Bar graphs show the mean ± SEM of fold change in pSmad3 and Smad7 band intensity from two independent experiments with figures showing a representative assay. Pretreatment with TGF-ß type II receptor antisense, but not sense reduced TGF-ß-induced Smad7 and pSmad3 in HES and ESC compared with untreated control (Ctrl). There was no change in ß-actin expression during these treatments.
|
|
 |
Discussion
|
|---|
TGF-ß is a multifunctional cytokine that is expressed in human endometrium throughout the menstrual cycle, and evidence suggests that it plays a central role in various normal uterine biological and pathological activities (2, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21). These actions of TGF-ß are mediated from the cell surface to the nucleus through TGF-ß receptors and activation of specific intracellular mediators that include Smads, which are recognized as major pathway in TGF-ß receptor-mediated signaling (21, 22, 23). In the present study, we evaluated the expression of Smads in human endometrium and endometrial epithelial and stromal cells and demonstrated that receptor-activated Smad3, common Smad4, and inhibitory Smad7 mRNA and protein are expressed in human endometrium, and isolated endometrial epithelial and stromal cells in culture. We also showed that TGF-ß1, in a dose-, time-, and cell-dependent manner regulates the expression of Smads in ESC and HES cells, a human endometrial epithelial cell line derived from spontaneous transformation of isolated endometrial surface epithelial cells from benign proliferative endometrium (27). Based on the expression and cellular distribution of Smads and pSmad3, the results suggest that human endometrium constitutively expresses all the necessary components of Smad signaling pathway that could be recruited and activated by TGF-ß receptors.
In vitro studies indicate that, unlike receptor-activated Smads, the inhibitory Smads are primarily localized in the nucleus in the absence of ligand but accumulate in the cytoplasm following receptor activation (29). We observed both cytoplasmic/nuclear localizations of Smads, with mostly nuclear pSmad2/3 localization, suggesting that in the endometrium the Smad pathway is present in an activated form possibly due to TGF-ßs autocrine/paracrine action. In addition, Smad3 and pSmad2/3 localization in quiescent ESC and HES showed similar patterns with increased nuclear localization in response to TGF-ß treatment. Activated TGF-ß receptors recruit both Smad2 and Smad3; however, their activation and nuclear translocation is reported to differ in response to TGF-ß (30). Smad3 activation is reported to occur in activated cells, whereas Smad2 nuclear translocation occurs primarily in quiescent cells (30). Because ESC and HES were maintained under a serum-free condition (quiescent), TGF-ß-activated Smad3 and its nuclear translocation in these cells may be regulated differently. Whether Smad2 and Smad3 activation in the endometrial cells is stage specific (activated vs. quiescent) is not yet determined; it could, however, influence TGF-ß-mediated action during the menstrual cycle (proliferative vs. secretory phase), at different endometrial regions (basalis vs. functionalis), reproductive vs. postmenopausal periods, and normal vs. endometrial disorders, each consisting of populations of actively growing and quiescent cell types.
In addition to expression of Smads, their regulation is equally important as part of regulatory mechanisms that control TGF-ß autocrine/paracrine action. Interestingly, TGF-ß is reported to act as a key regulator of Smads expression in various cell types, including increased Smad-7 expression in skin fibroblasts, Mv1Lu and HaCaT cell lines, and inhibition of Smad3 in skin fibroblasts, but not in MDA-MB468, human breast cancer cell line deficient in Smad4 (31, 32, 33). Our results show that TGF-ß has a moderate regulatory action of the expression of Smad in the endometrium, by increasing Smad3 and Smad7 in ESC and HES. Because ovarian steroids regulate the expression of TGF-ß in steroid-sensitive tissues, including endometrium, they may also influence Smad expression (34). A recent report indicates that Smad3 and Smad4 act as coregulators of estrogen receptor (ER)
(35), and cross talk between TGF-ß and ER to suppress TGF-ß-activated Smad3 in breast cancer cell lines, without affecting Smads expression (36). Smad3 induction is reported to repress androgen receptor-mediated, but not ER-mediated transcriptional activation, whereas rat prostate epithelial cells undergoing apoptosis as a result of castration is accompanied by increased Smad7 expression (37, 38, 39).
Constitutive expression of Smads and their regulation by TGF-ß1 in dose-, time-, cell-, and Smad-specific manner suggests the presence of a self-regulatory feedback mechanism that may regulate TGF-ß action in the endometrium. In addition, cell- and dose-dependent induction of pSmad3 suggests that TGF-ß autocrine/paracrine action in the endometrium is mediated, at least in part, through this pathway. We also observed some variations in TGF-ß-induced Smads activation in endometrial epithelial and stromal cells during time- and dose-dependent experiments. These variations most likely are due differences in cell to cell (stromal cell) preparations, response to TGF-ß following passaging, or TGF-ß receptor content and affinity. The differences in Smad expression and activation between the endometrial epithelial and stromal cells may also reflect the autocrine/paracrine action of TGF-ß in endometrial microenvironment and as an important regulator of local endometrial function. Using TGF-ß receptor antisense to block the autocrine/paracrine actions of TGF-ß on Smad activation indicated the importance of such actions, although further evidence is required to demonstrate the level of interference with TGF-ß receptor expression. We have previously demonstrated that treatment with TGF-ß receptor antisense and TGF-ß receptor antibody significantly reduced TGF-ß self-regulating action in leiomyoma and myometrial smooth cell (40).
A rapid induction of pSmad3 as well as differential regulation of Smad7 further suggests simultaneous utilization of both agonist and antagonist Smads in the endometrial cells. Because Smad7 interaction with activated TGF-ß receptors prevents Smad3 activation, changes in Smad7 expression may function as an intracellular regulator of TGF-ß signaling in endometrial cells, since inhibition and/or induction of Smad7 results in alteration of cellular responsiveness to TGF-ß (22, 23, 24, 29, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41). Alterations in the expression of Smad have been associated with various pathological disorders, including their aberrant, which leads to loss of response to TGF-ß inhibitory action (23). In endometrial abnormalities such as endometriosis, leiomyoma, and endometrial cancer with altered TGF-ß and TGF-ß receptor expression, changes in Smad expression, regulation, and activation may further be associated with these disorders. Our preliminary results and a recent report indicate that Smads expression is altered in endometrial cancer compared with normal endometrium (34, 42).
Alternatively, TGF-ß can activate components of other signaling pathways including MAPK, protein kinase C, and Ca+2/Calmodulin (23, 43, 44, 45) that are expressed and activated by growth factors and peptide hormones in human endometrium (46, 47). Our preliminary result indicates that TGF-ß can similarly activate MAPK in HES and ESC (48). Although activation of each individual pathway by TGF-ß may have a specific regulatory function in the endometrial environment, it is important to note that cross talk and interactions among these pathways is also important in regulation of specific gene expression downstream from each pathway. Smad3 is reported to serve as a substrate for ERK2 and ERK2-dependent activation of Smad2 resulting in increased Smad2 nuclear localization and activity (45, 49). Interestingly, ovarian steroid receptors also activate MAPK (50, 51) and Smads (35), suggesting that cross talk and activation of multiple pathways may be necessary for implementation of estrogen and TGF-ß receptor interactions in the endometrium under both normal and pathological conditions.
In summary, the results show that human endometrium and endometrial epithelial and stromal cells express Smads mRNA and protein, where they are differentially expressed, regulated and activated by TGF-ß in dose-, time-, and cell-specific manner. Considering the importance of TGF-ß in various normal endometrial biological activities and associated abnormalities, it is necessary to further investigate the implication of Smads in these processes through regulation of genes downstream from this pathway.
 |
Footnotes
|
|---|
This work was supported in part by NIH Grant HD37432. This work was presented in part at the 49th Annual Meeting of the Society for Gynecological Investigation, Los Angeles, California, March 2002.
Abbreviations: DAPI, 4',6-Diamidino-2-phenylindole; EEC, endometrial epithelial cell; ER, estrogen receptor; ESC, endometrial stromal cell; FITC, fluorescein isothiocyanate; G3PDH, glyceraldehyde-3-phosphate dehydrogenase; HES, human endometrial epithelial cell line; pSmad3, phosphorylated Smad3.
Received February 19, 2003.
Accepted June 16, 2003.
 |
References
|
|---|
- Kauma SW 2000 Cytokines in implantation. J Reprod Fertil Suppl 55:3142[Medline]
- Chegini N, Williams RS 2000 Implication of growth factor and cytokine networks in endometrium. In Hill J, ed. Cytokines in human reproduction. New York: Wiley and Sons; 92132
- Selam B, Arici A 2000 Implantation defect in endometriosis: endometrium or peritoneal fluid. J Reprod Fertil Suppl 55:121128[Medline]
- Burton JL, Wells M 1998 Recent advances in the histopathology and molecular pathology of carcinoma of the endometrium. Histopathology 33:297303[CrossRef][Medline]
- Bulun SE, Gurates B, Fang Z, Tamura M, Sebastian S, Zhou J, Amin S, Yang S 2002 Mechanisms of excessive estrogen formation in endometriosis. J Reprod Immunol 55:2133[CrossRef][Medline]
- Lawrence DA 1996 Transforming growth factor-beta: a general review. Eur Cytokine Netw 7:363374[Medline]
- Branton MH, Kopp JB 1999 TGF-ß and fibrosis. Microbes Infect 1:13491365[CrossRef][Medline]
- Chegini N, Zhao Y, Williams RS, Flanders KC 1994 Human uterine tissue throughout the menstrual cycle expresses transforming growth factor-ß 1 (TGF-ß1), TGFß2, TGF ß3, and TGF ß type II receptor messenger ribonucleic acid and protein and contains [125I]TGF-ß1-binding sites. Endocrinology 135:439449[Abstract]
- Chegini N, Tang XM, Dou Q 1999 The expression, activity and regulation of granulocyte macrophage-colony stimulating factor in human endometrial epithelial and stromal cells. Mol Hum Reprod 5:459466[Abstract/Free Full Text]
- Arici A, MacDonald PC, Casey ML 1996 Modulation of the levels of transforming growth factor ß messenger ribonucleic acids in human endometrial stromal cells. Biol Reprod 54:463469[Abstract]
- Dumont N, OConnor-McCourt MD, Philip A 1995 Transforming growth factor-ß receptors on human endometrial cells: identification of the type I, II, and III receptors and glycosyl-phosphatidylinositol anchored TGF-ß binding proteins. Mol Cell Endocrinol 111:5766[CrossRef][Medline]
- Casslen B, Sandberg T, Gustavsson B, Willen R, Nilbert M 1998 Transforming growth factor ß1 in the human endometrium. Cyclic variation, increased expression by estradiol and progesterone, and regulation of plasminogen activators and plasminogen activator inhibitor-1. Biol Reprod 58:13431350[Abstract/Free Full Text]
- Sandberg T, Casslen B, Gustavsson B, Benraad TJ 1998 Human endothelial cell migration is stimulated by urokinase plasminogen activator:plasminogen activator inhibitor 1 complex released from endometrial stromal cells stimulated with transforming growth factor ß1; possible mechanism for paracrine stimulation of endometrial angiogenesis. Biol Reprod 59:759767[Abstract/Free Full Text]
- Lea RG, Underwood J, Flanders KC, Hirte H, Banwatt D, Finotto S, Ohno I, Daya S, Harley C, Michel M 1995 A subset of patients with recurrent spontaneous abortion is deficient in transforming growth factor ß-2-producing "suppressor cells" in uterine tissue near the placental attachment site. Am J Reprod Immunol 34:5264
- Bruner KL, Eisenberg E, Gorstein F, Osteen KG 1999 Progesterone and transforming growth factor-ß coordinately regulate suppression of endometrial matrix metalloproteinases in a model of experimental endometriosis. Steroids 64:648653[CrossRef][Medline]
- Blobe GC, Schiemann WP, Lodish HF 2000 Role of transforming growth factor ß in human disease. N Engl J Med 342:13501358[Free Full Text]
- Chegini N, Gold LI, Williams RS 1994 Localization of transforming growth factor ß isoforms TGF-ß1, TGF-ß2, and TGF-ß3 in surgically induced endometriosis in the rat. Obstet Gynecol 83:455461[Medline]
- Chegini N, Rong H, Bennett B, Stone IK 1999 Peritoneal fluid cytokine and eicosanoid levels and their relation to the incidence of peritoneal adhesion. J Soc Gynecol Invest 6:153157[CrossRef][Medline]
- Ripley D, Tang XM, Ma C, Chegini N 2001 The expression and action of granulocyte macrophage-colony stimulating factor and its interaction with TGF-ß in endometrial carcinoma. Gynecol Oncol 81:301309[CrossRef][Medline]
- Gold LI, Saxena B, Mittal KR 1994 Increased expression of transforming growth factor beta isoforms and basic fibroblast growth factor in complex hyperplasia and adenocarcinoma of the endometrium: evidence for paracrine and autocrine action. Cancer Res 54:23472358[Abstract/Free Full Text]
- Zimmerman CM, Padgett RW 2000 Transforming growth factor beta signaling mediators and modulators. Gene 249:1730[CrossRef][Medline]
- Massague J, Wotton D 2000 Transcriptional control by the TGF-ß/Smad signaling system. EMBO J 19:17451754[CrossRef][Medline]
- Moustakas A, Souchelnytskyi S, Heldin CH 2001 Smad regulation in TGF-ß signal transduction. J Cell Sci 114:43594369
- Kato S, Ueda S, Tamaki K, Fuji M, Miyazono K, ten Dijke P, Morimatsu M, Okuda S 2001 Ectopic expression of Smad7 inhibits transforming growth factor-beta responses in vascular smooth muscle cells. Life Sci 69:26412652[CrossRef][Medline]
- Chegini N, Rossi MJ, Masterson BJ 1992 Platelet-derived growth factor (PDGF), epidermal growth factor (EGF), and EGF and PDGF ß-receptors in human endometrial tissue: localization and in vitro action. Endocrinology 130:23732385[Abstract/Free Full Text]
- Tang XM, Zhao Y, Rossi MJ, Abu-Rustum RS, Ksander GA, Chegini N 1994 Expression of transforming growth factor-ß (TGF ß) isoforms and TGF ß type II receptor messenger ribonucleic acid and protein, and the effect of TGF ßs on endometrial stromal cell growth and protein degradation in vitro. Endocrinology 135:450459[Abstract]
- Desai NN, Kennard EA, Kniss DA, Friedman CI 1994 Novel human endometrial cell line promotes blastocyst development. Fertil Steril 61:760766[Medline]
- Xu J, Luo X, Chegini N 2003 Differential expression, regulation, and induction of Smads, transforming growth factor-ß signal transduction pathway in leiomyoma, and myometrial smooth muscle cells and alteration by gonadotropin-releasing hormone analog. J Clin Endocrinol Metab 88:13501361[Abstract/Free Full Text]
- Itoh S, Landstrom M, Hermansson A, Itoh F, Heldin CH, Heldin NE, ten Dijke P 1998 Transforming growth factor ß1 induces nuclear export of inhibitory Smad7. J Biol Chem 273:2919529201[Abstract/Free Full Text]
- Liu C, Gaca MD, Swenson ES, Vellucci VF, Reiss M, Wells RG 2003 Smads 2 and 3 are differentially activated by transforming growth factor-ß (TGF-ß) in quiescent and activated hepatic stellate cells. Constitutive nuclear localization of Smads in activated cells is TGF-ß-independent. J Biol Chem 278:1172111728[Abstract/Free Full Text]
- Mori Y, Chen SJ, Varga J 2000 Modulation of endogenous Smad expression in normal skin fibroblasts by transforming growth factor-beta. Exp Cell Res 258:374383[CrossRef][Medline]
- Stopa M, Anhuf D, Terstegen L, Gatsios P, Gressner AM, Dooley S 2000 Participation of Smad2, Smad3, and Smad4 in transforming growth factor beta (TGF-ß)-induced activation of Smad7. The TGF-ß response element of the promoter requires functional Smad binding element and E-box sequences for transcriptional regulation. J Biol Chem 275:2930829317[Abstract/Free Full Text]
- Dong C, Zhu S, Wang T, Yoon W, Li Z, Alvarez RJ, ten Dijke P, White B, Wigley FM, Goldschmidt-Clermont PJ 2002 Deficient Smad7 expression: a putative molecular defect in scleroderma. Proc Natl Acad Sci USA 99:39083913[Abstract/Free Full Text]
- Chegini N, Ripley D, Ripps BA 2001 Expression of Smads, transforming growth factor ß signal transduction protein, in normal endometrium and endometrial cancer. J Soc Gynecol Investig 8(Suppl):196A
- Wu L, Wu Y, Gathings B, Wan M, Li X, Grizzle W, Liu Z, Lu C, Mao Z, Cao X 2003 Smad4 as a transcription corepressor for estrogen receptor
. J Biol Chem 278:1519215200[Abstract/Free Full Text]
- Matsuda T, Yamamoto T, Muraguchi A, Saatcioglu F 2001 Cross-talk between transforming growth factor-ß and estrogen receptor signaling through Smad3. J Biol Chem 276:4290842914[Abstract/Free Full Text]
- Pouliot F, Labrie C 1999 Expression profile of agonistic Smads in human breast cancer cells: absence of regulation by estrogens. Int J Cancer 81:98103[CrossRef][Medline]
- Hayes SA, Zarnegar M, Sharma M, Yang F, Peehl DM, ten Dijke P, Sun Z 2001 Smad3 represses androgen receptor-mediated transcription. Cancer Res 61:21122118[Abstract/Free Full Text]
- Landstrom M, Heldin NE, Bu S, Hermansson A, Itoh S, ten Dijke P, Heldin CH 2000 Smad7 mediates apoptosis induced by transforming growth factor beta in prostatic carcinoma cells. Curr Biol 10:535538[CrossRef][Medline]
- Chegini N, Tang XM, Ma C, Williams RS 2002 The effects of gonadotropin releasing hormone analogues "add-back" antiestrogen and antiprogestins on leiomyoma and myometrial smooth muscle cells growth and transforming growth factor ß expression. Mol Hum Reprod 12:10711078
- Inagaki Y, Mamura M, Kanamaru Y, Greenwel P, Nemoto T, Takehara K, Ten Dijke P, Nakao A 2001 Constitutive phosphorylation and nuclear localization of Smad3 are correlated with increased collagen gene transcription in activated hepatic stellate cells. J Cell Physiol 187:117123[CrossRef][Medline]
- Parekh TV, Gama P, Wen X, Demopoulos R, Munger JS, Carcangiu ML, Reiss M, Gold LI 2002 Transforming growth factor ß signaling is disabled early in human endometrial carcinogenesis concomitant with loss of growth inhibition. Cancer Res 62:27782790[Abstract/Free Full Text]
- Mulder KM 2000 Role of Ras and MAPKs in TGF-ß signaling. Cytokine Growth Factor Rev 11:2335[CrossRef][Medline]
- Yakymovych I, Ten Dijke P, Heldin CH, Souchelnytskyi S 2001 Regulation of Smad signaling by protein kinase C. FASEB J 15:553555[Free Full Text]
- Scherer A, Graff JM 2000 Calmodulin differentially modulates Smad1 and Smad2 signaling. J Biol Chem 275:4143041438[Abstract/Free Full Text]
- Tamura M, Sebastian S, Yang S, Gurates B, Fang Z, Bulun SE 2002 2002 Interleukin-1ß elevates cyclooxygenase-2 protein level and enzyme activity via increasing its mRNA stability in human endometrial stromal cells: an effect mediated by extracellularly regulated kinases 1 and 2. J Clin Endocrinol Metab 87:32633273[Abstract/Free Full Text]
- Simmen RC, Zhang XL, Michel FJ, Min SH, Zhao G, Simmen FA 2002 Molecular markers of endometrial epithelial cell mitogenesis mediated by the Sp/Kruppel-like factor BTEB1. DNA Cell Biol 21:115128[CrossRef][Medline]
- Luo X, Xu J, Chegini N 2003 Transforming growth factor beta and gonadotropin releasing hormone analogue recruit and activate MAPK in endometrial epithelial and stromal cells. J Soc Gynecol Invest 10:106A
- de Caestecker MP, Parks WT, Frank CJ, Castagnino P, Bottaro DP, Roberts AB, Lechleider RJ 1998 Smad2 transduces common signals from receptor serine-threonine and tyrosine kinases. Genes Dev 12:15871592[Abstract/Free Full Text]
- Hall JM, Couse JF, Korach KS 2001 The multifaceted mechanisms of estradiol and estrogen receptor signaling. J Biol Chem 276:3686936872[Free Full Text]
- Richer JK, Lange CA, Manning NG, Owen G, Powell R, Horwitz KB 1998 Convergence of progesterone with growth factor and cytokine signaling in breast cancer. Progesterone receptors regulate signal transducers and activators of transcription expression and activity. J Biol Chem 273:3131731326[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
C. O.A. Omwandho, L. Konrad, G. Halis, F. Oehmke, and H.-R. Tinneberg
Role of TGF-{beta}s in normal human endometrium and endometriosis
Hum. Reprod.,
November 5, 2009;
(2009)
dep382v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-g. Liu, R. R. Tekmal, P. A. Binkley, H. B. Nair, R. S. Schenken, and N. B. Kirma
Induction of endometrial epithelial cell invasion and c-fms expression by transforming growth factor beta
Mol. Hum. Reprod.,
October 1, 2009;
15(10):
665 - 673.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.J.A.F. van Kaam, J.P. Schouten, A.W. Nap, G.A.J. Dunselman, and P.G. Groothuis
Fibromuscular differentiation in deeply infiltrating endometriosis is a reaction of resident fibroblasts to the presence of ectopic endometrium
Hum. Reprod.,
December 1, 2008;
23(12):
2692 - 2700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Bukulmez, D. B. Hardy, B. R. Carr, R. J. Auchus, T. Toloubeydokhti, R. A. Word, and C. R. Mendelson
Androstenedione Up-Regulation of Endometrial Aromatase Expression via Local Conversion to Estrogen: Potential Relevance to the Pathogenesis of Endometriosis
J. Clin. Endocrinol. Metab.,
September 1, 2008;
93(9):
3471 - 3477.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Pan, X. Luo, T. Toloubeydokhti, and N. Chegini
The expression profile of micro-RNA in endometrium and endometriosis and the influence of ovarian steroids on their expression
Mol. Hum. Reprod.,
November 1, 2007;
13(11):
797 - 806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Huang, M. A. Mulcahey, A. Crescenzi, M. Chung, B. W. Kim, C. Barnes, W. Kuijt, H. Turano, J. Harney, and P. R. Larsen
Transforming Growth Factor-{beta} Promotes Inactivation of Extracellular Thyroid Hormones via Transcriptional Stimulation of Type 3 Iodothyronine Deiodinase
Mol. Endocrinol.,
December 1, 2005;
19(12):
3126 - 3136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.R. Kim, D.W. Park, J.H. Lee, D.S. Choi, K.J. Hwang, H.S. Ryu, and C.K. Min
Progesterone-dependent release of transforming growth factor-beta1 from epithelial cells enhances the endometrial decidualization by turning on the Smad signalling in stromal cells
Mol. Hum. Reprod.,
November 1, 2005;
11(11):
801 - 808.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Lee, J. E. Lee, J. H. Park, S. J. Kim, M. K. Kim, S. I. Roh, and H. S. Yoon
Establishment and Maintenance of Human Embryonic Stem Cell Lines on Human Feeder Cells Derived from Uterine Endometrium under Serum-Free Condition
Biol Reprod,
January 1, 2005;
72(1):
42 - 49.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Ding, J. Xu, X. Luo, and N. Chegini
Gonadotropin Releasing Hormone and Transforming Growth Factor {beta} Activate Mitogen-Activated Protein Kinase/Extracellularly Regulated Kinase and Differentially Regulate Fibronectin, Type I Collagen, and Plasminogen Activator Inhibitor-1 Expression in Leiomyoma and Myometrial Smooth Muscle Cells
J. Clin. Endocrinol. Metab.,
November 1, 2004;
89(11):
5549 - 5557.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Luo, L. Ding, and N. Chegini
Gonadotropin-releasing hormone and TGF-{beta} activate MAP kinase and differentially regulate fibronectin expression in endometrial epithelial and stromal cells
Am J Physiol Endocrinol Metab,
November 1, 2004;
287(5):
E991 - E1001.
[Abstract]
[Full Text]
[PDF]
|
 |
|