help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Westerbacka, J.
Right arrow Articles by Walker, B. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Westerbacka, J.
Right arrow Articles by Walker, B. R.
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 10 4924-4931
Copyright © 2003 by The Endocrine Society

Body Fat Distribution and Cortisol Metabolism in Healthy Men: Enhanced 5ß-Reductase and Lower Cortisol/Cortisone Metabolite Ratios in Men with Fatty Liver

Jukka Westerbacka, Hannele Yki-Järvinen, Satu Vehkavaara, Anna-Maija Häkkinen, Ruth Andrew, Deborah J. Wake, Jonathan R. Seckl and Brian R. Walker

Department of Medicine, Division of Diabetes (J.W., H.Y.-J., S.V.), and Department of Oncology (A.-M.H.), University of Helsinki, 00029 Helsinki, Finland; and Endocrinology Unit (R.A., D.J.W., J.R.S., B.R.W.), University of Edinburgh, Western General Hospital, Edinburgh EH4 2XU, United Kingdom

Address all correspondence and requests for reprints to: Prof. Brian R. Walker, University of Edinburgh, Endocrinology Unit, Western General Hospital, Edinburgh EH4 2XU, United Kingdom. E-mail: b.walker{at}ed.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
In Cushing’s syndrome, cortisol causes fat accumulation in specific sites most likely to be associated with insulin resistance, notably in omental adipose and also perhaps in the liver. In idiopathic obesity, cortisol-metabolizing enzymes may play a key role in determining body fat distribution. Increased regeneration of cortisol from cortisone within adipose by 11ß-hydroxysteroid dehydrogenase (HSD) type 1 (11HSD1) has been proposed to cause visceral fat accumulation, whereas decreased hepatic 11HSD1 may protect the liver from glucocorticoid excess. Increased inactivation of cortisol by 5{alpha}- and 5ß-reductases in the liver may drive compensatory activation of the hypothalamic-pituitary-adrenal axis, hence increasing adrenal androgens and ‘android’ central obesity. This study aimed to examine relationships between these enzymes and detailed measurements of body fat distribution.

Twenty-five healthy men (age, 22–57 yr; body mass index, 20.6–35.6 kg/m2) were recruited from occupational health services. Body composition was assessed by anthropometric measurements, bioimpedance, and cross-sectional abdominal magnetic resonance imaging scans. Liver fat content was assessed by magnetic resonance imaging spectroscopy. Insulin sensitivity was measured in a euglycemic hyperinsulinemic clamp. Cortisol metabolites were measured in a 24-h urine sample by gas chromatography-mass spectrometry. In vivo hepatic 11HSD1 activity was measured by generation of plasma cortisol after an oral dose of cortisone. In vitro 11HSD1 activity and mRNA were measured in 18 subjects who consented to provide abdominal sc adipose biopsies.

Indices of obesity (body mass index, whole-body percentage fat, waist/hip ratio) were associated with higher urinary excretion of 5{alpha}- and 5ß-reduced cortisol metabolites (for percentage fat, P < 0.05 and P < 0.01, respectively) and increased adipose 11HSD1 activity (P < 0.05). Liver fat accumulation was associated with a selective increase in urinary excretion of 5ß-reduced cortisol and cortisone metabolites (P < 0.01) and a lower ratio of cortisol/cortisone metabolites in urine (P < 0.001) but no difference in in vivo cortisone-to-cortisol conversion or in vitro adipose 11HSD1. Higher excretion of 5ß-reduced cortisol metabolites was independently associated with insulin resistance and hypertriglyceridemia. Lower conversion of cortisone to cortisol was associated with lower fasting plasma cortisol (P < 0.01). However, visceral adipose fat mass was not associated with indices of cortisol metabolism; indeed, after adjusting for the effects of whole-body and liver fat, increased visceral fat was associated with lower cortisol metabolite excretion.

We conclude that alterations in 11HSD1 and hepatic 5{alpha}-reductase activity are associated with generalized, rather than central, obesity in humans. Activation of 5ß-reductase in men with fat accumulation in the liver may confound the interpretation of cortisol metabolite excretion when liver fat content is unknown, and may contribute to altered bile acid and cholesterol metabolism in nonalcoholic steatohepatitis.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
ACCUMULATION OF TRIGLYCERIDE stores in selected adipose and extraadipose sites is recognized increasingly as a determinant of insulin sensitivity and its attendant cardiovascular risk. Metabolically adverse sites for fat accumulation include visceral fat, skeletal muscle, and liver (1, 2, 3). In Cushing’s syndrome, increased circulating levels of the major endogenous glucocorticoid cortisol are responsible for accumulation of fat in selected adipose tissue depots, especially in the face, nape of the neck, and visceral compartments (4). Anecdotal reports also suggest that glucocorticoid excess drives triglyceride accumulation within the liver (5, 6, 7). In idiopathic obesity, there is evidence of increased cortisol production rate, but this is not associated with consistent elevation of plasma cortisol levels and seems to occur only in compensation for increased peripheral metabolic clearance of cortisol (8, 9).

Recent studies have explored the enzymes that are dysregulated in obesity. The principle routes of clearance of cortisol in the liver are catalyzed by 5{alpha}- and 5ß-reductase enzymes. Activity and mRNA for these enzymes is increased in the liver of obese rodents (10); and in humans, anthropometric indices of obesity [including increased body mass index (BMI), waist circumference, and waist/hip ratio] are associated with increased excretion of 5{alpha}- and 5ß-reduced metabolites of cortisol (11, 12, 13). Increased inactivation of cortisol by these A-ring reductases may explain lower plasma cortisol in obesity (14, 15). Compensatory activation of the hypothalamic-pituitary-adrenal axis may drive increased adrenal androgen secretion and thus amplify a central (or android body fat distribution) (1). However, studies to date have not been able to distinguish whether increased excretion of 5{alpha}- and/or 5ß-reduced cortisol metabolites is specifically associated with central obesity.

In addition, regeneration of cortisol from the inactive steroid precursor cortisone by the enzyme 11ß-hydroxysteroid dehydrogenase (HSD) type 1 (11HSD1) is altered in idiopathic obesity. This dysregulation is tissue-specific: obesity is associated with decreased 11HSD1 activity in liver but increased 11HSD1 activity in adipose tissue of both rodents and humans (10, 16, 17, 18, 19, 20). Because both glucocorticoid receptor and 11HSD1 expression and activity are higher in visceral adipocytes than in sc adipocytes (21, 22), at least in primary culture, it has been proposed that increased 11HSD1 will be most important within visceral adipose tissue, where it may be responsible for "Cushing’s disease of the omentum" (22).

The potency of 11HSD1 in determining body fat distribution and its associated metabolic complications is illustrated by experiments in mice. Transgenic mice with selective overexpression of 11HSD1 in white adipose tissue under the AP2 promoter/enhancer develop central obesity (23), whereas homozygous 11HSD1 knockout mice show lower weight gain and preferential distribution of fat to sc (rather than visceral) adipose stores during high-fat feeding (24). AP2–11HSD1 overexpressors (23) also exhibit triglyceride accumulation in the liver, putatively because of increased delivery of both free fatty acids and corticosterone in the portal vein. Preliminary data in ApoE-11HSD1 transgenic lines suggest that liver-specific overexpression of 11HSD1 also results in excess fat accumulation in the liver (25). Against this background, it is hypothesized that high adipose 11HSD1 activity will be associated with preferential accumulation of fat in visceral adipose tissue. Furthermore, we hypothesize that decreased hepatic 11HSD1 activity may protect against liver fat accumulation by lowering intrahepatic cortisol concentrations.

To address in detail the relationships between cortisol metabolism and body fat distribution, we have undertaken a study of cortisol metabolism in a group of healthy men in whom body fat distribution and associated metabolic parameters have been carefully characterized, and include assessment of liver fat content by magnetic resonance imaging (MRI) spectroscopy and visceral fat mass by cross-sectional MRI.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects

Men were recruited from occupational health services in Helsinki. The subjects did not use any drugs and were healthy as judged by history and physical examination, negative serology (for hepatitis A, B, or C or of autoimmune hepatitis), and the absence of clinical features of inborn errors of metabolism or a history of use of toxins or drugs associated with steatosis, except for moderate alcohol consumption (<20 g/d). Alcohol consumption was assessed by detailed history and laboratory markers (serum {gamma}-glutamyltranspeptidase, the aspartate aminotransferase/alanine aminotransferase ratio, and mean corpuscular volume). Written informed consent was obtained. The experimental protocol was approved by the ethical committee of the Helsinki University Hospital.

Body composition

Height, weight, waist and hip circumferences, and whole-body composition by bioimpedance plethysmography (Bio-Electrical Impedance Analysis System, Model no. BIA-101A; RJL Systems, St. Louis, MO) were measured after overnight fasting as previously described (26). In addition, body fat distribution was measured in the liver by MRI proton spectroscopy using methylene signal intensity and in the abdomen by cross-sectional MRI using data from 16 10-mm slices (26).

In vivo insulin sensitivity of glucose production and disposal

At 0800 h, after an overnight fast, blood pressure was recorded, basal blood samples were obtained for the measurements in Table 1Go, and subjects underwent a euglycemic hyperinsulinemic clamp as previously described (3). Glucose production and disposal were measured by infusion of [3-3H]glucose in a primed (20 µCi) continuous (0.2 µCi/min) fashion for a total of 360 min (27). After 120 min, insulin was infused in a primed-continuous (0.3 mU/kg·min) fashion. Plasma glucose was maintained at 5 mM (90 mg/dl) until 360 min, using a variable rate infusion of 20% glucose. Glucose kinetics and percentage suppression of free fatty acids from baseline were calculated during the final 60 min of the clamp. Serum free insulin concentrations were measured using RIA (Pharmacia Insulin RIA kit; Pharmacia, Uppsala, Sweden) after precipitation with polyethylene glycol. Plasma glucose concentrations were measured in duplicate with the glucose oxidase method using Beckman Glucose Analyzer II (Beckman Instruments, Fullerton, CA). Serum free fatty acids were measured using a fluorometric method. Serum lipids were measured as previously described (26).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Subject characteristics according to body composition

 
In vivo cortisol secretion and metabolism

On another day, subjects completed a 24-h urine collection. Excretion of cortisol and its metabolites [5ß-tetrahydrocortisol (THF), 5{alpha}-THF, 5ß-tetrahydrocortisone (THE), cortols, cortolones, and cortisone] was measured by electron impact gas chromatography-mass spectrometry as previously described (28). Total cortisol excretion was calculated from the sum of 5ß-THF, 5{alpha}-THF, THE, cortols, and cortolones (29). The balance between 11HSD activities in all tissues was assessed as the ratio of (5ß-THF + 5{alpha}-THF)/THE. Renal 11ß-HSD type 2 activity was assessed as urinary cortisol/cortisone ratio (28, 30). The balance of 5{alpha}- and 5ß-reductases was assessed by the ratio 5ß-THF/5{alpha}-THF (11). Relative 5{alpha}- and 5ß-reduction of cortisol was also assessed by Ulick’s A-ring reduction quotients, 5{alpha}-THF/cortisol, 5ß-THF/cortisol, and 5ß-THE/cortisone (31).

On another day, conversion of cortisone to cortisol by 11HSD1 on first pass through the liver was measured after the subjects took 1 mg oral dexamethasone at 2300 h to suppress endogenous cortisol production and fasted overnight (16, 17, 32). The next morning, a catheter was inserted into an antecubital vein for blood sampling, and the subjects ingested 25 mg cortisone acetate. Plasma cortisol was then measured every 15 min for 90 min using a direct RIA (ICN Pharmaceuticals, Basingstoke, UK). Corticosteroid-binding globulin (CBG) was measured by RIA on the first sample (Medgenix Diagnostics, Fleurus, Belgium).

Intraadipose cortisol metabolism

A randomly selected subgroup of subjects who consented to providing a biopsy reattended between 0800 and 1200 h on another day, when a sc adipose biopsy of approximately 500 mg was obtained under local anesthesia through a 2- to 3-cm incision from the paraumbilical anterior abdominal wall. Subcutaneous fat was frozen immediately in two aliquots in liquid nitrogen.

Adipose 11HSD1 activity was measured in one aliquot of the biopsies as previously described (17, 18, 20) by homogenizing in Krebs buffer at pH 7.4 and incubating 750 µg protein/ml at 37 C with nicotinamide adenine dinucleotide phosphate (2 mM) and 1,2,6,7-3H4-cortisol (100 nM) for 30 h. Samples were withdrawn at 3, 6, 20, and 30 h for separation of cortisol and cortisone by HPLC with on-line liquid scintillation detection. Enzyme activity was measured in the dehydrogenase (cortisol to cortisone) direction in vitro, rather than the reductase (cortisone to cortisol) reaction preferred in vivo, because dehydrogenase activity is more stable once the enzyme is liberated from its intracellular environment (33), and, under these conditions, the dehydrogenase activity has a linear relationship with protein content added to the assay.

A second aliquot of the biopsy was analyzed for 11HSD1 mRNA as previously described (20). Approximately 500 mg fat was homogenized in 1.5 ml Trizol (Gibco PRL, Paisley, UK), and RNA was purified using RNAid RNA binding matrix (Anachem, Luton, UK), washed three times, and dissociated by addition of diethylpyrocarbonate H20/dithiothreitol/RNAsin. RNA was quantified using spectrophotometric analysis at OD260. RNA integrity was checked by agarose gel electrophoresis. Oligo dT-primed cDNA was synthesized from 0.5-µg RNA samples using Promega Reverse Transcription System (Promega, Southampton, UK). Transcript level quantification for 11HSD1 was performed with Real Time PCR primer-probe sets using the ABI PRISM 7700 Sequence Detection System with the following primers and probes: 5'GGAATATTCAGTGTCCAGGGTCAA3' (forward), 5'TGATCTCCAGGGCACATTCCT3' (reverse), and 5'-6-FAM-CTTGGCCTCATAGACACAGAAACAGCCA-TAMRA-3' (probe). Human cyclophyllin (Applied Biosystems, Cheshire, UK) primers/probes were included in a multiplex reaction with the probes/primers for the gene of interest to normalize the transcript levels. A standard curve for each primer probe set was generated in triplicate by serial dilution of cDNA pooled from several subjects. Each sample was run in duplicate, and the mean values of the duplicates were used to calculate transcript level. Reverse transcriptase negative controls and intron spanning primers were used to examine for genomic DNA and prevent amplification.

Statistical analyses

Areas under curves for conversion of cortisone to cortisol in vivo and for 11HSD1 activity in adipose in vitro were calculated using the trapezoidal rule. Variables were log-transformed if necessary to obtain a normal distribution, as indicated in the tables. Pearson correlation analyses were performed to identify associations. Confounding between associations was addressed using forward stepwise multiple linear regression analysis with variables entering the final model if F was more than 1.0. All data are shown as mean ± SE of mean. A P value < 0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subject characteristics

Participating men were 22–57 yr old, with a wide range of BMI (20.6–35.6 kg/m2), waist/hip ratio (0.85–1.1), whole-body fat (11.2–31.0%), visceral fat (1423–7025 cm3), sc abdominal fat (1302–4650 cm3), and liver fat (1–41%). Characteristics of men who provided a biopsy (n = 18) were not different from those who did not (n = 7) (data not shown). Associations between body composition variables are shown in Table 1Go. For illustration, data are shown for subjects above or below the median for each measurement of body composition; however, statistical comparisons were by Pearson correlations. Body composition did not change significantly with increasing age, but subjects with generalized or visceral obesity tended to be older. Increased whole-body fat was associated with higher BMI and liver fat content. Increased visceral fat was associated with higher BMI. However, waist/hip ratio correlated more strongly with MRI measurements of sc abdominal fat mass (r = 0.39, P = 0.05) than with visceral fat mass (r = 0.20, P = 0.35).

Indices of cortisol metabolism

There were no associations between urinary excretion of cortisol metabolites, conversion of oral cortisone to cortisol in vivo, or adipose 11HSD1 activity. However, adipose 11HSD1 mRNA and activity were closely correlated (r = 0.77, P < 0.001). Plasma CBG levels were not correlated with any body composition or metabolic variables, so that total plasma cortisol values were used in the analyses of hepatic 11HSD1 activity in vivo.

Associations of cortisol metabolism and body composition

Results of Pearson correlations are in Table 1Go. Increasing whole-body fat was associated with increased excretion of all of the major metabolites of cortisol and with evidence consistent with previously described tissue-specific alterations in 11HSD1 activity (i.e. increased 11HSD1 activity in adipose tissue with nonsignificant trends for increased adipose 11HSD1 mRNA and reduced hepatic conversion of oral cortisone to cortisol in vivo). Similar associations of glucocorticoid parameters were observed with waist circumference, waist/hip ratio, and sc abdominal fat by MRI (data not shown). In contrast, visceral fat mass was not associated significantly with any indices of cortisol metabolism. In men with higher liver fat content, there was a selective increase in excretion of 5ß-reduced cortisol metabolites but no difference in 11HSD1 activities in liver or adipose (Fig. 1Go) or in adipose 11HSD1 mRNA.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 1. Lack of influence of liver fat content on liver and adipose 11HSD1 activity. A, Liver 11HSD1 activity measured by conversion of an oral dose of cortisone to plasma cortisol after overnight dexamethasone suppression. B, Adipose 11HSD1 activity measured in homogenates of sc abdominal adipose biopsies. For illustration, subjects are divided according to the median liver fat content in this cohort of 10%. Data are mean ± SEM.

 
These differences in absolute excretion rates of individual cortisol metabolites resulted in altered urinary ratios that are conventionally used to assess enzyme activities. The most consistent relationships were with liver fat content, which was inversely associated with the ratio of cortisol/cortisone metabolites [i.e. (5{alpha}-THF + 5ß-THF)/5ß-THE] (Fig. 2Go) and with relative 5{alpha}/5ß-reductase activity (5{alpha}-THF/5ß-THF) (r = -0.62, P < 0.01). Similarly, the A-ring reduction quotients (31) reflecting 5ß-reductase activity (5ß-THF/cortisol and 5ß-THE/cortisone) were strongly positively associated with liver fat content (r = 0.53, P < 0.01 and r = 0.58, P < 0.01, respectively), but the quotient reflecting 5{alpha}-reductase activity was not correlated with liver fat (r = -0.04).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 2. Association of body composition with urinary cortisol/cortisone metabolite ratio. A, Total body fat vs. urine cortisol/cortisone metabolite ratio. Pearson correlation coefficient = -0.24, P = 0.24. B, Liver fat vs. cortisol/cortisone metabolite ratio. Liver fat was log-transformed to obtain a normal distribution. Pearson correlation coefficient = -0.78, P < 0.001.

 
For the variables for which associations were identified in Pearson correlation analyses in Table 1Go, we explored the relative influence of fat accumulation in different sites. We performed stepwise multiple regression analyses of indices of cortisol metabolism with percentage body fat, visceral fat, sc abdominal fat, and liver fat as independent variables. Results are shown in Table 2Go. Whole-body percentage fat was consistently the best predictor of indices of cortisol metabolism, including increased cortisol metabolite excretion, and increased adipose 11HSD1 activity. Liver fat accumulation was independently associated with increased 5ß-THE excretion, very strongly inversely associated with the cortisol/cortisone metabolite ratio, and significantly associated with decreased adipose 11HSD1. When corrected for the effect of total body fat and liver fat, visceral fat mass was inversely associated with urinary cortisol metabolite excretion and adipose 11HSD1 activity.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Multiple regression models predicting cortisol metabolism according to body composition

 
Associations of cortisol metabolism and metabolic complications of fat accumulation

Pearson correlation analyses were performed to detect relationships between indices of cortisol metabolism and metabolic variables, including fasting plasma glucose, insulin, total cholesterol, high-density lipoprotein cholesterol, triglycerides, glycosylated hemoglobin, blood pressure, and measurements during the hyperinsulinemic euglycemic clamp (i.e. basal endogenous glucose production rate, insulin-stimulated glucose uptake, and insulin-mediated suppression of free fatty acids). Significant associations were then tested for confounding by body composition (as percentage body fat, the strongest predictor of cortisol metabolism in Table 2Go) in multiple regression analyses.

The following associations were independent of obesity. Higher conversion of oral cortisone to plasma cortisol was associated with higher total fasting plasma cholesterol (adjusted ß-coefficient = 0.53, P < 0.01). Higher urinary excretion of 5ß-THF and 5ß-THE were associated with higher fasting plasma insulin (ß = 0.48 and 0.53, respectively, P < 0.05) and impaired free fatty acid suppression by insulin (-0.56 and -0.61, respectively, P < 0.03). Higher urinary 5ß-THF excretion was associated with higher fasting serum triglyceride levels (ß = 0.56, P < 0.03); this was the only relationship with 5ß-reduced metabolite excretion that was also independent of liver fat content (ß = 0.59, P < 0.02).


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
These data show that different distributions of fat accumulation are associated with specific changes in cortisol metabolism in otherwise healthy men. Increased abdominal sc adipose 11HSD1 (which predicts increased cortisol regeneration from cortisone within fat) and increased total cortisol metabolite excretion were associated with a higher proportion of whole-body fat but not with preferential fat accumulation in either visceral, sc abdominal, or hepatic depots. Hepatic regeneration of cortisol from cortisone was not related to body fat distribution, although increased activity was associated with higher plasma cholesterol levels. Increased 5ß-reduction of cortisol was specifically associated with fat accumulation in the liver, rather than in adipose depots, and was independently associated with evidence of insulin resistance. Liver fat content was a major determinant of the ratio of cortisol/cortisone metabolites in urine, and this could best be explained by changes in 5ß-reductase activity rather than 11HSD activities.

The long-standing hypothesis that glucocorticoids contribute to fat accumulation in obesity has been rejuvenated by recent findings concerning the influence of local metabolism of cortisol. Enthusiasm has been fueled by experiments in mice showing the potency of 11HSD1 in modulating obesity and associated features of the metabolic syndrome (23, 34, 35). In humans, it has been hypothesized that there is a syndrome in which increased intraadipose generation of cortisol by 11HSD1 in visceral fat leads to central obesity and the metabolic syndrome, in what has been described as Cushing’s disease of the omentum (22). However, this hypothesis has yet to be proven in humans. Although studies in primary culture suggest that 11HSD1 is more active in visceral than sc adipocytes (22), this may not hold in freshly isolated tissue (19), and there is, as yet, no direct evidence that visceral 11HSD1 is increased in obesity (36). Rather, it is studies of sc adipose tissue that have shown increased 11HSD1 activity and mRNA in obese subjects (17, 18, 19, 20). These studies suggest similar associations between increased adipose 11HSD1 activity and either generalized (BMI or total percentage body fat) or central (waist/hip ratio or waist circumference) obesity, as is recapitulated here. However, waist circumference and waist/hip ratio provide imprecise indices of visceral fat accumulation. Indeed, in the current data, waist/hip ratio was more closely related to abdominal sc fat than visceral fat (Table 1Go). One previous small study used computed tomography scans of the abdomen to quantify visceral fat but was not definitive, because it reported only a lack of association between visceral/sc fat ratio with the urinary cortisol/cortisone metabolite ratio in patients receiving cortisol replacement therapy (37); as is illustrated here, this urinary ratio is an inadequate indicator of 11HSD1 activity. Thus, whether variations in sc adipose 11HSD1 are associated with variations in visceral fat accumulation has not been examined previously. The current results show that it is total body fat, not visceral fat mass, that is associated with increased sc adipose 11HSD1 activity. Increased adipose 11HSD1 activity in human obesity may be invoked as a cause of "Cushing’s disease of the adipose" but not yet of "Cushing’s disease of the omentum."

The previous observations that conversion of oral cortisone to plasma cortisol on first-pass metabolism in the liver is impaired in obesity (16, 17, 18) led to the suggestion that down-regulation of 11HSD1 is an important protective mechanism. In knockout mice, 11HSD1 deficiency results in enhanced expression of enzymes involved in lipid catabolism and reduced expression of gluconeogenic enzymes (34, 35). In transgenic mice with overexpression of 11HSD1 in adipose or liver, there are preliminary reports of increased liver fat accumulation (25). In man, pharmacological inhibition of 11HSD1 enhances hepatic insulin sensitivity (38, 39). We did not find associations of in vivo cortisone-to-cortisol conversion with liver fat content, or glucose production rate in the basal state or during hyperinsulinemia. There was a positive association between cortisone-to-cortisol conversion and fasting plasma total cholesterol levels, which is intriguing, but we did not find associations with high-density lipoprotein cholesterol or free fatty acid levels predicted from the animal studies. The importance of down-regulation of hepatic 11HSD1 in human obesity therefore remains uncertain.

The widespread use of the urine cortisol/cortisone metabolite ratio as the gold standard index of 11HSD1 activity has arguably raised more questions than it has answered in understanding altered cortisol metabolism in obesity. In different study cohorts, the cortisol/cortisone metabolite ratio has been reported to be increased (11, 18, 37), decreased (16, 17), or unchanged (12, 13) with increasing obesity. This ratio, based on the most abundant A-ring reduced metabolites of cortisol and cortisone in urine, is determined not only by 11HSD1 activity but also by 11HSD2 conversion of cortisol to cortisone (e.g. in kidney) and by variations in A-ring reductase activities. We had previously suggested that the balance between down-regulation of 11HSD1 in liver and up-regulation in adipose in obesity might have an unpredictable effect on cortisol/cortisone metabolite ratio, and that a more potent effect of greater fat mass in women might account for gender differences (18). Here, we offer a different explanation that suggests that even greater caution is required in the interpretation of the conventional cortisol/cortisone metabolite ratio. We show, for the first time, a striking relationship between lower cortisol/cortisone metabolite ratios and liver fat accumulation. This occurs in the absence of any relationship between liver fat and 11HSD1 measured in vivo in liver by conversion of oral cortisone to plasma cortisol, or in vitro in sc adipose biopsies. It is possible that 11HSD1 activity is altered in some tissue, other than the sc adipose and liver studied here, because the contribution of each organ to whole-body turnover between cortisone and cortisol has yet to be established. However, a more plausible explanation for the change in cortisol/cortisone metabolite ratio with increasing liver fat is that it is explained by altered intrahepatic cortisol metabolism, and specifically by the dramatic increase in excretion of 5ß-reduced glucocorticoids, including 5ß-THE. This finding may explain the inconsistency of urinary cortisol/cortisone ratios and body composition in previous studies that did not take account of liver fat accumulation. To what extent it confounds interpretation of altered 11HSD1 activities in type 2 diabetes (40), polycystic ovarian syndrome (41), and GH deficiency and excess (42, 43, 44, 45) remains to be seen.

It is intriguing that liver fat accumulation is associated with increased metabolism of glucocorticoids by 5ß-reductase, which is, in turn, associated with hyperinsulinemia and impaired suppression of free fatty acids by insulin. Causality in these associations is unclear. A previous study of patients with alcoholic and nonalcoholic liver disease without fatty liver showed that liver dysfunction per se is associated with decreased excretion of THE and a higher cortisol/cortisone metabolite ratio (46), so the changes observed here seem specific to fatty liver. Published information about regulation of 5ß-reductase expression is sketchy. The current observations suggest that its dysregulation in obesity is dissociated from the changes in 5{alpha}-reductase activity but do not suggest a clear mechanism. 5ß-Reductase is also involved in cholesterol and bile acid metabolism (47, 48, 49), so that disrupted intrahepatic lipid metabolism might be a cause or consequence of dysregulation of 5ß-reductase. The association between excretion of 5ß-reduced cortisol metabolites and impaired suppression of free fatty acids by insulin is difficult to reconcile with exclusively intrahepatic interactions between 5ß-reductase and lipid metabolism, although the contribution of the liver to free fatty acid uptake in patients with fatty liver has not been quantified and may be important. Increased fatty acids may provide a regulatory signal altering 5ß-reductase expression, analogous to their likely effects through nuclear receptors on 11HSD1 (50, 51), but this remains speculative. Systemic consequences of increased 5ß-reductase may include the effects of increased peripheral metabolism of cortisol, with resultant lowering of plasma cortisol, which may contribute to compensatory activation of the hypothalamic-pituitary-adrenal axis, as has been proposed for the effect of increased 5{alpha}-reductase in obesity (11). However, we did not find a strong association between increased liver fat accumulation and total cortisol metabolite excretion. Further dissection of mechanisms of dysregulation of both 5ß- and 5{alpha}-reductases in animal models is clearly warranted.

Given the emerging complexity of the associations between body composition and cortisol metabolism, caution is required in synthesizing results from different studies. Because of the detailed imaging and biopsy investigations, the current study includes relatively small numbers of participants (n = 25). No detailed studies in this field have included more than 40 subjects. There are some inconsistencies between studies. The conversion of oral cortisone to cortisol was more strikingly reduced with increasing obesity in previous studies (16, 17, 18) than was seen here. Although adipose 11HSD1 activity and mRNA were closely correlated here, the associations between 11HSD1 mRNA and body composition and insulin sensitivity were weaker in the current data than in other published reports (19, 20). In particular, adipose 11HSD1 was closely associated with variations in insulin sensitivity in other cohorts. There are also reports of an inverse relationship between body fat and adipose 11HSD1 activity, although the enzyme was assessed in cultured adipose cells, which may have changed their phenotype during culture (36). Nevertheless, despite these discrepancies, a pattern has emerged that suggests that altered peripheral cortisol metabolism is a key component of changes in body composition. The challenge now is to dissect the mechanisms and consequences of these changes to validate new therapeutic approaches.


    Acknowledgments
 
We are grateful to Jill Campbell and Alison Ayres for technical support.


    Footnotes
 
This work was supported by grants from the Academy of Finland (to J.W., H.Y.-J., and S.V.), Sigrid Juselius Foundation (to H.Y.-J.), Finnish Diabetes Research Society (to H.Y.-J., J.W., and S.V.) the Novo Nordisk Foundation (to H.Y.-J.), Finnish Foundation for Cardiovascular Research (to S.V.), the Wellcome Trust (to J.R.S. and B.R.W.), and the British Heart Foundation (to B.R.W.).

Abbreviations: BMI, Body mass index; CBG, corticosteroid-binding globulin; HSD, hydroxysteroid dehydrogenase; 11HSD1, 11ß-HSD type 1; MRI, magnetic resonance imaging; THE, tetrahydrocortisone; THF, tetrahydrocortisol.

Received April 7, 2003.

Accepted June 16, 2003.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Bjorntorp P 1991 Visceral fat accumulation: the missing link between psychosocial factors and cardiovascular disease? J Intern Med 230:195–201[Medline]
  2. Virkamaki A, Korsheninnikova E, Seppala-Lindroos A, Vehkavaara S, Goto T, Halavaara. J, Hakkinen AM, Yki-Jarvinen H 2001 Intramyocellular lipid is associated with resistance to in vivo insulin actions on glucose uptake, antilipolysis, and early insulin signaling pathways in human skeletal muscle. Diabetes 50:2337–2343[Abstract/Free Full Text]
  3. Seppala-Lindroos A, Vehkavaara S, Hakkinen AM, Goto T, Westerbacka J, Sovijarvi A, Halavaara. J, Yki-Jarvinen H 2002 Fat accumulation in the liver is associated with defects in insulin suppression of glucose production and serum free fatty acids independent of obesity in normal men. J Clin Endocrinol Metab 87:3023–3028[Abstract/Free Full Text]
  4. Ross EJ, Linch DC 1982 Cushing’s syndrome—killing disease: discriminatory value of signs and symptoms aiding early diagnosis. Lancet 2:646–649[CrossRef][Medline]
  5. Itoh S, Igarashi M, Tsukada Y, Ichinoe A 1997 Non-alcoholic fatty liver with alcoholic hyalin after long-term glucocorticoid therapy. Acta Hepatogastroenterol (Stuttg) 24:415–418
  6. Dourakis SP, Sevastianos VA, Kaliopi P 2002 Acute severe steatohepatitis related to prednisolone therapy. Am J Gastroenterol 97:1074–1075[CrossRef][Medline]
  7. Nanki T, Koike R, Miyasaka N 1999 Subacute severe steatohepatitis during prednisolone therapy for systemic lupus erythematosis. Am J Gastroenterol 94:3379
  8. Strain GW, Zumoff B, Strain JJ 1980 Cortisol production in obesity. Metabolism 29:980–985[CrossRef][Medline]
  9. Lottenberg SA, Giannella-Neto D, Derendorf H, Rocha M, Bosco A, Carvalho SV, Moretti AE, Lerario AC, Wajchenberg BL 1998 Effect of fat distribution on the pharmacokinetics of cortisol in obesity. Int J Clin Pharmacol Ther 36:501–505[Medline]
  10. Livingstone DEW, Jones GC, Smith K, Andrew R, Kenyon CJ, Walker BR 2000 Understanding the role of glucocorticoids in obesity: tissue-specific alterations of corticosterone metabolism in obese Zucker rats. Endocrinology 141:560–563[Abstract/Free Full Text]
  11. Andrew R, Phillips DIW, Walker BR 1998 Obesity and gender influence cortisol secretion and metabolism in man. J Clin Endocrinol Metab 83:1806–1809[Abstract/Free Full Text]
  12. Fraser R, Ingram MC, Anderson NH, Morrison C, Davies E, Connell JMC 1999 Cortisol effects on body mass, blood pressure, and cholesterol in the general population. Hypertension 33:1364–1368[Abstract/Free Full Text]
  13. Reynolds RM, Walker BR, Phillips DIW, Sydall HE, Andrew R, Wood PJ, Whorwood CB 2001 Altered control of cortisol secretion in adult men with low birthweight and cardiovascular risk factors. J Clin Endocrinol Metab 86:245–250[Abstract/Free Full Text]
  14. Ljung T, Andersson B, Bengtsson B, Bjorntorp P, Marin P 1996 Inhibition of cortisol secretion by dexamethasone in relation to body fat distribution: a dose-response study. Obese Res 4:277–282
  15. Walker BR, Soderberg S, Lindahl B, Olsson T 2000 Independent effects of obesity and cortisol in predicting cardiovascular risk factors in men and women. J Intern Med 247:198–204[CrossRef][Medline]
  16. Stewart PM, Boulton A, Kumar S, Clark PMS, Shackleton CHL 1999 Cortisol metabolism in human obesity: impaired cortisone—cortisol conversion in subjects with central adiposity. J Clin Endocrinol Metab 84:1022–1027[Abstract/Free Full Text]
  17. Rask E, Olsson T, Soderberg S, Andrew R, Livingstone DEW, Johnson O, Walker BR 2001 Tissue-specific dysregulation of cortisol metabolism in human obesity. J Clin Endocrinol Metab 86:1418–1421[Abstract/Free Full Text]
  18. Rask E, Walker BR, Soderberg S, Livingstone DEW, Eliasson M, Johnson O, Andrew R, Olsson T 2002 Tissue-specific changes in peripheral cortisol metabolism in obese women; increased adipose 11ß-hydroxysteroid dehydrogenase type 1 activity. J Clin Endocrinol Metab 87:3330–3336[Abstract/Free Full Text]
  19. Paulmyer-Lacroix O, Boullu S, Oliver C, Alessi M-C, Grino M 2002 Expression of the mRNA coding for 11ß-hydroxysteroid dehydrogenase type 1 in adipose tissue from obese patients: an in situ hybridization study. J Clin Endocrinol Metab 87:2701–2705[Abstract/Free Full Text]
  20. Lindsay RS, Tataranni A, Permana P, Livingstone DEW, Wake DJ, Walker BR2003 Subcutaneous adipose 11ß-hydroxysteroid dehydrogenase type 1 activity and mRNA levels are associated with adiposity and insulinemia in Pima Indians and Caucasians. J Clin Endocrinol Metab 88:2738–2744
  21. Bronnegard M, Arner P, Hellstrom L 1990 Glucocorticoid receptor messenger ribonucleic acid in different regions of human adipose tissue. Endocrinology 127:1689–1696[Abstract]
  22. Bujalska IJ, Kumar S, Stewart PM 1997 Does central obesity reflect ’Cushing’s disease of the omentum’? Lancet 349:1210–1213[CrossRef][Medline]
  23. Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR, Flier JS 2001 A transgenic model of visceral obesity and the metabolic syndrome. Science 294:2166–2170[Abstract/Free Full Text]
  24. Morton NM, Paterson JM, Holmes MC, Walker BR, Mullins JJ, Seckl JR 11ß-Hydroxysteroid dehydrogenase type 1 null mice resist dietary obesity and its metabolic complications. Program of the 84th Annual Meeting of The Endocrine Society, San Francisco, CA, 2002, p 87 (Abstract OR17–3)
  25. Paterson JM, Holmes MC, Morton NM, Seckl JR, Mullins JJ Liver-specific over-expression of 11ß-HSD1 in transgenic mice produces insulin resistance, hyperlipidaemia and fatty liver. Program of the 84th Annual Meeting of The Endocrine Society, San Francisco, CA, 2002, p 395 (Abstract P2–319)
  26. Tiikkainen M, Tamminen M, Hakkinen A-M, Bergholm R, Vehkavaara S, Halavaara J, Teramo K, Rissanen A, Yki-Jarvinen H 2002 Liver-fat accumulation and insulin resistance in obese women with previous gestational diabetes. Obes Res 10:859–867[Medline]
  27. Ryysy L, Hakkinen AM, Goto T, Vehkavaara S, Westerbacka J, Halavaara. J, Yki-Jarvinen H 2000 Hepatic fat content and insulin action on free fatty acids and glucose metabolism rather than insulin absorption are associated with insulin requirements during insulin therapy in type 2 diabetic patients. Diabetes 49:749–758[Abstract]
  28. Best R, Walker BR 1997 Additional value of measurement of urinary cortisone and unconjugated cortisol metabolites in assessing the activity of 11ß-hydroxysteroid dehydrogenase in vivo. Clin Endocrinol (Oxf) 47:231–236[CrossRef][Medline]
  29. Zumoff B, Fukushima DK, Hellman L 1974 Intercomparison of four methods for measuring cortisol production. J Clin Endocrinol Metab 38:169–175[Medline]
  30. Palermo M, Shackleton CHL, Mantero F, Stewart PM 1996 Urinary free cortisone and the assessment of 11ß-hydroxysteroid dehydrogenase activity in man. Clin Endocrinol (Oxf) 45:605–611[CrossRef][Medline]
  31. Ulick S, Tedde R, Wang JZ 1992 Defective ring A reduction of cortisol as the major metabolic error in the syndrome of apparent mineralocorticoid excess. J Clin Endocrinol Metab 74:593–599[Abstract]
  32. Stewart PM, Wallace AM, Atherden SM, Shearing CH, Edwards CRW 1990 Mineralocorticoid activity of carbenoxolone: contrasting effects of carbenoxolone and liquorice on 11ß-hydroxysteroid dehydrogenase activity in man. Clin Sci 78:49–54[Medline]
  33. Agarwal AK, Monder C, Eckstein B, White PC 1989 Cloning and expression of rat cDNA encoding corticosteroid 11ß-dehydrogenase. J Biol Chem 264:18939–18943[Abstract/Free Full Text]
  34. Kotelevtsev YV, Holmes MC, Burchell A, Houston PM, Scholl D, Jamieson PM, Best R, Brown RW, Edwards CRW, Seckl JR, Mullins JJ 1997 11ß-Hydroxysteroid dehydrogenase type 1 knockout mice show attenuated glucocorticoid inducible responses and resist hyperglycaemia on obesity and stress. Proc Natl Acad Sci USA 94:14924–14929[Abstract/Free Full Text]
  35. Morton NM, Holmes MC, Fievet C, Staels B, Tailleux A, Mullins JJ, Seckl JR 2001 Improved lipid and lipoprotein profile, hepatic insulin sensitivity, and glucose tolerance in 11ß-hydroxysteroid dehydrogenase type 1 null mice. J Biol Chem 276:41293–41300[Abstract/Free Full Text]
  36. Tomlinson JW, Sinha B, Bujalska I, Hewison M, Stewart PM 2002 Expression of 11ß-hydroxysteroid dehydrogenase type 1 in adipose tissue is not increased in human obesity. J Clin Endocrinol Metab 87:5630–5635[Abstract/Free Full Text]
  37. Tiosano D, Eisentein I, Militianu D, Chrousos GP, Hochberg Z 2003 11ß-Hydroxysteroid dehydrogenase activity in hypothalamic obesity. J Clin Endocrinol Metab 88:379–384[Abstract/Free Full Text]
  38. Walker BR, Connacher AA, Lindsay RM, Webb DJ, Edwards CRW 1995 Carbenoxolone increases hepatic insulin sensitivity in man: a novel role for 11-oxosteroid reductase in enhancing glucocorticoid receptor activation. J Clin Endocrinol Metab 80:3155–3159[Abstract]
  39. Andrews RC, Rooyackers O, Walker BR 2003 Effects of the 11ß-hydroxysteroid dehydrogenase inhibitor carbenoxolone on insulin sensitivity in men with type 2 diabetes. J Clin Endocrinol Metab 88:285–291[Abstract/Free Full Text]
  40. Andrews RC, Herlihy O, Livingstone DEW, Andrew R, Walker BR 2002 Abnormal cortisol metabolism and tissue sensitivity to cortisol in patients with glucose intolerance. J Clin Endocrinol Metab 87:5587–5593[Abstract/Free Full Text]
  41. Rodin A, Thakkar H, Taylor N, Clayton R 1994 Hyperandrogenism in polycystic ovary syndrome: evidence of dysregulation of 11ß-hydroxysteroid dehydrogenase. N Engl J Med 330:460–465[Abstract/Free Full Text]
  42. Weaver JU, Thaventhiran L, Noonan K, Burrin JM, Taylor NF, Norman MR, Monson JP 1994 The effect of growth hormone replacement on cortisol metabolism and glucocorticoid sensitivity in hypopituitary adults. Clin Endocrinol (Oxf) 41:639–648[Medline]
  43. Weaver JU, Taylor NF, Monson JP, Wood PJ, Kelly WF 1998 Sexual dimorphism in 11 ß hydroxysteroid dehydrogenase activity and its relation to fat distribution and insulin sensitivity; a study in hypopituitary subjects. Clin Endocrinol (Oxf) 49:13–20[CrossRef][Medline]
  44. Moore JS, Monson JP, Kaltsas G, Putignano P, Wood PJ, Sheppard MC, Besser GM, Taylor NF, Stewart PM 1999 Modulation of 11ß-hydroxysteroid dehydrogenase isozymes by growth hormone and insulin-like growth factor: in vivo and in vitro studies. J Clin Endocrinol Metab 84:4172–4177[Abstract/Free Full Text]
  45. Trainer PJ, Drake WM, Perry LA, Taylor NF, Besser GM, Monson JP 2001 Modulation of cortisol metabolism by the growth hormone receptor antagonist pegvisomant in patients with acromegaly. J Clin Endocrinol Metab 86:2989–2992[Abstract/Free Full Text]
  46. Stewart PM, Burra P, Shackleton CHL, Sheppard MC, Elias E 1993 11ß-Hydroxysteroid dehydrogenase deficiency and glucocorticoid status in patients with alcoholic and non-alcoholic liver disease. J Clin Endocrinol Metab 76:748–751[Abstract]
  47. Furuebisu M, Deguchi S, Okuda K 1987 Identification of cortisone 5ß-reductase as {Delta}4–3-ketosteroid 5ß-reductase. Biochim Biophys Acta 912:110–114[CrossRef][Medline]
  48. Kondo K-H, Kai M-H, Setoguchi Y, Eggertsen G, Sjoblom P, Setoguchi T, Okuda K-I, Bjorkhem I 1994 Cloning and expression of cDNA of human {Delta}4–3-oxosteroid 5ß-reductase and substrate specificity of the expressed enzyme. Eur J Biochem 219:357–363[Medline]
  49. Charbonneau A, The V-L 2001 Genomic organization of a human 5ß-reductase and its pseudogene and substrate selectivity of the expressed enzyme. Biochim Biophys Acta 1517:228–235[Medline]
  50. Hermanowski-Vosatka A, Gerhold D, Mundt SS, Loving VA, Lu M, Chen Y, Elbrecht A, Wu M, Doebber T, Kelly L, Milot D, Guo Q, Wang P-R, Ippolito M, Chao Y-S, Wright SD 2000 PPAR{alpha} agonists reduce 11ß-hydroxysteroid dehydrogenase type 1 in the liver. Biochem Biophys Res Commun 279:330–336[CrossRef][Medline]
  51. Stulnig TM, Oppermann U, Steffensen KR, Schuster GU, Gustafsson J-A 2002 Liver X receptors down-regulate 11ß-hydroxysteroid dehydrogenase type 1 expression and activity. Diabetes 51:2426–2433[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J EndocrinolHome page
D. P Macfarlane, S. Forbes, and B. R Walker
Glucocorticoids and fatty acid metabolism in humans: fuelling fat redistribution in the metabolic syndrome
J. Endocrinol., May 1, 2008; 197(2): 189 - 204.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
B. R Walker
Glucocorticoids and Cardiovascular Disease
Eur. J. Endocrinol., November 1, 2007; 157(5): 545 - 559.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. A. Wudy, M. F. Hartmann, and T. Remer
Sexual dimorphism in cortisol secretion starts after age 10 in healthy children: urinary cortisol metabolite excretion rates during growth
Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E970 - E976.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
S. Wiegand, A. Richardt, T. Remer, S. A Wudy, J. W Tomlinson, B. Hughes, A. Gruters, P. M Stewart, C. J Strasburger, and M. Quinkler
Reduced 11{beta}-hydroxysteroid dehydrogenase type 1 activity in obese boys
Eur. J. Endocrinol., September 1, 2007; 157(3): 319 - 324.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
R. S. Ahima, Y. Qi, N. S. Singhal, M. B. Jackson, and P. E. Scherer
Brain Adipocytokine Action and Metabolic Regulation
Diabetes, December 1, 2006; 55(Supplement_2): S145 - S154.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. S. Densmore, N. M. Morton, J. J. Mullins, and J. R. Seckl
11{beta}-Hydroxysteroid Dehydrogenase Type 1 Induction in the Arcuate Nucleus by High-Fat Feeding: A Novel Constraint to Hyperphagia?
Endocrinology, September 1, 2006; 147(9): 4486 - 4495.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
H. A Sigurjonsdottir, J. Koranyi, M. Axelson, B.-A. Bengtsson, and G. Johannsson
GH effect on enzyme activity of 11{beta}HSD in abdominal obesity is dependent on treatment duration
Eur. J. Endocrinol., January 1, 2006; 154(1): 69 - 74.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
A. Hermanowski-Vosatka, J. M. Balkovec, K. Cheng, H. Y. Chen, M. Hernandez, G. C. Koo, C. B. Le Grand, Z. Li, J. M. Metzger, S. S. Mundt, et al.
11{beta}-HSD1 inhibition ameliorates metabolic syndrome and prevents progression of atherosclerosis in mice
J. Exp. Med., August 15, 2005; 202(4): 517 - 527.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Basu, R. J. Singh, A. Basu, E. G. Chittilapilly, M. C. Johnson, G. Toffolo, C. Cobelli, and R. A. Rizza
Obesity and Type 2 Diabetes Do Not Alter Splanchnic Cortisol Production in Humans
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 3919 - 3926.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. H. Pietilainen, A. Rissanen, J. Kaprio, S. Makimattila, A.-M. Hakkinen, J. Westerbacka, J. Sutinen, S. Vehkavaara, and H. Yki-Jarvinen
Acquired obesity is associated with increased liver fat, intra-abdominal fat, and insulin resistance in young adult monozygotic twins
Am J Physiol Endocrinol Metab, April 1, 2005; 288(4): E768 - E774.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. C. Sandeep, R. Andrew, N. Z.M. Homer, R. C. Andrews, K. Smith, and B. R. Walker
Increased In Vivo Regeneration of Cortisol in Adipose Tissue in Human Obesity and Effects of the 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Inhibitor Carbenoxolone
Diabetes, March 1, 2005; 54(3): 872 - 879.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. J. Drake, D. E. W. Livingstone, R. Andrew, J. R. Seckl, N. M. Morton, and B. R. Walker
Reduced Adipose Glucocorticoid Reactivation and Increased Hepatic Glucocorticoid Clearance as an Early Adaptation to High-Fat Feeding in Wistar Rats
Endocrinology, February 1, 2005; 146(2): 913 - 919.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
V. Lyssenko, P. Almgren, D. Anevski, R. Perfekt, K. Lahti, M. Nissen, B. Isomaa, B. Forsen, N. Homstrom, C. Saloranta, et al.
Predictors of and Longitudinal Changes in Insulin Sensitivity and Secretion Preceding Onset of Type 2 Diabetes
Diabetes, January 1, 2005; 54(1): 166 - 174.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
P. Kok, S. W. Kok, M. M. Buijs, J. J. M. Westenberg, F. Roelfsema, M. Frolich, M. P. M. Stokkel, A. E. Meinders, and H. Pijl
Enhanced circadian ACTH release in obese premenopausal women: reversal by short-term acipimox treatment
Am J Physiol Endocrinol Metab, November 1, 2004; 287(5): E848 - E856.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Kannisto, K. H. Pietilainen, E. Ehrenborg, A. Rissanen, J. Kaprio, A. Hamsten, and H. Yki-Jarvinen
Overexpression of 11{beta}-Hydroxysteroid Dehydrogenase-1 in Adipose Tissue Is Associated with Acquired Obesity and Features of Insulin Resistance: Studies in Young Adult Monozygotic Twins
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4414 - 4421.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Valsamakis, A. Anwar, J. W. Tomlinson, C. H. L. Shackleton, P. G. McTernan, R. Chetty, P. J. Wood, A. K. Banerjee, G. Holder, A. H. Barnett, et al.
11{beta}-Hydroxysteroid Dehydrogenase Type 1 Activity in Lean and Obese Males with Type 2 Diabetes Mellitus
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4755 - 4761.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. M. Morton, L. Ramage, and J. R. Seckl
Down-Regul