| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Medicine, Division of Diabetes (J.W., H.Y.-J., S.V.), and Department of Oncology (A.-M.H.), University of Helsinki, 00029 Helsinki, Finland; and Endocrinology Unit (R.A., D.J.W., J.R.S., B.R.W.), University of Edinburgh, Western General Hospital, Edinburgh EH4 2XU, United Kingdom
Address all correspondence and requests for reprints to: Prof. Brian R. Walker, University of Edinburgh, Endocrinology Unit, Western General Hospital, Edinburgh EH4 2XU, United Kingdom. E-mail: b.walker{at}ed.ac.uk.
| Abstract |
|---|
|
|
|---|
- and 5ß-reductases in the liver may drive compensatory activation of the hypothalamic-pituitary-adrenal axis, hence increasing adrenal androgens and android central obesity. This study aimed to examine relationships between these enzymes and detailed measurements of body fat distribution. Twenty-five healthy men (age, 2257 yr; body mass index, 20.635.6 kg/m2) were recruited from occupational health services. Body composition was assessed by anthropometric measurements, bioimpedance, and cross-sectional abdominal magnetic resonance imaging scans. Liver fat content was assessed by magnetic resonance imaging spectroscopy. Insulin sensitivity was measured in a euglycemic hyperinsulinemic clamp. Cortisol metabolites were measured in a 24-h urine sample by gas chromatography-mass spectrometry. In vivo hepatic 11HSD1 activity was measured by generation of plasma cortisol after an oral dose of cortisone. In vitro 11HSD1 activity and mRNA were measured in 18 subjects who consented to provide abdominal sc adipose biopsies.
Indices of obesity (body mass index, whole-body percentage fat, waist/hip ratio) were associated with higher urinary excretion of 5
- and 5ß-reduced cortisol metabolites (for percentage fat, P < 0.05 and P < 0.01, respectively) and increased adipose 11HSD1 activity (P < 0.05). Liver fat accumulation was associated with a selective increase in urinary excretion of 5ß-reduced cortisol and cortisone metabolites (P < 0.01) and a lower ratio of cortisol/cortisone metabolites in urine (P < 0.001) but no difference in in vivo cortisone-to-cortisol conversion or in vitro adipose 11HSD1. Higher excretion of 5ß-reduced cortisol metabolites was independently associated with insulin resistance and hypertriglyceridemia. Lower conversion of cortisone to cortisol was associated with lower fasting plasma cortisol (P < 0.01). However, visceral adipose fat mass was not associated with indices of cortisol metabolism; indeed, after adjusting for the effects of whole-body and liver fat, increased visceral fat was associated with lower cortisol metabolite excretion.
We conclude that alterations in 11HSD1 and hepatic 5
-reductase activity are associated with generalized, rather than central, obesity in humans. Activation of 5ß-reductase in men with fat accumulation in the liver may confound the interpretation of cortisol metabolite excretion when liver fat content is unknown, and may contribute to altered bile acid and cholesterol metabolism in nonalcoholic steatohepatitis.
| Introduction |
|---|
|
|
|---|
Recent studies have explored the enzymes that are dysregulated in obesity. The principle routes of clearance of cortisol in the liver are catalyzed by 5
- and 5ß-reductase enzymes. Activity and mRNA for these enzymes is increased in the liver of obese rodents (10); and in humans, anthropometric indices of obesity [including increased body mass index (BMI), waist circumference, and waist/hip ratio] are associated with increased excretion of 5
- and 5ß-reduced metabolites of cortisol (11, 12, 13). Increased inactivation of cortisol by these A-ring reductases may explain lower plasma cortisol in obesity (14, 15). Compensatory activation of the hypothalamic-pituitary-adrenal axis may drive increased adrenal androgen secretion and thus amplify a central (or android body fat distribution) (1). However, studies to date have not been able to distinguish whether increased excretion of 5
- and/or 5ß-reduced cortisol metabolites is specifically associated with central obesity.
In addition, regeneration of cortisol from the inactive steroid precursor cortisone by the enzyme 11ß-hydroxysteroid dehydrogenase (HSD) type 1 (11HSD1) is altered in idiopathic obesity. This dysregulation is tissue-specific: obesity is associated with decreased 11HSD1 activity in liver but increased 11HSD1 activity in adipose tissue of both rodents and humans (10, 16, 17, 18, 19, 20). Because both glucocorticoid receptor and 11HSD1 expression and activity are higher in visceral adipocytes than in sc adipocytes (21, 22), at least in primary culture, it has been proposed that increased 11HSD1 will be most important within visceral adipose tissue, where it may be responsible for "Cushings disease of the omentum" (22).
The potency of 11HSD1 in determining body fat distribution and its associated metabolic complications is illustrated by experiments in mice. Transgenic mice with selective overexpression of 11HSD1 in white adipose tissue under the AP2 promoter/enhancer develop central obesity (23), whereas homozygous 11HSD1 knockout mice show lower weight gain and preferential distribution of fat to sc (rather than visceral) adipose stores during high-fat feeding (24). AP211HSD1 overexpressors (23) also exhibit triglyceride accumulation in the liver, putatively because of increased delivery of both free fatty acids and corticosterone in the portal vein. Preliminary data in ApoE-11HSD1 transgenic lines suggest that liver-specific overexpression of 11HSD1 also results in excess fat accumulation in the liver (25). Against this background, it is hypothesized that high adipose 11HSD1 activity will be associated with preferential accumulation of fat in visceral adipose tissue. Furthermore, we hypothesize that decreased hepatic 11HSD1 activity may protect against liver fat accumulation by lowering intrahepatic cortisol concentrations.
To address in detail the relationships between cortisol metabolism and body fat distribution, we have undertaken a study of cortisol metabolism in a group of healthy men in whom body fat distribution and associated metabolic parameters have been carefully characterized, and include assessment of liver fat content by magnetic resonance imaging (MRI) spectroscopy and visceral fat mass by cross-sectional MRI.
| Subjects and Methods |
|---|
|
|
|---|
Men were recruited from occupational health services in Helsinki. The subjects did not use any drugs and were healthy as judged by history and physical examination, negative serology (for hepatitis A, B, or C or of autoimmune hepatitis), and the absence of clinical features of inborn errors of metabolism or a history of use of toxins or drugs associated with steatosis, except for moderate alcohol consumption (<20 g/d). Alcohol consumption was assessed by detailed history and laboratory markers (serum
-glutamyltranspeptidase, the aspartate aminotransferase/alanine aminotransferase ratio, and mean corpuscular volume). Written informed consent was obtained. The experimental protocol was approved by the ethical committee of the Helsinki University Hospital.
Body composition
Height, weight, waist and hip circumferences, and whole-body composition by bioimpedance plethysmography (Bio-Electrical Impedance Analysis System, Model no. BIA-101A; RJL Systems, St. Louis, MO) were measured after overnight fasting as previously described (26). In addition, body fat distribution was measured in the liver by MRI proton spectroscopy using methylene signal intensity and in the abdomen by cross-sectional MRI using data from 16 10-mm slices (26).
In vivo insulin sensitivity of glucose production and disposal
At 0800 h, after an overnight fast, blood pressure was recorded, basal blood samples were obtained for the measurements in Table 1
, and subjects underwent a euglycemic hyperinsulinemic clamp as previously described (3). Glucose production and disposal were measured by infusion of [3-3H]glucose in a primed (20 µCi) continuous (0.2 µCi/min) fashion for a total of 360 min (27). After 120 min, insulin was infused in a primed-continuous (0.3 mU/kg·min) fashion. Plasma glucose was maintained at 5 mM (90 mg/dl) until 360 min, using a variable rate infusion of 20% glucose. Glucose kinetics and percentage suppression of free fatty acids from baseline were calculated during the final 60 min of the clamp. Serum free insulin concentrations were measured using RIA (Pharmacia Insulin RIA kit; Pharmacia, Uppsala, Sweden) after precipitation with polyethylene glycol. Plasma glucose concentrations were measured in duplicate with the glucose oxidase method using Beckman Glucose Analyzer II (Beckman Instruments, Fullerton, CA). Serum free fatty acids were measured using a fluorometric method. Serum lipids were measured as previously described (26).
|
On another day, subjects completed a 24-h urine collection. Excretion of cortisol and its metabolites [5ß-tetrahydrocortisol (THF), 5
-THF, 5ß-tetrahydrocortisone (THE), cortols, cortolones, and cortisone] was measured by electron impact gas chromatography-mass spectrometry as previously described (28). Total cortisol excretion was calculated from the sum of 5ß-THF, 5
-THF, THE, cortols, and cortolones (29). The balance between 11HSD activities in all tissues was assessed as the ratio of (5ß-THF + 5
-THF)/THE. Renal 11ß-HSD type 2 activity was assessed as urinary cortisol/cortisone ratio (28, 30). The balance of 5
- and 5ß-reductases was assessed by the ratio 5ß-THF/5
-THF (11). Relative 5
- and 5ß-reduction of cortisol was also assessed by Ulicks A-ring reduction quotients, 5
-THF/cortisol, 5ß-THF/cortisol, and 5ß-THE/cortisone (31).
On another day, conversion of cortisone to cortisol by 11HSD1 on first pass through the liver was measured after the subjects took 1 mg oral dexamethasone at 2300 h to suppress endogenous cortisol production and fasted overnight (16, 17, 32). The next morning, a catheter was inserted into an antecubital vein for blood sampling, and the subjects ingested 25 mg cortisone acetate. Plasma cortisol was then measured every 15 min for 90 min using a direct RIA (ICN Pharmaceuticals, Basingstoke, UK). Corticosteroid-binding globulin (CBG) was measured by RIA on the first sample (Medgenix Diagnostics, Fleurus, Belgium).
Intraadipose cortisol metabolism
A randomly selected subgroup of subjects who consented to providing a biopsy reattended between 0800 and 1200 h on another day, when a sc adipose biopsy of approximately 500 mg was obtained under local anesthesia through a 2- to 3-cm incision from the paraumbilical anterior abdominal wall. Subcutaneous fat was frozen immediately in two aliquots in liquid nitrogen.
Adipose 11HSD1 activity was measured in one aliquot of the biopsies as previously described (17, 18, 20) by homogenizing in Krebs buffer at pH 7.4 and incubating 750 µg protein/ml at 37 C with nicotinamide adenine dinucleotide phosphate (2 mM) and 1,2,6,7-3H4-cortisol (100 nM) for 30 h. Samples were withdrawn at 3, 6, 20, and 30 h for separation of cortisol and cortisone by HPLC with on-line liquid scintillation detection. Enzyme activity was measured in the dehydrogenase (cortisol to cortisone) direction in vitro, rather than the reductase (cortisone to cortisol) reaction preferred in vivo, because dehydrogenase activity is more stable once the enzyme is liberated from its intracellular environment (33), and, under these conditions, the dehydrogenase activity has a linear relationship with protein content added to the assay.
A second aliquot of the biopsy was analyzed for 11HSD1 mRNA as previously described (20). Approximately 500 mg fat was homogenized in 1.5 ml Trizol (Gibco PRL, Paisley, UK), and RNA was purified using RNAid RNA binding matrix (Anachem, Luton, UK), washed three times, and dissociated by addition of diethylpyrocarbonate H20/dithiothreitol/RNAsin. RNA was quantified using spectrophotometric analysis at OD260. RNA integrity was checked by agarose gel electrophoresis. Oligo dT-primed cDNA was synthesized from 0.5-µg RNA samples using Promega Reverse Transcription System (Promega, Southampton, UK). Transcript level quantification for 11HSD1 was performed with Real Time PCR primer-probe sets using the ABI PRISM 7700 Sequence Detection System with the following primers and probes: 5'GGAATATTCAGTGTCCAGGGTCAA3' (forward), 5'TGATCTCCAGGGCACATTCCT3' (reverse), and 5'-6-FAM-CTTGGCCTCATAGACACAGAAACAGCCA-TAMRA-3' (probe). Human cyclophyllin (Applied Biosystems, Cheshire, UK) primers/probes were included in a multiplex reaction with the probes/primers for the gene of interest to normalize the transcript levels. A standard curve for each primer probe set was generated in triplicate by serial dilution of cDNA pooled from several subjects. Each sample was run in duplicate, and the mean values of the duplicates were used to calculate transcript level. Reverse transcriptase negative controls and intron spanning primers were used to examine for genomic DNA and prevent amplification.
Statistical analyses
Areas under curves for conversion of cortisone to cortisol in vivo and for 11HSD1 activity in adipose in vitro were calculated using the trapezoidal rule. Variables were log-transformed if necessary to obtain a normal distribution, as indicated in the tables. Pearson correlation analyses were performed to identify associations. Confounding between associations was addressed using forward stepwise multiple linear regression analysis with variables entering the final model if F was more than 1.0. All data are shown as mean ± SE of mean. A P value < 0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
Participating men were 2257 yr old, with a wide range of BMI (20.635.6 kg/m2), waist/hip ratio (0.851.1), whole-body fat (11.231.0%), visceral fat (14237025 cm3), sc abdominal fat (13024650 cm3), and liver fat (141%). Characteristics of men who provided a biopsy (n = 18) were not different from those who did not (n = 7) (data not shown). Associations between body composition variables are shown in Table 1
. For illustration, data are shown for subjects above or below the median for each measurement of body composition; however, statistical comparisons were by Pearson correlations. Body composition did not change significantly with increasing age, but subjects with generalized or visceral obesity tended to be older. Increased whole-body fat was associated with higher BMI and liver fat content. Increased visceral fat was associated with higher BMI. However, waist/hip ratio correlated more strongly with MRI measurements of sc abdominal fat mass (r = 0.39, P = 0.05) than with visceral fat mass (r = 0.20, P = 0.35).
Indices of cortisol metabolism
There were no associations between urinary excretion of cortisol metabolites, conversion of oral cortisone to cortisol in vivo, or adipose 11HSD1 activity. However, adipose 11HSD1 mRNA and activity were closely correlated (r = 0.77, P < 0.001). Plasma CBG levels were not correlated with any body composition or metabolic variables, so that total plasma cortisol values were used in the analyses of hepatic 11HSD1 activity in vivo.
Associations of cortisol metabolism and body composition
Results of Pearson correlations are in Table 1
. Increasing whole-body fat was associated with increased excretion of all of the major metabolites of cortisol and with evidence consistent with previously described tissue-specific alterations in 11HSD1 activity (i.e. increased 11HSD1 activity in adipose tissue with nonsignificant trends for increased adipose 11HSD1 mRNA and reduced hepatic conversion of oral cortisone to cortisol in vivo). Similar associations of glucocorticoid parameters were observed with waist circumference, waist/hip ratio, and sc abdominal fat by MRI (data not shown). In contrast, visceral fat mass was not associated significantly with any indices of cortisol metabolism. In men with higher liver fat content, there was a selective increase in excretion of 5ß-reduced cortisol metabolites but no difference in 11HSD1 activities in liver or adipose (Fig. 1
) or in adipose 11HSD1 mRNA.
|
-THF + 5ß-THF)/5ß-THE] (Fig. 2
/5ß-reductase activity (5
-THF/5ß-THF) (r = -0.62, P < 0.01). Similarly, the A-ring reduction quotients (31) reflecting 5ß-reductase activity (5ß-THF/cortisol and 5ß-THE/cortisone) were strongly positively associated with liver fat content (r = 0.53, P < 0.01 and r = 0.58, P < 0.01, respectively), but the quotient reflecting 5
-reductase activity was not correlated with liver fat (r = -0.04).
|
|
Pearson correlation analyses were performed to detect relationships between indices of cortisol metabolism and metabolic variables, including fasting plasma glucose, insulin, total cholesterol, high-density lipoprotein cholesterol, triglycerides, glycosylated hemoglobin, blood pressure, and measurements during the hyperinsulinemic euglycemic clamp (i.e. basal endogenous glucose production rate, insulin-stimulated glucose uptake, and insulin-mediated suppression of free fatty acids). Significant associations were then tested for confounding by body composition (as percentage body fat, the strongest predictor of cortisol metabolism in Table 2
) in multiple regression analyses.
The following associations were independent of obesity. Higher conversion of oral cortisone to plasma cortisol was associated with higher total fasting plasma cholesterol (adjusted ß-coefficient = 0.53, P < 0.01). Higher urinary excretion of 5ß-THF and 5ß-THE were associated with higher fasting plasma insulin (ß = 0.48 and 0.53, respectively, P < 0.05) and impaired free fatty acid suppression by insulin (-0.56 and -0.61, respectively, P < 0.03). Higher urinary 5ß-THF excretion was associated with higher fasting serum triglyceride levels (ß = 0.56, P < 0.03); this was the only relationship with 5ß-reduced metabolite excretion that was also independent of liver fat content (ß = 0.59, P < 0.02).
| Discussion |
|---|
|
|
|---|
The long-standing hypothesis that glucocorticoids contribute to fat accumulation in obesity has been rejuvenated by recent findings concerning the influence of local metabolism of cortisol. Enthusiasm has been fueled by experiments in mice showing the potency of 11HSD1 in modulating obesity and associated features of the metabolic syndrome (23, 34, 35). In humans, it has been hypothesized that there is a syndrome in which increased intraadipose generation of cortisol by 11HSD1 in visceral fat leads to central obesity and the metabolic syndrome, in what has been described as Cushings disease of the omentum (22). However, this hypothesis has yet to be proven in humans. Although studies in primary culture suggest that 11HSD1 is more active in visceral than sc adipocytes (22), this may not hold in freshly isolated tissue (19), and there is, as yet, no direct evidence that visceral 11HSD1 is increased in obesity (36). Rather, it is studies of sc adipose tissue that have shown increased 11HSD1 activity and mRNA in obese subjects (17, 18, 19, 20). These studies suggest similar associations between increased adipose 11HSD1 activity and either generalized (BMI or total percentage body fat) or central (waist/hip ratio or waist circumference) obesity, as is recapitulated here. However, waist circumference and waist/hip ratio provide imprecise indices of visceral fat accumulation. Indeed, in the current data, waist/hip ratio was more closely related to abdominal sc fat than visceral fat (Table 1
). One previous small study used computed tomography scans of the abdomen to quantify visceral fat but was not definitive, because it reported only a lack of association between visceral/sc fat ratio with the urinary cortisol/cortisone metabolite ratio in patients receiving cortisol replacement therapy (37); as is illustrated here, this urinary ratio is an inadequate indicator of 11HSD1 activity. Thus, whether variations in sc adipose 11HSD1 are associated with variations in visceral fat accumulation has not been examined previously. The current results show that it is total body fat, not visceral fat mass, that is associated with increased sc adipose 11HSD1 activity. Increased adipose 11HSD1 activity in human obesity may be invoked as a cause of "Cushings disease of the adipose" but not yet of "Cushings disease of the omentum."
The previous observations that conversion of oral cortisone to plasma cortisol on first-pass metabolism in the liver is impaired in obesity (16, 17, 18) led to the suggestion that down-regulation of 11HSD1 is an important protective mechanism. In knockout mice, 11HSD1 deficiency results in enhanced expression of enzymes involved in lipid catabolism and reduced expression of gluconeogenic enzymes (34, 35). In transgenic mice with overexpression of 11HSD1 in adipose or liver, there are preliminary reports of increased liver fat accumulation (25). In man, pharmacological inhibition of 11HSD1 enhances hepatic insulin sensitivity (38, 39). We did not find associations of in vivo cortisone-to-cortisol conversion with liver fat content, or glucose production rate in the basal state or during hyperinsulinemia. There was a positive association between cortisone-to-cortisol conversion and fasting plasma total cholesterol levels, which is intriguing, but we did not find associations with high-density lipoprotein cholesterol or free fatty acid levels predicted from the animal studies. The importance of down-regulation of hepatic 11HSD1 in human obesity therefore remains uncertain.
The widespread use of the urine cortisol/cortisone metabolite ratio as the gold standard index of 11HSD1 activity has arguably raised more questions than it has answered in understanding altered cortisol metabolism in obesity. In different study cohorts, the cortisol/cortisone metabolite ratio has been reported to be increased (11, 18, 37), decreased (16, 17), or unchanged (12, 13) with increasing obesity. This ratio, based on the most abundant A-ring reduced metabolites of cortisol and cortisone in urine, is determined not only by 11HSD1 activity but also by 11HSD2 conversion of cortisol to cortisone (e.g. in kidney) and by variations in A-ring reductase activities. We had previously suggested that the balance between down-regulation of 11HSD1 in liver and up-regulation in adipose in obesity might have an unpredictable effect on cortisol/cortisone metabolite ratio, and that a more potent effect of greater fat mass in women might account for gender differences (18). Here, we offer a different explanation that suggests that even greater caution is required in the interpretation of the conventional cortisol/cortisone metabolite ratio. We show, for the first time, a striking relationship between lower cortisol/cortisone metabolite ratios and liver fat accumulation. This occurs in the absence of any relationship between liver fat and 11HSD1 measured in vivo in liver by conversion of oral cortisone to plasma cortisol, or in vitro in sc adipose biopsies. It is possible that 11HSD1 activity is altered in some tissue, other than the sc adipose and liver studied here, because the contribution of each organ to whole-body turnover between cortisone and cortisol has yet to be established. However, a more plausible explanation for the change in cortisol/cortisone metabolite ratio with increasing liver fat is that it is explained by altered intrahepatic cortisol metabolism, and specifically by the dramatic increase in excretion of 5ß-reduced glucocorticoids, including 5ß-THE. This finding may explain the inconsistency of urinary cortisol/cortisone ratios and body composition in previous studies that did not take account of liver fat accumulation. To what extent it confounds interpretation of altered 11HSD1 activities in type 2 diabetes (40), polycystic ovarian syndrome (41), and GH deficiency and excess (42, 43, 44, 45) remains to be seen.
It is intriguing that liver fat accumulation is associated with increased metabolism of glucocorticoids by 5ß-reductase, which is, in turn, associated with hyperinsulinemia and impaired suppression of free fatty acids by insulin. Causality in these associations is unclear. A previous study of patients with alcoholic and nonalcoholic liver disease without fatty liver showed that liver dysfunction per se is associated with decreased excretion of THE and a higher cortisol/cortisone metabolite ratio (46), so the changes observed here seem specific to fatty liver. Published information about regulation of 5ß-reductase expression is sketchy. The current observations suggest that its dysregulation in obesity is dissociated from the changes in 5
-reductase activity but do not suggest a clear mechanism. 5ß-Reductase is also involved in cholesterol and bile acid metabolism (47, 48, 49), so that disrupted intrahepatic lipid metabolism might be a cause or consequence of dysregulation of 5ß-reductase. The association between excretion of 5ß-reduced cortisol metabolites and impaired suppression of free fatty acids by insulin is difficult to reconcile with exclusively intrahepatic interactions between 5ß-reductase and lipid metabolism, although the contribution of the liver to free fatty acid uptake in patients with fatty liver has not been quantified and may be important. Increased fatty acids may provide a regulatory signal altering 5ß-reductase expression, analogous to their likely effects through nuclear receptors on 11HSD1 (50, 51), but this remains speculative. Systemic consequences of increased 5ß-reductase may include the effects of increased peripheral metabolism of cortisol, with resultant lowering of plasma cortisol, which may contribute to compensatory activation of the hypothalamic-pituitary-adrenal axis, as has been proposed for the effect of increased 5
-reductase in obesity (11). However, we did not find a strong association between increased liver fat accumulation and total cortisol metabolite excretion. Further dissection of mechanisms of dysregulation of both 5ß- and 5
-reductases in animal models is clearly warranted.
Given the emerging complexity of the associations between body composition and cortisol metabolism, caution is required in synthesizing results from different studies. Because of the detailed imaging and biopsy investigations, the current study includes relatively small numbers of participants (n = 25). No detailed studies in this field have included more than 40 subjects. There are some inconsistencies between studies. The conversion of oral cortisone to cortisol was more strikingly reduced with increasing obesity in previous studies (16, 17, 18) than was seen here. Although adipose 11HSD1 activity and mRNA were closely correlated here, the associations between 11HSD1 mRNA and body composition and insulin sensitivity were weaker in the current data than in other published reports (19, 20). In particular, adipose 11HSD1 was closely associated with variations in insulin sensitivity in other cohorts. There are also reports of an inverse relationship between body fat and adipose 11HSD1 activity, although the enzyme was assessed in cultured adipose cells, which may have changed their phenotype during culture (36). Nevertheless, despite these discrepancies, a pattern has emerged that suggests that altered peripheral cortisol metabolism is a key component of changes in body composition. The challenge now is to dissect the mechanisms and consequences of these changes to validate new therapeutic approaches.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: BMI, Body mass index; CBG, corticosteroid-binding globulin; HSD, hydroxysteroid dehydrogenase; 11HSD1, 11ß-HSD type 1; MRI, magnetic resonance imaging; THE, tetrahydrocortisone; THF, tetrahydrocortisol.
Received April 7, 2003.
Accepted June 16, 2003.
| References |
|---|
|
|
|---|
43-ketosteroid 5ß-reductase. Biochim Biophys Acta 912:110114[CrossRef][Medline]
43-oxosteroid 5ß-reductase and substrate specificity of the expressed enzyme. Eur J Biochem 219:357363[Medline]
agonists reduce 11ß-hydroxysteroid dehydrogenase type 1 in the liver. Biochem Biophys Res Commun 279:330336[CrossRef][Medline]
This article has been cited by other articles:
![]() |
D. P Macfarlane, S. Forbes, and B. R Walker Glucocorticoids and fatty acid metabolism in humans: fuelling fat redistribution in the metabolic syndrome J. Endocrinol., May 1, 2008; 197(2): 189 - 204. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R Walker Glucocorticoids and Cardiovascular Disease Eur. J. Endocrinol., November 1, 2007; 157(5): 545 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Wudy, M. F. Hartmann, and T. Remer Sexual dimorphism in cortisol secretion starts after age 10 in healthy children: urinary cortisol metabolite excretion rates during growth Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E970 - E976. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wiegand, A. Richardt, T. Remer, S. A Wudy, J. W Tomlinson, B. Hughes, A. Gruters, P. M Stewart, C. J Strasburger, and M. Quinkler Reduced 11{beta}-hydroxysteroid dehydrogenase type 1 activity in obese boys Eur. J. Endocrinol., September 1, 2007; 157(3): 319 - 324. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Ahima, Y. Qi, N. S. Singhal, M. B. Jackson, and P. E. Scherer Brain Adipocytokine Action and Metabolic Regulation Diabetes, December 1, 2006; 55(Supplement_2): S145 - S154. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Densmore, N. M. Morton, J. J. Mullins, and J. R. Seckl 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Induction in the Arcuate Nucleus by High-Fat Feeding: A Novel Constraint to Hyperphagia? Endocrinology, September 1, 2006; 147(9): 4486 - 4495. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A Sigurjonsdottir, J. Koranyi, M. Axelson, B.-A. Bengtsson, and G. Johannsson GH effect on enzyme activity of 11{beta}HSD in abdominal obesity is dependent on treatment duration Eur. J. Endocrinol., January 1, 2006; 154(1): 69 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hermanowski-Vosatka, J. M. Balkovec, K. Cheng, H. Y. Chen, M. Hernandez, G. C. Koo, C. B. Le Grand, Z. Li, J. M. Metzger, S. S. Mundt, et al. 11{beta}-HSD1 inhibition ameliorates metabolic syndrome and prevents progression of atherosclerosis in mice J. Exp. Med., August 15, 2005; 202(4): 517 - 527. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Basu, R. J. Singh, A. Basu, E. G. Chittilapilly, M. C. Johnson, G. Toffolo, C. Cobelli, and R. A. Rizza Obesity and Type 2 Diabetes Do Not Alter Splanchnic Cortisol Production in Humans J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 3919 - 3926. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. H. Pietilainen, A. Rissanen, J. Kaprio, S. Makimattila, A.-M. Hakkinen, J. Westerbacka, J. Sutinen, S. Vehkavaara, and H. Yki-Jarvinen Acquired obesity is associated with increased liver fat, intra-abdominal fat, and insulin resistance in young adult monozygotic twins Am J Physiol Endocrinol Metab, April 1, 2005; 288(4): E768 - E774. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Sandeep, R. Andrew, N. Z.M. Homer, R. C. Andrews, K. Smith, and B. R. Walker Increased In Vivo Regeneration of Cortisol in Adipose Tissue in Human Obesity and Effects of the 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Inhibitor Carbenoxolone Diabetes, March 1, 2005; 54(3): 872 - 879. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Drake, D. E. W. Livingstone, R. Andrew, J. R. Seckl, N. M. Morton, and B. R. Walker Reduced Adipose Glucocorticoid Reactivation and Increased Hepatic Glucocorticoid Clearance as an Early Adaptation to High-Fat Feeding in Wistar Rats Endocrinology, February 1, 2005; 146(2): 913 - 919. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Lyssenko, P. Almgren, D. Anevski, R. Perfekt, K. Lahti, M. Nissen, B. Isomaa, B. Forsen, N. Homstrom, C. Saloranta, et al. Predictors of and Longitudinal Changes in Insulin Sensitivity and Secretion Preceding Onset of Type 2 Diabetes Diabetes, January 1, 2005; 54(1): 166 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kok, S. W. Kok, M. M. Buijs, J. J. M. Westenberg, F. Roelfsema, M. Frolich, M. P. M. Stokkel, A. E. Meinders, and H. Pijl Enhanced circadian ACTH release in obese premenopausal women: reversal by short-term acipimox treatment Am J Physiol Endocrinol Metab, November 1, 2004; 287(5): E848 - E856. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kannisto, K. H. Pietilainen, E. Ehrenborg, A. Rissanen, J. Kaprio, A. Hamsten, and H. Yki-Jarvinen Overexpression of 11{beta}-Hydroxysteroid Dehydrogenase-1 in Adipose Tissue Is Associated with Acquired Obesity and Features of Insulin Resistance: Studies in Young Adult Monozygotic Twins J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4414 - 4421. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Valsamakis, A. Anwar, J. W. Tomlinson, C. H. L. Shackleton, P. G. McTernan, R. Chetty, P. J. Wood, A. K. Banerjee, G. Holder, A. H. Barnett, et al. 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Activity in Lean and Obese Males with Type 2 Diabetes Mellitus J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4755 - 4761. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Morton, L. Ramage, and J. R. Seckl Down-Regul |