help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Starkey, K.
Right arrow Articles by Ludgate, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Starkey, K.
Right arrow Articles by Ludgate, M.
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 1 55-59
Copyright © 2003 by The Endocrine Society


Original Article

Peroxisome Proliferator-Activated Receptor-{gamma} in Thyroid Eye Disease: Contraindication for Thiazolidinedione Use?

Kerry Starkey, Armin Heufelder, Glynn Baker, Werner Joba, Marc Evans, Stephen Davies and Marian Ludgate

Departments of Medicine (K.S., G.B., M.E., D.D., M.L.) and Ophthalmology (G.B.), University of Wales College of Medicine, Heath Park, Cardiff CF14 4XN, United Kingdom; and Endocrinology and Molecular Medicine (A.H., W.J.), Clinical Research Centre, D80336 Munich, Germany

Address all correspondence and requests for reprints to: Marian Ludgate, Ph.D., Department of Medicine, Endocrinology, Metabolism & Diabetes Section, University of Wales College of Medicine, Heath Park, Cardiff CF14 4XN, United Kingdom. E-mail: ludgate{at}cf.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
A male type-2 diabetic, treated with the peroxisome proliferator-activated receptor (PPAR) agonist, Pioglitazone, experienced exacerbation of his thyroid eye disease (TED), which had been stable and inactive for more then 2 yr. Expansion of the orbital fat developed, and we have investigated the effects of PPAR{gamma} agonists, including Pioglitazone and, subsequently, an antagonist on the adipogenesis of preadipocytes from TED orbits and Graves’ neck fats.

The percentage of differentiating cells, assessed by oil red O staining, morphological changes, and PPAR{gamma} transcript levels, was determined for preadipocytes in hormone/agonist-induced models of adipogenesis, supplemented or not with PPAR{gamma} agonists or antagonist. The PPAR{gamma} agonists resulted in a 2- to 13-fold increase, and a PPAR{gamma} antagonist produced a 2- to 7-fold reduction in adipogenesis in vitro. Effects were dose dependent and maximal at 1 or 10 µM.

We suggest that care should be exercised when selecting patients for treatment with PPAR{gamma} agonists and that such agonists may be contraindicated in individuals with a previous history of autoimmune thyroid or eye diseases. Our work also suggests that PPAR{gamma} antagonists could provide a novel therapy for TED patients in the active stage of disease.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
MOST PATIENTS WITH Graves’ disease (GD) have self-resolving orbitopathy, but about 5% develop thyroid eye disease (TED) requiring intervention (1). Both GD and TED are autoimmune conditions, and GD is the result of thyroid-stimulating antibodies that mimic the action of TSH and cause hyperthyroidism and diffuse goiter (2). There is considerable evidence suggesting that the target of thyroid-stimulating antibodies, the TSH receptor (TSHR), may also play a role in TED. TSHR transcripts and functional protein have been demonstrated in orbital tissues, notably the fat (3, 4, 5), and a murine model of TED can be induced with TSHR-primed T cells or genetic immunization (6, 7). The TSHR has also been implicated in a second extrathyroidal manifestation of GD, pretibial dermopathy (PD) (8, 9).

The signs and symptoms of TED can be explained by the increase in volume of the orbital contents by edema, production of hydrophilic glycosaminoglycans, and accumulation of adipose tissue (10). Considerable progress has been made in understanding the molecular regulation of preadipocyte differentiation into a mature adipocyte (adipogenesis) after hormonal induction by insulin, for example. There are species- and depot-specific differences in adipogenesis, but a generalized pattern is emerging (11). It can be triggered by activation of peroxisome proliferator-activated receptor (PPAR){gamma}, a member of the nuclear receptor family of transcription factors (11, 12). The development of PPAR{gamma} agonists, such as the thiazolidinediones (TZDs), has confirmed this proadipogenic effect in vitro (13).

The TZDs activate the PPAR{gamma} and target the key etiological processes of type 2 diabetes, resulting in enhanced glucose and free fatty acid metabolism and improved insulin sensitivity. The mechanisms involved include increased insulin and glucose receptor expression and, possibly, attenuated production of inflammatory cytokines, such as TNF{alpha} (14, 15). The increased adipogenesis results in weight gain, although this may be site specific. In contrast, a limited number of PPAR{gamma} antagonists have been described and have been shown to inhibit both PPAR{gamma} agonist- (16) and hormone-induced differentiation of rodent preadipocyte cell lines (17).

We describe a male patient with previous GD and TED (both stabilized) and type 2 diabetes. After treatment with Pioglitazone, he experienced rapid exacerbation of TED. We have investigated the effects of PPAR{gamma} agonists and antagonists on human orbital preadipocytes.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Case report

A 57-yr-old male nonsmoker, with thyrotoxicosis, goiter, and raised TSHR antibodies, was diagnosed with GD in 1997. Euthyroidism was restored with radioiodine. He had a body mass index of 30.7 and an 8-yr history of type 2 diabetes and hypertension treated with metformin and enalapril. In 1998, he developed severe TED, with a Mouritz clinical activity score (CAS) of 7, and PD. Oral prednisolone was commenced at 60 mg and followed a tapering regime that terminated in June 1998, reduced his CAS to 3, and improved his PD. Thyroid, glycemic, and hypertensive control continued without complication on L-thyroxine, metformin, enalapril, and hydrochlorothiazide. Despite being euthyroid, his TSHR antibodies remained elevated, but TED and PD were stable when he underwent routine ophthalmic review, in November 2000, which recorded an asymptomatic ophthalmopathy with a CAS of 1. In January 2001, his glycemic control deteriorated and he was commenced on Pioglitazone, 30 mg daily. Within 3 months of commencing Pioglitazone, he developed recurrence of his TED symptoms (Fig. lAGo and Table 1Go), and his CAS had risen to 6. He remained euthyroid throughout this period, with a serum TSH concentration of 0.4 mU/liter. An orbital Tl-weighted magnetic resonance imaging shows the high signal of supraorbital fat prolapsing anterior to the orbital rim (Fig. lBGo). In parallel, PD also increased. The Pioglitazone was stopped; and 3 months later, the CAS reduced to 2.



View larger version (103K):
[in this window]
[in a new window]
 
Figure 1. A, Patient, after 3 months treatment with Pioglitazone, showing chemosis, conjunctival injection, superior periorbital swelling, with loss of upper lid sulci. B, T1 weighted magnetic resonance imaging slice through upper orbits, demonstrating fat volume expansion and prolapse anterior to the orbital rim (superior recti are also enlarged and contribute to proptosis).

 

View this table:
[in this window]
[in a new window]
 
Table 1. Ophthalmic examination of the patient, 6 wk before and after 3 months on Pioglitazone (Pioglit) therapy and after 3 months withdrawal of the drug

 
Patients studied

Adipose tissues were collected, with informed consent and the approval of the local ethics committee, from one normal orbit and six TED patients undergoing decompression and from two GD patients undergoing thyroidectomy.

Preadipocyte isolation and culture

Preadipocytes were obtained by collagenase digest and centrifugation, as previously described (5), and seeded on coverslips in medium (DMEM/Ham’s Fl 2, 1:1) containing 10% fetal calf serum. In some experiments, they were transferred to a hormone-induced differentiation protocol (5) with no further addition, or were supplemented with l0 µM PPAR{gamma} agonist GW7845 or l0 µM PPAR{gamma} antagonist GW9662, both kindly provided by Dr. Tim Wilson (GlaxoSmithKline, Research Triangle Park, NC; Ref.18).

Alternatively, preadipocytes were transferred to DMEM/Ham’s, 3% fetal calf serum containing 100 mM cortisol, 100 mM insulin, and (for 3 d) l µM Pioglitazone (kindly provided by Takeda Chemical Industries Co., Ltd., Osaka, Japan), 0.25 mM IBMX, with no further addition; or were supplemented with l0 µM GW9662.

Assessment of adipogenesis

Seven to 14 d after the initiation of differentiation, adipogenesis was evaluated in 300–600 cells, for each sample, and culture condition by direct counting of cells showing morphological evidence of differentiation and/or Oil red O staining. Counting was performed in a blinded fashion. At least 2 coverslips were assessed, and the results (which agree to within 10%) were expressed as a percentage.

Quantitation of PPAR{gamma} transcripts

Total RNA was extracted and reverse transcribed into cDNA using 0.1 U Moloney murine leukemia virus reverse transcriptase and 40 pmol oligo dT in a total vol of 20 µl, using standard protocols. A maximum of 1 µg RNA was used or all of the RNA extracted in samples too small for accurate quantification. Real-time PCR was performed on 1 µl of the cDNA (a maximum of 50 ng), using SYBR green to monitor PCR kinetics in a Light Cycler (Roche Diagnostic Corporation, Indianapolis, IN), to quantitate transcripts of the housekeeping gene adenine phosphoribosyltransferase (APRT) and PPAR{gamma}. PCR conditions were: 2.5 mM Mg2+, 55 C annealing with forward primer in exon 3 (gctgcgtgctcatccgaaag) and reverse primer in exon 5 (ccttaagcgaggtcagctcc); for APRT and 3 mM Mg2+, 55 C annealing with forward primer in exon 3 (cagtggggatgtctcataa) and reverse primer in exon 5 (cttttggcatactctgtgat) for PPAR{gamma}. These primers detect PPAR{gamma} 1 and 2 (12). Results are expressed as transcript copy numbers obtained from the crossing points on standard curves established using cloned cDNA for both genes, based on duplicate measurements agreeing to within 20%; each experiment was performed at least twice.

Statistics

Statistical comparisons were made using a Wilcoxon matched-pairs signed-ranks test (19). A P value > 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Hormone-induced differentiation

In preadipocytes evaluated in the standard hormone-induced protocol, signs of differentiation were detectable from d 10 and were induced in 1–25% of the cells.

PPAR{gamma} agonists increase adipogenesis

In preadipocytes cultured in differentiation medium supplemented with l0 µM GW7845, adipogenic changes were observed in 8–64% of the cells, a 2- to 8-fold increase in hormone-induced differentiation.

In samples treated with l µM Pioglitazone alone, adipogenesis was induced in 7–8% of the cells. Signs of differentiation were observed after only 3 d in culture, contrasting with the slower hormone-induced protocol.

In all samples tested, the presence of a PPAR{gamma} agonist resulted in a significant increase in differentiation, compared with the standard hormone-induced protocol (P > 0.05).

PPAR{gamma} antagonist GW9662 inhibits hormone- and agonist-induced adipogenesis

In preadipocytes cultured in differentiation medium supplemented with 10 µM GW9662, adipogenic changes were observed in 0.5–8% of the cells. The antagonist reduced hormone-induced differentiation by 3- to 6-fold. In samples treated with l µM Pioglitazone and 10 µM GW9662, the antagonist reduced Pioglitazone-induced differentiation by 4- to 10-fold.

In all samples tested, the presence of the PPAR{gamma} antagonist resulted in a significant decrease in differentiation, compared with either the standard hormone- or Pioglitazone-induced protocols (P > 0.05).

All of the PPAR{gamma} agonist/antagonist effects were dose dependent, with Pioglitazone being optimal at 1 µM, whereas GW7845 and GW9662 were both optimal at 10 µM (data not shown). Results (quoting the optimum concentrations) are summarized in Fig. 2Go.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Percentage of cells differentiating (A) in the standard hormone protocol plus PPAR{gamma} agonist GW7845 (white columns) or antagonist GW9662 (black columns), compared with the standard hormone-induced protocol alone (100%, broken line), and (B) in the presence of Pioglitazone (hatched columns) or Pioglitazone plus antagonist GW9662 (gray columns) in samples of fat from TED orbits (T), cervical fat from patients with thyroid disease (C), and normal orbital fat (NO).

 
PPAR{gamma} transcripts are detectable in mature adipocytes and during adipogenesis but not in preadipocytes

Two samples of TED orbital fat (T5 and T6) were used to extract RNA from the preadipocyte and adipocyte populations without any period in culture. The preadipocytes expressed undetectable levels of PPAR{gamma}, despite adequate APRT transcript copy numbers of 4.4 x 102 and 2.5 x 104 per 50 ng input cDNA. The corresponding mature adipocytes both expressed PPAR{gamma}, as shown in Table 2Go.


View this table:
[in this window]
[in a new window]
 
Table 2. Representative quantitative real-time PCR measurements

 
TED orbital fat (T2) preadipocytes were analyzed after hormone-induced differentiation. In the standard protocol, approximately 1 PPAR{gamma} transcript was detected per 200 APRT, which is less than the levels measured in the mature adipocytes. A similar level was observed when the protocol was supplemented with the antagonist, but there was a 6-fold increase to 1 PPAR{gamma} transcript per 30 APRT, in the presence of agonist. Results of a typical experiment are shown in Table 2Go.


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The reactivation of TED, in the case reported, developed rapidly after treatment of his type 2 diabetes with Pioglitazone. Most exacerbations of TED occur along with destabilization of euthyroidism, which did not occur in this patient, who remained euthyroid throughout. The timing of TED exacerbation, and subsequent restabilization after drug withdrawal, suggests that the PPAR{gamma} agonist is likely to have played a role in the pathogenesis. Edema is a common side effect of TZD therapy (20), which may have contributed to the patient’s TED. That the patient’s eyes have not returned to their previous state, 6 months after Pioglitazone therapy ceased, argues for mechanisms other than edema exacerbating his proptosis.

Previous in vitro experiments have reported increased adipogenesis in response to TZDs in human sc but not omental preadipocytes; TED orbits were not examined (13). Studies published while this work was under review demonstrated increased adipogenesis in TED preadipocytes cultured with rosiglitazone (21, 22), and one of them (21) raised the possibility of the exacerbation of TED in diabetics treated with TZDs. We provide clear evidence for a marked and rapid increase in differentiation in TED preadipocytes cultured with Pioglitazone, which acts on several PPARs, and show that the effect is mediated by PPAR{gamma} by using an agonist, GW7845, specific for this receptor subtype.

We have assessed adipogenesis by three different criteria, including quantitation of PPAR{gamma} transcripts. Our results, using real-time PCR, agree with previous semiquantitive studies showing that PPAR{gamma} mRNA expression is increased during differentiation of murine 3T3L1 preadipocytes and is up-regulated by Pioglitazone (23).

Adipogenesis contributes to the pathogenesis of TED in several ways, including a direct effect on proptosis attributable to the larger volume of mature adipocytes (compared with their precursors), elaboration of proinflammatory adipocytokines, and up-regulation of TSHR expression leading to homing of autoreactive T cells to the orbit (10). Consequently, we investigated whether a PPAR{gamma} antagonist might prove beneficial in reducing adipogenesis.

GW9662 inhibited hormone- and agonist-induced differentiation, providing further confirmation of a role for PPAR{gamma}. To our knowledge, this is the first report of a PPAR{gamma} ligand inhibiting the differentiation of primary human preadipocytes; and our results parallel those obtained using cells and lines of rodent origin (16, 17).

The results suggest that PPAR{gamma} antagonists could ameliorate TED by reducing orbital adipogenesis but would have to be administered when disease is active, because PPAR{gamma} antagonists have no effect on mature adipocytes (24).

Furthermore, care should be taken when selecting patients for treatment with PPAR{gamma} agonists. We recommend caution and close supervision of patients who have autoimmune thyroid or eye disease when treated with TZDs.


    Acknowledgments
 
We are grateful to C. Lane and Prof. M. Wheeler for providing surgical samples and to Dr. A. Parkes for advice on statistical analysis.


    Footnotes
 
This work was supported by grants from the University of Wales College of Medicine and the Wales Office for Research and Development.

Abbreviations: APRT, Adenine phosphoribosyltransferase; CAS, clinical activity score; GD, Graves’ disease; PD, pretibial dermopathy; PPAR, peroxisome proliferator-activated receptor; TED, thyroid eye disease; TSHR, TSH receptor; TZD, thiazolidinedione.

Received June 25, 2002.

Accepted September 17, 2002.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Perros P, Kendall-Taylor P 1995 Thyroid-associated ophthalmopathy—pathogenesis and clinical management. Baillieres Clin Endocrinol Metab 9:115–135[CrossRef][Medline]
  2. Rees Smith B, Mclachlan S, Furmaniak J 1998 Autoantibodies to the thyrotropin receptor. Endocr Rev 9:106–120
  3. Crisp M, Lane C, Halliwell M, Wynford-Thomas D, Ludgate M 1997 Thyrotropin receptor transcripts in human adult adipose tissue. J Clin Endocrinol Metab 82:2003–2005
  4. Bahn R, Dutton C, Naff N, Joba W, Spitweg C, Heufelder A 1998 Thyrotropin receptor expression in Graves’ orbital adipose/connective tissues; potential autoantigen in Graves’ ophthalmopathy. J Clin Endocrinol Metab 83:998–1002[Abstract/Free Full Text]
  5. Crisp MS, Starkey KJ, Lane C, Ham J, Ludgate M 2000 Adipogenesis in thyroid eye disease. Invest Ophthalmol Vis Sci 41:3249–3255[Abstract/Free Full Text]
  6. Many MC, Costagliola S, Detrait M, Denef JF, Vassart G, Ludgate M 1999 Development of an animal model of autoimmune thyroid eye disease. J Immunol 162:4966–4974[Abstract/Free Full Text]
  7. Costagliola S, Many MC, Denef JF, Pohlenz J, Refetoff S, Vassart G 2000 Genetic immunisation of outbred mice with thyrotropin receptor cDNA provides a model of Graves’ disease. J Clin Invest 105:803–811[Medline]
  8. Rapoport B, Alsabeth R, Aftergood D, McLachlan SM 2000 Elephantiasic pretibial myxedema: insight into and a hypothesis regarding the patho-genesis of the extrathyroidal manifestations of Graves’ disease. Thyroid 10:685–692[CrossRef][Medline]
  9. Daumerie C, Ludgate M, Costagliola S, Many MC 2002 Evidence for thyrotropin receptor immunoreactivity in pretibial connective tissue from patients with thyroid associated dermopathy. Eur J Endocrinol 146:35–38[Abstract]
  10. Ludgate M, Baker G 2002 Unlocking the immunological mechanisms of orbital inflammation in thyroid eye disease. Clin Exp Immunol 127:193–198[CrossRef][Medline]
  11. Rosen ED, Spiegelman BM 2000 Molecular regulation of adipogenesis. Annu Rev Cell Biol 16:145–171
  12. Tontonoz P, Hu E, Spiegelman BM 1994 Stimulation of adipogenesis in fibroblasts by PPAR{gamma}2, a lipid activated transcription factor. Cell 79:1147–1156[CrossRef][Medline]
  13. Adams M, Montague CT, Prins JB, Holder JC, Smith SA, Sanders L, Digby JE, Sewter CP, Lazar MA, Chatterjee VKK, O’Rahilly S 1997 Activators of peroxisome proliferator activated receptor {gamma} have depot specific effects on human preadipocyte differentiation. J Clin Invest 100:3149–3153[Medline]
  14. Iwata M, Haruta T, Usui I, Takata Y, Takano A, Uno T, Kawahara Ueno E, Sasaoka T, Ishibashi O, Kobayashi M 2001 Pioglitazone ameliorates tumor necrosis {alpha} induced insulin resistance by a mechanism independent of adipogenic activity of peroxisome proliferator activated receptor {gamma}. Diabetes 50:1083–1092[Abstract/Free Full Text]
  15. Lebovitz HE, Dole JF, Patwardhan R, Rappaport EB, Freed MI 2001 Rosiglitazone monotherapy is effective in patients with type 2 diabetes mellitus. J Clin Endocrinol Metab 86:280–288[Abstract/Free Full Text]
  16. Oberfeld JL, Collins JL, Holmes CP, Goreham DM, Cooper JP, Cobb JE, Lenhard JM, Hull-Ryde EA, Mohr CP, Blanchard SG, Parks DJ, Moore LB, Lehmann JM, Plunket K, Miller AB, Milburn MV, Kliewer SA, Willson TM 1999 A peroxisome proliferator activated receptor {gamma} ligand inhibits adipocyte differentiation. Proc Natl Acad Sci USA 96:6102–6106[Abstract/Free Full Text]
  17. Wright HM, Clish CB, Mikami T, Hauser S, Yanagi K, Hiramatsu R, Serhan CN, Spiegelman BM 2000 A synthetic antagonist for the peroxisome proliferator activated receptor {gamma} inhibits adipocyte differentiation. J Biol Chem 275:1873–1877[Abstract/Free Full Text]
  18. Willson TM, Brown PJ, Sternbach DD, Henke BR 2000 The PPARs: from orphan receptors to drug discovery. J Med Chem 43:527–550[CrossRef][Medline]
  19. Curtis DA, Marascuilo LA 1992 Point estimates and confidence-intervals for the parameters of the 2-sample and matched-pair combined tests for ranks and normal scores. J Exp Educat 60:243–269
  20. Chilcot J, Tappenden P, Jones ML, Wight JP 2001 A systematic review of the clinical effectiveness of poiglitazone in the treatment of type 2 diabetes mellitus. Clin Ther 23:1792–1823[CrossRef][Medline]
  21. Smith TJ, Koumas L, Gagnon A, Bell A, Sempowski GD, Phipps RP, Sorisky A 2002 Orbital fibroblast heterogeneity may determine the clinical presentation of thyroid associated ophthalmopathy. J Clin Endocrinol Metab 87:385–392[Abstract/Free Full Text]
  22. Valyasevi RW, Harteneck DA, Dutton CM, Bahn RS 2002 Stimulation of adipogenesis, peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}), and thyrotropin receptor by PPAR{gamma} agonist in human orbital preadipocyte fibroblasts. J Clin Endocrinol Metab 87:2352–2358[Abstract/Free Full Text]
  23. Takamura T, Nohara E, Nagai Y, Kobayashi K 2001 Stage-specific effects of a thiazolidinedione on proliferation, differentiation and PPAR {gamma} mRNA expression in 3T3L1 adipocytes. Eur J Pharmacol 422:23–29[CrossRef][Medline]
  24. Camp HS, Chaudhry A, Leff T 2001 A novel potent antagonist of peroxisome proliferator activated receptor {gamma} blocks adipocyte differentiation but does not reverse the phenotype of terminally differentiated adipocytes. Endocrinology 142:3207–3213[Abstract/Free Full Text]
  25. Mouritz MP, Koorneef L, Wiersinga WM, Prummel MF, Berghout A, Van der Gaag R 1989 Clinical criteria for the assessment of disease activity in Graves’ ophthalmopathy: a novel approach. Br J Ophthalmol 73:639–644[Abstract/Free Full Text]
  26. Terwee CB, Dekker FW, Mouritz MP, Gerding MN, Baldeschi L, Kalmann R, Prummel MF, Wiersinga WM 2001 Interpretation and validity of changes in scores on the Graves’ ophthalmopathy quality of life after different treatments. Clin Endocrinol (Oxf) 54:391–398[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
I. Cozma, L. Zhang, J. Uddin, C. Lane, A. Rees, and M. Ludgate
Modulation of expression of somatostatin receptor subtypes in Graves' ophthalmopathy orbits: relevance to novel analogs
Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1630 - E1635.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
C Crescioli, L Cosmi, E Borgogni, V Santarlasci, S Gelmini, M Sottili, E Sarchielli, B Mazzinghi, M Francalanci, A Pezzatini, et al.
Methimazole inhibits CXC chemokine ligand 10 secretion in human thyrocytes
J. Endocrinol., October 1, 2007; 195(1): 145 - 155.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
L. Zhang, G. Baker, D. Janus, C. A. Paddon, D. Fuhrer, and M. Ludgate
Biological Effects of Thyrotropin Receptor Activation on Human Orbital Preadipocytes
Invest. Ophthalmol. Vis. Sci., December 1, 2006; 47(12): 5197 - 5203.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. E. Feldon, C. W. O'Loughlin, D. M. Ray, S. Landskroner-Eiger, K. E. Seweryniak, and R. P. Phipps
Activated Human T Lymphocytes Express Cyclooxygenase-2 and Produce Proadipogenic Prostaglandins that Drive Human Orbital Fibroblast Differentiation to Adipocytes
Am. J. Pathol., October 1, 2006; 169(4): 1183 - 1193.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. Schaffler, U. Muller-Ladner, J. Scholmerich, and C. Buchler
Role of Adipose Tissue as an Inflammatory Organ in Human Diseases
Endocr. Rev., August 1, 2006; 27(5): 449 - 467.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Antonelli, M. Rotondi, S. M. Ferrari, P. Fallahi, P. Romagnani, S. S. Franceschini, M. Serio, and E. Ferrannini
Interferon-{gamma}-Inducible {alpha}-Chemokine CXCL10 Involvement in Graves' Ophthalmopathy: Modulation by Peroxisome Proliferator-Activated Receptor-{gamma} Agonists
J. Clin. Endocrinol. Metab., February 1, 2006; 91(2): 614 - 620.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Lantz, T. Vondrichova, H. Parikh, C. Frenander, M. Ridderstrale, P. Asman, M. Aberg, L. Groop, and B. Hallengren
Overexpression of Immediate Early Genes in Active Graves' Ophthalmopathy
J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4784 - 4791.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Baker, G. Mazziotti, C. von Ruhland, and M. Ludgate
Reevaluating Thyrotropin Receptor-Induced Mouse Models of Graves' Disease and Ophthalmopathy
Endocrinology, February 1, 2005; 146(2): 835 - 844.
[Abstract] [Full Text] [PDF]


Home page
Arch OphthalmolHome page
F. Levin, M. Kazim, T. J. Smith, and E. Marcovici
Rosiglitazone-Induced Proptosis
Arch Ophthalmol, January 1, 2005; 123(1): 119 - 121.
[Full Text] [PDF]


Home page
BMJHome page
T. Cawood, P. Moriarty, and D. O'Shea
Recent developments in thyroid eye disease
BMJ, August 14, 2004; 329(7462): 385 - 390.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Kumar, M. J. Coenen, P. E. Scherer, and R. S. Bahn
Evidence for Enhanced Adipogenesis in the Orbits of Patients with Graves' Ophthalmopathy
J. Clin. Endocrinol. Metab., February 1, 2004; 89(2): 930 - 935.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. P. Combs, U. B. Pajvani, A. H. Berg, Y. Lin, L. A. Jelicks, M. Laplante, A. R. Nawrocki, M. W. Rajala, Albert. F. Parlow, L. Cheeseboro, et al.
A Transgenic Mouse with a Deletion in the Collagenous Domain of Adiponectin Displays Elevated Circulating Adiponectin and Improved Insulin Sensitivity
Endocrinology, January 1, 2004; 145(1): 367 - 383.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Starkey, K.
Right arrow Articles by Ludgate, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Starkey, K.
Right arrow Articles by Ludgate, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals