help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jabara, S.
Right arrow Articles by Strauss, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jabara, S.
Right arrow Articles by Strauss, J. F., III
The Journal of Clinical Endocrinology & Metabolism Vol. 88, No. 1 484-492
Copyright © 2003 by The Endocrine Society

Original Article

Stromal Cells of the Human Postmenopausal Ovary Display a Distinctive Biochemical and Molecular Phenotype

Sami Jabara, Lane K. Christenson, Clare Y. Wang, Jan M. McAllister, Norman B. Javitt, Andrea Dunaif and Jerome F. Strauss, III

Center for Research on Reproduction and Women’s Health (S.J., L.K.C., C.Y.W., J.F.S.), University of Pennsylvania Medical Center, Philadelphia, Pennsylvania 19104; Department of Cellular and Molecular Physiology (J.M.M.), Milton S. Hershey Medical Center, The Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033; Division of Hepatic Disease (N.B.J.), New York University Medical Center, New York, New York 10016; and Division of Endocrinology (A.D.), Metabolism and Molecular Medicine, Department of Medicine, Northwestern University Medical School, Chicago, Illinois 60611

Address all correspondence and requests for reprints to: Jerome F. Strauss, III, M.D., Ph.D., Center for Research on Reproduction and Women’s Health, 1354 BRB II/III, 421 Curie Boulevard, Philadelphia, Pennsylvania 19104. E-mail: jfs3{at}mail.med.upenn.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The stroma of the human postmenopausal ovary is postulated to produce androgens, but evidence for and against this idea exits in the literature. The purpose of this study was to determine whether key steroidogenic enzymes involved in androgen synthesis are expressed in the postmenopausal ovarian stroma. Stromal cells were isolated from postmenopausal ovaries and expression for genes involved in steroidogenesis [steroidogenic acute regulatory protein (StAR), P450scc, 3ß-hydroxysteroid dehydrogenase (3ß-HSD) P450c17, and P450c27] as well as for several growth factor binding proteins [gremlin, IGF binding protein-4, follistatin, and secreted frizzled-related protein (sFRP)-1 and -4], were compared with cultured human theca cells and dermal fibroblasts. Production of steroids (pregnenolone, progesterone, and hydroxysterol metabolites) and the metabolism of [3H] pregnenolone by ovarian stromal cells were also assessed. Isolated ovarian stromal cells from different subjects had a uniform morphology within and across cultures. Quantitative real time RT-PCR revealed that StAR, P450scc, and 3ß-HSD transcripts were, respectively 30, 25, and 45 times more abundant in theca cells than in stromal cells. Mean levels of P450scc and 3ß-HSD transcripts in stromal cells were similar to those found in dermal fibroblasts, whereas StAR transcripts in stromal cells were 285-fold more abundant than in fibroblasts. There was no significant expression of P450c17 in ovarian stromal cells or fibroblasts (~2000-fold less than in theca cells). Western analysis demonstrated the presence of the 30-kDa StAR mature protein in the cultured stromal cells, whereas P450c17 protein was not detectable. Ovarian stromal cells did not metabolize [3H] pregnenolone in the presence or absence of 8-Br-cAMP. Furthermore, pregnenolone and progesterone secretion by stromal cells was also undetectable, even in the presence of 22-hydroxycholesterol. P450c27 protein was detected in ovarian stromal cells and its metabolic products (i.e. 27-hydroxycholesterol and cholestenoic acid) were found in the culture media, reflecting functional cholesterol 27-hydroxylase activity. Follistatin, gremlin, IGF binding protein-4, and sFRP-1 and -4 transcripts were detected in the stromal cells in relative amounts significantly higher than theca cells, but not significantly different from fibroblasts, except for sFRP-1, which was significantly higher in stromal cells. Our observations demonstrate that stromal cells of the postmenopausal ovary have a signature biochemical and molecular phenotype that can be distinguished from fibroblasts. These cells do not appear to have significant steroidogenic potential in vitro, but they do metabolize cholesterol into hydroxysterols. We conclude that the predominant stromal cells of the postmenopausal ovary are not a significant site of androgen biosynthesis.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE POSTMENOPAUSAL OVARY consisting primarily of stromal cells is devoid of follicles and luteal tissue, the primary ovarian steroidogenic compartments in premenopausal women (1, 2, 3, 4). Studies of the steroidogenic activity of postmenopausal ovarian stromal cells have yielded conflicting results. Several reports suggest that the postmenopausal ovary is an important site of androgen synthesis (4, 5, 6, 7, 8, 9, 10, 11, 12, 13). Consistent with the notion of gonadotropin-stimulated steroidogenesis, plasma androgen levels were reduced in postmenopausal women after the administration of GnRH agonists or antagonists (5, 11, 14). Analysis of ovarian and peripheral vein blood in postmenopausal subjects revealed higher testosterone concentrations in the ovarian than in peripheral blood (6, 8). In contrast, other authors have concluded that the postmenopausal ovary is not a primary site of androgen biosynthesis (15, 16). Cauley et al. (15) examined hormone levels in postmenopausal women with and without ovaries and observed no statistically significant differences in circulating levels of testosterone and androstenedione between the two groups. Couzinet et al. (16) recently reported that plasma androgen levels were very low in all postmenopausal women with adrenal insufficiency and were similar between oophorectomized and nonoophorectomized postmenopausal women with normal adrenal function. These investigators also demonstrated that dexamethasone dramatically suppressed plasma androgen pro-duction, whereas human chorionic gonadotropin treatment had no effect on plasma sex steroid levels. Immunohistochemical studies of postmenopausal ovaries also found no evidence of expression of P450scc, 3ß-hydroxysteroid dehydrogenase (3ß-HSD), or P450c17, three steroidogenic enzymes necessary for androgen biosynthesis. However, expression of steroidogenic enzymes has been observed in scattered cells in the postmenopausal ovarian stroma by others (17, 18, 19).

The purpose of the present study was to gain a better understanding of human postmenopausal ovarian stromal cells by examining their steroid biosynthetic potential and their expression of cell lineage markers, steroidogenic enzymes and growth factor binding proteins. The cultured stromal cells expressed vimentin and cytokeratin, steroidogenic acute regulatory protein (StAR), P450scc, and P450c27, and lower levels of 3ß-HSD, but negligible amounts of P450c17. We found no evidence for significant pregnenolone production or metabolism. These observations indicate that the predominant stromal cells of the postmenopausal ovary have the potential to metabolize cholesterol into oxysterols but are not capable of significant steroid hormone synthesis, particularly androgen formation. The stromal cells also expressed high levels of transcripts for a number of growth factor binding proteins, suggesting a role for the stroma in insulating various ovarian compartments in the premenopausal ovary from the actions of locally produced growth factors.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Stromal cell isolation and cell culture

Ovaries were obtained under sterile conditions from five postmenopausal women undergoing hysterectomy and salpingo-oophorectomy for benign gynecologic disease as approved by the Institutional Review Board of the University of Pennsylvania and its tissue bank. A pathologist removed a portion of cortico-medullary ovarian stroma under aseptic conditions. Immediately after collection, the sample was immersed in ice-cold Roswell Park Memorial Institute (RPMI) 1640 medium and transferred to the laboratory. The ovarian tissue was then divided into two portions: one was fixed for immunohistochemistry (described below) and the remaining portion was minced into small (<1 mm3) blocks and cultured on collagen-coated plastic dishes. The collagen-coated dishes were prepared by incubating plastic dishes with a solution of rat-tail collagen (Collaborative Biomedical Products, Bedford, MA) at 37 C for 30 min; excess collagen was then removed by aspiration. Tissue explants were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated calf serum and antibiotics (penicillin 100 IU/ml, streptomycin 100 µg/ml, nystatin 25 U/ml) at 37 C in a humidified incubator under an atmosphere of 5% CO2 and 95% air. Culture medium was changed every 48 h until cells growing out from the explants reached 90% confluence, at which point the explants were washed with PBS and the remaining floating or attached pieces of tissue were removed. The remaining cells were released from the dishes by trypsin (0.25%) and then were plated onto six-well plastic culture dishes. When these second passage cells reached confluence, they were dispersed with trypsin and used for all subsequent experiments.

Human theca and granulosa cells were isolated and cultured as previously described (20, 21). The thecal cells from three normal patients, previously reported (21), were cultured through 22–26 population doublings in a 1:1 mixture of DMEM (low glucose, Life Technologies, Inc., Grand Island, NY) and Ham’s F-12 medium containing 5% fetal bovine serum (Life Technologies, Inc.), 5% horse serum (Irvine Scientific, Santa Ana, CA), 2% UltroSer G (Bio Sepra, Cergy-Saint-Christophe, France), 20 nM insulin, 20 nM selenium, 1.0 µM vitamin E (Sigma, St. Louis, MO), and 1% antibiotic solution (penicillin-streptomycin-fungizone) (Life Technologies, Inc.). Cells were maintained in an environment of 5% CO2, 5% O2, and 90% nitrogen at 37 C. Theca cells were washed twice with serum-free media (SFM; 1:1 mixture of DMEM and Ham’s F-12 medium containing 1 mg/ml BSA (Sigma), 100 µg/ml human transferrin (Sigma), 20 nM insulin, 20 nM selenium, 1 µM vitamin E, and 1% antibiotic solution before treatment protocols were initiated. Similar culture media was used for granulosa cells, the isolation and source of which was described previously (20). Human dermal fibroblasts were isolated and cultured as previously described (22, 23). Similar to thecal cell cultures, stromal cells were incubated in SFM (RPMI instead of DMEM) for the purpose of media analysis of steroid synthesis/metabolism. Half of all ovarian stromal and theca cell cultures were exposed to 1 mM 8-Br-cAMP (Sigma). At completion of all experiments, culture medium was collected and cells were then processed for isolation of protein for Western blot analysis or RNA for quantitative real-time PCR as described below.

Immunocytochemistry and immunohistochemistry

The ovarian tissue reserved for immunohistochemistry was fixed in buffered formalin and paraffin embedded, sectioned at 5–10 µm thickness, and placed on glass slides. Following deparaffinization in xylene, sections were rehydrated through a graded series of EtOH and water. Second passage stromal cells were also placed in 3-well chamber slides (5,000 cells/well) and fixed with buffered formalin. Cultured cells and the ovarian tissue sections were immunostained with anticytokeratin (Monoclonal Anti-Cytokeratin Peptide 18, Sigma), antivimentin (Monoclonal Anti-vimentin Clone V9, Sigma) antibodies at the respective dilutions of 1/500 and 1/50. The Vectastain Elite ABC system (Vector Laboratories, Inc., Burlingame, CA) for mouse IgG was used to detect primary antibodies. Briefly, following incubation with normal horse serum, preparations were incubated with the primary antibody for 30–60 min at room temperature. The slides were rinsed with Tris-buffered saline + 0.1% Tween 20 and then incubated with biotinylated antimouse secondary antibody. Slides were then washed with Tris-buffered saline + 0.1% Tween 20 and exposed to the chromogen, 3,3'-diaminobenzidine tetrahydrocholride in the presence of hydrogen peroxide, resulting in a brown reaction product. Negative controls involved substituting the primary antibody with either PBS or with preimmune mouse immunoglobulins. Slides were counterstained with Mayer’s hematoxylin and mounted using Permount and coverslips.

Western blot analysis

Protein extracts from stromal, granulosa and theca cells were generated as previously described (24). Protein concentrations were determined by the bicinchoninic acid protein assay kit (Pierce Chemical Co., Rockford, IL) and equal amounts of protein extract (60 µg) were loaded onto 10% acrylamide gels for electrophoresis. After electrophoresis, proteins were transferred to polyvinylidene difluoride membranes for probing with rabbit polyclonal anti-StAR (1:2000 dilution, Affinity BioReagents, Inc., Golden, CO), rabbit polyclonal anti-P450c17 raised against human recombinant P450c17 (1:1000 dilution), mouse monoclonal (i.e. antivimentin and anticytokeratin 18), or monoclonal anti-P450c27 (a gift from Dr. Narayan Avadhani, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA) antibodies as previously described (25). The detection of target protein-antibody complexes was carried out using the Vistra ECF Western blotting kit (Amersham Pharmacia Biotech, Arlington Heights, IL) and the chemifluorescence signal analyzed with a Storm PhosphorImager (Molecular Dynamics, Eugene, OR) using the blue fluorescence/chemifluorescence mode as previously described (24) or the SuperSignal Femto West (Pierce Chemical Co.) reagent as described by the manufacturer.

Quantitative real time RT-PCR

RNA isolation from stromal, dermal fibroblast and thecal cells followed procedures that have been previously described (20). Briefly, total RNA was isolated using Trizol reagent (Life Technologies, Inc.). One to 5 µg of total RNA were treated with RQ1 ribonuclease-free deoxyribonuclease (Promega Corp., Madison, WI) for 30 min at 37 C before reverse transcription with Moloney murine leukemia virus reverse transcriptase (Promega Corp.) as described by the manufacturer. The resulting cDNA was diluted 10-fold in sterile water and aliquots were subjected to quantitative real-time PCR. PCR primer pairs and probes for the analysis were designed with the Primer Express 1.5 software that accompanies the PE Applied Biosystems (Foster City, CA) Model 7700 sequence detector. Quantitative RT-PCR for human StAR used the TaqMan Universal Master Mix (PE Applied Biosystems), 900 nM of the forward and reverse primers, and 200 nM of the fluorescent probe as previously described (19). The SYBR green reagent was used to detect amplicons of the human P450scc cDNA (forward, TGGGTCGCCTATCACCAGTAT bases 420–440; reverse, CCACCCGGTCTTTCTTCCA bases 501–483), human P450c17 (forward, TGCTTATTAAGAAGGGCAAGGACTT bases 295–319; reverse, TGTTGGACGCGATGTCTAGAGT bases 363–342), human gremlin (forward, TGCTGGAGTCCAGCCAAGA bases 218–236; reverse, GCACCAGTCTCGCTTCAGGTA bases 282–262), human IGF binding protein (IGFBP)-4 (forward, CCCACTCCCAAAGCTCAGACT bases 1467–1487; reverse, CCAAGCAGATGGTGCAACAA bases 1555–1536) human 3ß-HSD type II (forward, TCCACCCACCTGGCTTCAT bases 1319–1338; reverse, GCAGGACCTGGGCTTGTG bases 1372–1354), follistatin (forward, AGGAGGAAGATGAAGACCAGGAC bases 1268–1290; reverse, CCACTCTAGAATAGAAGATATAGGAAAGCTG, bases 1323–1293), secreted frizzled-related protein (sFRP)-1 (forward, TTTGAGGAGAGCACCCTAGGC, bases 4120–4140; reverse, TGTGTATCTGCTGGCAACAGG, bases 4194 to 4174), and sFRP-4 (forward, TCCCTTCGAACTTCAAGTCCC, bases 926–946; reverse, GTCCTGAACTGTTCTCCG CTG, bases 1137–1117). Primer concentrations for each target cDNA were determined empirically. Agarose gel electrophoresis and analysis of the multicomponent data for all samples using the Dissociation Curves 1.0 program (PE Applied Biosystems) indicated the presence of a single PCR product. To account for differences in starting material, the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers and probe reagents from PE Applied Biosystems were used. The experimental and GAPDH PCRs were carried out in separate tubes in triplicate. The relative amounts of experimental and GAPDH PCR products were determined by comparison to a standard curve generated by serial dilution of a sample containing high levels of the target amplicons that was also run in triplicate. An arbitrary value of template was assigned to the highest standard and corresponding values to the subsequent dilutions and these relative values were plotted against the threshold value for each dilution to generate a standard curve. The relative amount for each experimental triplicate (i.e. unknown) and GAPDH triplicate was assigned an arbitrary value based on the slope and y-intercept of the standard curve. The average of the experimental triplicate was divided by the average of the GAPDH triplicate and the resulting normalized values were used for statistical analysis. ANOVA was used to compare the normalized levels of each of the target genes within the three different cell types and a probability value less than 0.05 was considered significant.

Analysis of hydroxysterol metabolites and metabolism of [3H] pregnenolone

Second passage ovarian stromal cells were grown in SFM in the presence or absence of 1 mM 8-Br-cAMP for 48 h. Aliquots of the media were removed at 48 h and analyzed for 27-hydroxycholesterol and 3ß-hydroxy-5-cholestenoic acid as previously described (25). The cells were then placed in SFM containing [3H] pregnenolone (S.A.= 17.5 Ci/mmol, 1.0 µM) and cold pregnenolone. Aliquots of the medium were collected at 48 h. Steroids were extracted from the medium with 4 volumes dichloromethane (HPLC grade) with an extraction efficiency greater than 90%. The dichloromethane phase containing unconjugated steroids was evaporated. The residue was dissolved in methanol and subjected to reverse-phase HPLC. HPLC was conducted on a computer-controlled automated chromatogram (Gilson Medical Electronics, Inc., Middleton, WI) using a Phenomenex 25-cm 5 µm Prodigy C18 column (Milford, MA). The gradient solvent delivery system consisted of 1:1 acetonitrile/methanol (A/M) and water (50:50) for 10 min, followed by a 10-min linear gradient to 57% A/M, an additional 4-min linear gradient to 73% A/M for 9 min, and then a 2-min linear gradient to 100% A/M. Radioactive material was detected by an in-line liquid scintillation spectrophotometer (IN/US System Inc., Tampa, FL). The retention times of authentic steroid standards were established for the nonreduced and reduced steroids at 240 and 200 nM, respectively.

Analysis of pregnenolone and progesterone synthesis

In a separate experiment, second passage ovarian stromal cells from three different ovaries were cultured in SFM containing the bioavailable steroidogenic substrate, 22(R)-hydroxycholesterol (5 µg/ml) in the presence or absence of 1 mM 8-Br-cAMP for 48 h. The amount of pregnenolone in the media was determined by RIA as described previously (26). Media progesterone concentrations were assayed using the respective Coat-A-Count tubes and reagents (Diagnostic Products, Los Angeles, CA) as described by the manufacturer (24).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Expression of vimentin and cytokeratin by ovarian stromal tissue and cultured cells

Isolated stromal cells from different subjects had a uniform morphology in culture. The stromal cells exhibited a stellate morphology, which differed from the characteristic cobblestone appearance of ovarian surface epithelial cells in culture. Moreover, the stromal cells coexpressed both vimentin and cytokeratin (Fig. 1Go, A and B). The brown immunostaining reaction product was apparent in the cytoplasm and was most intense for vimentin. The control preparations using nonimmune mouse serum showed no staining (Fig. 1CGo). Western analysis confirmed the coexpression of vimentin (single ~55-kDa band) and cytokeratin (single ~48-kDa band) (Fig. 1FGo) within ovarian stromal cell extracts. The ovarian stroma from which the cells originated was stained for vimentin and cytokeratin, revealing intense staining for vimentin and weak staining for cytokeratin (Fig. 1Go, D and E).



View larger version (71K):
[in this window]
[in a new window]
  		Figure 1. Expression of intermediate filament proteins by ovarian stromal cells. Immunostaining and Western blot analysis of the intermediate filament proteins, vimentin and cytokeratin are shown in cultured ovarian stromal cells (A, B, C, F) and postmenopausal human ovarian tissue (D, E). Immunostaining followed the procedures described in Materials and Methods section with second passage ovarian stromal cells stained for vimentin (A), cytokeratin (B), and nonimmune antibody control (C). Note that vimentin was uniformly detected within the cytoplasm of the stromal cells (A), whereas cytokeratin expression exhibited a weak punctate staining pattern. No specific immunostaining was observed in the sections where the primary antibody was replaced with preimmune serum (C) and in no antibody controls (data not shown). Postmenopausal ovarian tissue sections exhibited a pronounced staining for vimentin (D) with much weaker staining for the cytokeratin (E). Total cellular extracts prepared from cultured human stromal, thecal and granulosa cells were analyzed by Western blot as described in the Materials and Methods section. Western blot analysis for vimentin in stromal and theca cells identified a single band at 55 kDa. Western blot analysis for cytokeratin in cultured stromal cells and granulosa cells also yielded a single band at ~45 kDa.

 
Expression of steroidogenic proteins by ovarian stromal cells

Expression of StAR, P450scc, P450c17, and 3ß-HSD transcripts was analyzed in the ovarian stromal cells using real time quantitative RT-PCR normalized to GAPDH. The relative abundance of these transcripts was compared with levels found in theca cells and dermal fibroblasts (Fig. 2Go). Mean transcript levels of StAR, P450scc, and 3ß-HSD were, respectively 30, 25, and 45 times more abundant (P < 0.05) in theca cells than in stromal cells. Mean transcripts levels of P450scc (Fig. 2BGo) and 3ß-HSD (Fig. 2CGo) in stromal cells were similar to those found in dermal fibroblasts, whereas levels of StAR transcripts (Fig. 2AGo) in stromal cells were 285-fold more than those in fibroblasts (P < 0.05). There was no significant expression of P450c17 in stromal cells or fibroblasts (~2000-fold less than in theca cells).



View larger version (16K):
[in this window]
[in a new window]
  		Figure 2. Expression of steroidogenic protein transcripts in ovarian stromal cells. Histograms depict the quantitative real-time RT-PCR results for expression of StAR (A), P450scc (B), 3ß-HSD (C), and P450c17 (D). Quantitative RT-PCR was completed as described in Materials and Methods and the relative abundance of each cDNA was normalized for GAPDH expression. Means ± SEM for independent ovarian stromal cells (n = 3), thecal cells (n = 3), and dermal fibroblasts (n = 3) are shown.

 
Because StAR, P450c17, P450scc, and 3ß-HSD expression is regulated by cAMP in theca cells, we examined the effect of 8-Br-cAMP on ovarian stromal cells. A 1-mM dose of 8-Br-cAMP is known to induce expression of these genes in human theca cells, but this treatment had no significant effect on transcript levels in ovarian stromal cells (Table 1Go).


View this table:
[in this window]
[in a new window]
  		Table 1. Effect of 8-Br-cAMP treatment on the relative abundance of steroidogenic protein transcripts in ovarian stromal cells

 
Western blot analysis indicated that the 30-kDa protein corresponding to mature StAR was detected in ovarian stromal cell extracts. Ovarian stromal cell expression was less than that observed in the positive control human theca cell extracts (Fig. 3AGo). We also confirmed the absence of P450c17 protein from ovarian stromal cells by Western analysis. The ovarian stromal cell extracts lacked detectable P450c17 protein, whereas theca cell extracts contained significant amounts of P450c17 protein (Fig. 3BGo).



View larger version (57K):
[in this window]
[in a new window]
  		Figure 3. Protein levels of StAR, P450c17, and P450c27 in ovarian stromal cells. Western blot analysis of StAR (A), P450c17 (B), and P450c27 (C) expression in cultured ovarian stromal cells, followed procedures described in Materials and Methods. Total cellular extracts prepared from two different ovarian stromal cell cultures and thecal and granulosa cell cultures are shown. Western blot analysis revealed the expression of the mature 30-kDa StAR protein in ovarian stromal cells (A). Levels of expression were significantly less than those observed in theca and granulosa cell extracts. Ovarian stromal cells contained no P450c17 protein, whereas it was observable in the positive control thecal cells (B). The levels of P450c27 protein expression (56 kDa) detected in ovarian stromal cells and thecal cells were similar (C).

 
Expression of the cholesterol metabolizing enzyme, P450c27

P450c27, another cholesterol metabolizing enzyme, was detected in ovarian stromal cells. Western blot analysis of protein cell extracts from ovarian stromal cells in culture revealed the approximately 56-kDa protein, which was also found in theca cell extracts (Fig. 3CGo).

Analysis of steroidogenesis and cholesterol metabolism in ovarian stromal cells

We examined the metabolism of pregnenolone by ovarian stromal cells. HPLC analysis performed on culture media from ovarian stromal cells incubated with [3H] pregnenolone demonstrated no appreciable metabolism of pregnenolone in the presence or absence of 8-Br-cAMP (Fig. 4Go). A small peak at 20.17 min retention time representing 20{alpha}-hydroxypregnenolone was observed, reflecting minimal 20{alpha}-HSD activity. Pregnenolone and progesterone secretion by stromal cells was also undetectable in the culture media enriched with the hydroxysterol substrate, 22(R)-hydroxycholesterol. Media concentrations of pregnenolone and progesterone after treatment of stromal cells with 8-Br-cAMP in the presence or absence of 22(R)-hydroxycholesterol also failed to reach above the sensitivity (100 pg) of the RIAs. These observations indicate the absence of significant 3ß-HSD activity and as anticipated from the transcript profiling and Western blot analysis, the absence of P450c17 activity. We then examined the production of cholesterol metabolites generated by P450c27 in three separate cultures of ovarian stromal cells. Both 27-hydroxycholesterol and cholestenoic acid were detected (Table 2Go). There was no difference of production of these oxysterol metabolites in the presence or absence of cAMP treatment (data not shown).



View larger version (16K):
[in this window]
[in a new window]
  		Figure 4. Metabolism of [H3] pregnenolone by ovarian stromal cells. Cultured stromal cells were incubated in SFM containing [3H] pregnenolone in the absence or presence of 1 mM 8-Br-cAMP. Aliquots of the medium were collected after 48 h. Steroids were extracted from the medium and subjected to HPLC. Radioactive material was detected by an in-line liquid scintillation spectrophotometer and relative counts per minute are depicted by the red line. The retention times of authentic steroid standards were established for the nonreduced and reduced steroids at 240 and 200 nM, respectively and are depicted by the blue line. A representative HPLC run is shown.

 

View this table:
[in this window]
[in a new window]
  		Table 2. Production of hydroxysterols by ovarian stromal cells

 
Expression of growth factor binding proteins

Because we found no evidence for significant steroidogenic activity, we next determined whether the ovarian stromal cells expressed growth factor binding proteins. We hypothesized that this might be a retained phenotype of stromal cells in the premenopausal ovary where neutralizing binding proteins might serve an insulator function to geographically restrict the actions of growth factors produced by follicles and corpora lutea. We examined the expression of gremlin and follistatin, antagonists of bone morphogenetic proteins (BMPs) and TGF-ß family members, IGFBP-4, an IGF antagonist, and sFRP-1 and -4, antagonists of Wnt signaling, in ovarian stromal cells using real time quantitative RT-PCR (Fig. 5Go). The relative amounts of gremlin transcripts were 10-fold higher in ovarian stromal and fibroblast cells than in theca cells (Fig. 5AGo). IGFBP-4 mRNA levels were not significantly different among the three different cell types (Fig. 5BGo). The levels of follistatin transcripts were approximately 24 times higher (P < 0.05) in the stromal cells than in the theca cells and were equivalent in stromal cells and fibroblasts. The levels of sFRP-1 transcripts were approximately 40 times higher (P < 0.05) in the stromal cells than in theca cells and were equivalent to fibroblasts (Fig. 5CGo). The levels of sFRP-4 transcripts in ovarian stromal cells were approximately 15 times higher (P < 0.05) than in theca cells and approximately 80 times higher than in fibroblasts (Fig. 5DGo).



View larger version (20K):
[in this window]
[in a new window]
  		Figure 5. Expression of growth factor binding proteins by human ovarian stromal cells, thecal cells, and dermal fibroblasts. Histograms depict the quantitative real-time RT-PCR results for expression of gremlin (also known as BMP-1 antagonist; A), IGFBP-4 (B), follistatin (C), and sFRP-1 and -4 (D). Quantitative RT-PCR was completed as described in Materials and Methods, and the relative abundance of each transcript was normalized to GAPDH expression. Means ± SEM for independent stromal cells (n = 3), thecal cells (n = 3), and dermal fibroblasts (n = 3) are shown.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Studies of the human ovarian stroma have been limited primarily to investigations of its potential contributions to steroidogenesis in the postmenopausal ovary. Consequently, there are few reports characterizing the biochemical and molecular features of these cells with the majority of reports restricted to histological and immunocytochemical analyses (2, 16, 17, 18, 19). Ovarian stromal cells are thought to be of mesenchymal origin (27). Typical mesenchymal tissues express vimentin and not cytokeratin, a marker for cells of epithelial origin (28). However, certain cells like the ovarian surface epithelium cells stain positively for both markers (2). Based on the presumed mesenchymal origin, we had expected the ovarian stromal cells to stain positive for vimentin and negative for cytokeratin. In fact, several authors reported that stromal cells of the premenopausal human ovary are positive for vimentin and negative for cytokeratin (28, 29). It is important to note, however, that the stromal tissues used in these studies came from premenopausal women (28) or from ovarian tumors (29). The current study demonstrates that human postmenopausal ovarian stromal cells coexpress vimentin (strong intensity) and cytokeratin (weak intensity). This phenotype was present in cultured cells but was also confirmed by immunohistochemistry on freshly fixed ovarian stroma (Fig. 1Go). Differences in the immunohistochemical techniques and the cytokeratin antibody used, in addition to the difference in the source of the ovarian stroma used (premenopausal vs. postmenopausal, cancerous vs. normal) could explain the apparent discrepancies between the present study and earlier reports.

As mentioned above, surface epithelium cells can also stain positively for both markers; however, the staining for vimentin is much less intense than that for cytokeratin, which is opposite to our findings with ovarian stromal cells. Moreover, this single cell layer of epithelium cannot be easily recovered unless specific techniques for isolation and culture are employed. In addition, the morphology of our cultured stromal cells was distinctly different from the cobblestone morphology described for ovarian surface epithelial cells in culture. Thus, it seems highly unlikely that our cultures represented surface epithelial cells as opposed to stromal cells.

Ovarian stromal cells expressed StAR, 3ß-HSD, and P450scc transcripts, but at significantly lower levels than in cultured human theca cells. P450c17 transcripts were negligible in the stromal cells and P450c17 protein was not detectable by Western analysis. Despite the presence of low but detectable StAR, 3ß-HSD, and P450scc transcripts, the stromal cells were not able to metabolize pregnenolone into {Delta}4-3keto products, nor did they produce detectable levels of pregnenolone or progesterone when cultured with a soluble substrate for the cholesterol side-chain cleavage reaction. The lack of metabolism of labeled pregnenolone into androgens, a sensitive assay of P450c17 activity, and the virtual absence of P450c17 transcripts strongly indicate that the ovarian stroma is not a significant site of androgen biosynthesis These observations mirror those of Couzinet et al. (16), who demonstrated that less than 1% of cells in the stroma of the postmenopausal ovary stain for the presence of P450scc, 3ß-HSD, P450c17, and P450arom. These findings support the notion that the predominant cell type in the postmenopausal stroma in situ is not steroidogenic, and argue against the possibility that expression of the steroidogenic enzymes was suppressed under the culture conditions we employed. The retained expression of P450c27 discussed below provides additional support for this assertion. Therefore, if the postmenopausal does produce steroid hormones including androgens, they must originate from a minor cell population. Quantitatively, Couzinet et al. (16) proposed that the adrenals are the main source of the androgens in the menopausal woman. Ovariectomized women with intact adrenals had androgen levels equal to those of women with intact ovaries and adrenals, and those levels were 50% of the levels in premenopausal women, whereas women with adrenal insufficiency with or without ovaries had no detectable androgen in their blood.

The pattern of mRNA expression for steroidogenic proteins by stromal cells was similar to that of dermal fibroblasts, with the exception that StAR was 285 times more abundant in stromal cells than in dermal fibroblasts. Because StAR was clearly expressed in ovarian stromal cells as detected by quantitative RT-PCR and Western blot analysis, whereas the downstream enzymes involved in progesterone (P450scc and 3ß-HSD) and androgen biosynthesis (P450c17) were expressed at low to negligible levels and no activity was observed, we examined alternative pathways of metabolism of cholesterol. Unlike cultured human theca cells that respond to cAMP with increased expression of StAR and steroidogenic enzymes (30, 31), the levels of these transcripts, including StAR, P450scc, 3ß-HSD, and P450c17 transcripts, did not significantly increase when the stromal cells were exposed to 1 mM 8-Br-cAMP. This suggests either that the StAR gene is constitutively expressed in stromal cells, or that it is under a different mode of regulation than in the theca.

StAR is known to stimulate cholesterol metabolism by P450c27, an enzyme that is found on the inner mitochondrial membrane. We detected P450c27 in ovarian stromal cells and were able to show that these cells synthesize 27-hydroxycholesterol and cholestenoic acid, metabolites both produced by P450c27 (25). Thus, cells grown under our culture conditions retain expression of a cholesterol metabolizing cytochrome P450.

P450c27 plays a key role in both the classic/neutral and acid pathways of bile acid synthesis, and is therefore accordingly expressed in liver tissue (32). However, unlike the majority of the other enzymes involved in bile acid synthesis, P450c27 exhibits a wide distribution consistent with the possibility that it may have other functions (33). Consistent with this distribution, extrahepatic synthesis of 27-hydroxycholesterol is estimated to account for 5–10% of total bile acid production in humans (34, 35). Thus, the 27-hydroxylation reaction may serve as a mechanism for cells to discard cholesterol as the hydroxylated sterol leaves cells, entering the circulation where it can then be metabolized to bile acids in the liver. Alternatively, 27-hydroxycholesterol may serve as a regulator of cellular lipid metabolism by activating the nuclear receptor LXR (36), although a role for 27-hydroxycholesterol in regulating cholesterol metabolism has been recently questioned (37). The presence of StAR and P450c27 and their oxysterol products in ovarian stromal cells suggests that these cells may play a role in providing steroid precursors that can be converted into other steroid hormones. This represents a potentially novel endocrine role for the postmenopausal ovaries. Alternatively, stromal cell 27-hydroxycholesterol synthesis might contribute to basal steroid output by adjacent steroidogenic cells in premenopausal ovarian tissue. Finally, expression of P450c27 by the ovarian stromal cells in combination with its approximately 30-fold greater affinity for adrenodoxin than P450scc, may serve to limit P450scc activity by blocking its access to the common redox partner (38).

Ovarian stromal cells expressed significant levels of growth factor binding proteins, especially gremlin, a protein that binds and inactivates BMPs (39, 40), suggesting a role for stromal cells in the modulation of the function of growth factor action in the ovary. Members of the BMP family are known to play important roles in follicular growth (41, 42, 43). The production of gremlin by stromal cells in the premenopausal ovary may serve as a buffer, preventing diffusion of BMP signals in the ovary. The same may be true of the IGF binding proteins, secreted frizzled-related proteins and follistatin (43, 44, 45, 46). The production of these proteins that neutralize the activity of growth factors and signaling molecules that are thought to influence differentiation, growth, and development of ovarian cells and compartments (i.e. follicles, corpora lutea) is consonant with our hypothesis that the ovarian stroma may act as an insulator, limiting the action of growth factors and signaling molecules in space and time in the ovary. The growth factor binding proteins may also affect the stromal cell response to autocrine or paracrine stimuli.

In conclusion, our observations demonstrate that the predominate stromal cell type of the postmenopausal ovary has a signature biochemical and molecular phenotype that can be distinguished from fibroblasts. These cells do not appear to have significant steroidogenic potential, but do metabolize cholesterol into hydroxysterols. The expression of growth factor binding proteins raises the possibility of an important role for the stroma in geographically restricting the action of regulatory molecules in the premenopausal ovary.


   Acknowledgments
 
We thank Judith Wood for assistance in preparation of this manuscript.


   Footnotes
 
This work was supported by HD-34449, the National Cooperative Program in Infertility Research.

S.J. and L.K.C. contributed equally to this work.

Abbreviations: A/M, Acetonitrile/methanol; BMP, bone morphogenetic protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; 3ß-HSD, 3ß-hydroxysteroid dehydrogenase; IGFBP, IGF binding protein; RPMI, Roswell Park Memorial Institute; SFM, serum-free media; SFRP, secreted frizzled-related protein; Star, steroidogenic acute regulatory protein.

Received August 15, 2002.

Accepted September 27, 2002.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Richardson SJ, Senikas V, Nelson JF 1987 Follicular depletion during the menopausal transition: evidence for accelerated loss and ultimate exhaustion. J Clin Endocrinol Metab 65:1231–1237[Abstract]
  2. Nicosia SV 1986 Ovarian changes during the climacteric. In: Mastroianni L, Paulsen CA, eds. Aging reproduction and the climacteric. New York: Plenum Press; 179
  3. Erickson GF, Magoffin DA, Dyer CA, Hofeditz C 1985 The ovarian androgen producing cells: a review of structure/function relationships. Endocr Rev 6:371–399[Medline]
  4. Adashi EY 1994 The climacteric ovary as a functional gonadotropin-driven androgen-producing gland. Fertil Steril 62:20–27[Medline]
  5. Dowsett M, Cantwell B, Lal A, Jeffcoate SL, Harris AL 1988 Suppression of postmenopausal ovarian steroidogenesis with the luteinizing hormone-releasing hormone agonist goserelin. J Clin Endocrinol Metab 66:672–677[Abstract]
  6. Judd HL, Judd GE, Lucas WE, Yen SS 1974 Endocrine function of the postmenopausal ovary: concentration of androgens and estrogens in ovarian and peripheral vein blood. J Clin Endocrinol Metab 39:1020–1024[Medline]
  7. Judd HL, Lucas WE, Yen SS 1974 Effect of oophorectomy on circulating testosterone and androstenedione levels in patients with endometrial cancer. Am J Obstet Gynecol 118:793–798[Medline]
  8. Heinonen PK, Koivula T, Rajaniemi H, Pystynen P 1986 Peripheral and ovarian venous concentrations of steroid and gonadotropin hormones in postmenopausal women with epithelial ovarian tumors. Gynecol Oncol 25:1–10[CrossRef][Medline]
  9. Laughlin GA, Barrett-Connor E, Kritz-Silverstein D, von Muhlen D 2000 Hysterectomy, oophorectomy, and endogenous sex hormone levels in older women: the Rancho Bernardo Study. J Clin Endocrinol Metab 85:645–651[Abstract/Free Full Text]
  10. Longcope C 1971 Metabolic clearance and blood production rates of estrogens in postmenopausal women. Am J Obstet Gynecol 111:778–781[Medline]
  11. Rabinovici J, Rothman P, Monroe SE, Nerenberg C, Jaffe RB 1992 Endocrine effects and pharmacokinetic characteristics of a potent new gonadotropin-releasing hormone antagonist (Ganirelix) with minimal histamine-releasing properties: studies in postmenopausal women. J Clin Endocrinol Metab 75:1220–1225[Abstract]
  12. Ushiroyama T, Sugimoto O 1995 Endocrine function of the peri- and postmenopausal ovary. Horm Res 44:64–68
  13. Vermeulen A 1976 The hormonal activity of the postmenopausal ovary. J Clin Endocrinol Metab 42:247–253[Abstract]
  14. Sluijmer AV, Heineman MJ, De Jong FH, Evers JL 1995 Endocrine activity of the postmenopausal ovary: the effects of pituitary down-regulation and oophorectomy. J Clin Endocrinol Metab 80:2163–2167[Abstract]
  15. Cauley JA, Gutai JP, Kuller LH, LeDonne D, Powell JG 1989 The epidemiology of serum sex hormones in postmenopausal women. Am J Epidemiol 129:1120–1131[Abstract/Free Full Text]
  16. Couzinet B, Meduri G, Lecce MG, Young J, Brailly S, Loosfelt H, Milgrom E, Schaison G 2001 The postmenopausal ovary is not a major androgen-producing gland. J Clin Endocrinol Metab 86:5060–5066[Abstract/Free Full Text]
  17. Dupont, E, Labrie F, Luu-The V, Pelletier G 1992 Immunocytochemical localization of 3ß-hydroxysteroid dehydrogenase/{Delta}4-{Delta}5-isomerase in human ovary. J Clin Endocrinol Metab 74:994–998[Abstract]
  18. Sasano H, Mori T, Sasano N, Nagura H, Mason JI 1990 Immunolocalization of 3ß-hydroxysteroid dehydrogenase in human ovary. J Reprod Fertil 89: 743–751
  19. Inkster SE, Brodie AM 1991 Expression of aromatase cytochrome P-450 in premenopausal and postmenopausal human ovaries: an immunocytochemical study. J Clin Endocrinol Metab 73:717–726[Abstract]
  20. Yamamoto N, Christenson LK, JM MC, Strauss 3rd JF 2002 Growth differentiation factor-9 inhibits 3'5'-adenosine monophosphate-stimulated steroidogenesis in human granulosa and theca cells. J Clin Endocrinol Metab 87:2849–2856[Abstract/Free Full Text]
  21. Nelson VL, Legro RS, Strauss III JF, McAllister JM 1999 Augmented androgen production is a stable phenotype of propagated theca cells from polycystic ovaries. Mol Endocrinol 13:946–957[Abstract/Free Full Text]
  22. Dunaif A, Xia J, Book CB, Schenker E, Tang Z 1995 Excessive insulin receptor serine phosphorylation in cultured fibroblasts and in skeletal muscle. A potential mechanism for insulin resistance in the polycystic ovary syndrome. J Clin Invest 96:801–810
  23. Sorbara LR, Tang Z, Cama A, Xia J, Schenker E, Kohanski RA, Poretsky L, Koller E, Taylor SI, Dunaif A 1994 Absence of insulin receptor gene mutations in three insulin-resistant women with the polycystic ovary syndrome. Metabolism 43:1568–1574[CrossRef][Medline]
  24. Devoto L, Christenson LK, McAllister JM, Makrigiannakis A, Strauss 3rd JF 1999 Insulin and insulin-like growth factor-I and -II modulate human granulosa-lutein cell steroidogenesis: enhancement of steroidogenic acute regulatory protein (StAR) expression. Mol Hum Reprod 5:1003–1010[Abstract/Free Full Text]
  25. Sugawara T, Lin D, Holt JA, Martin KO, Javitt NB, Miller WL, Strauss 3rd JF 1995 Structure of the human steroidogenic acute regulatory protein (StAR) gene: StAR stimulates mitochondrial cholesterol 27-hydroxylase activity. Biochemistry 34:12506–12512[CrossRef][Medline]
  26. Arakane F, King SR, Du Y, Kallen CB, Walsh LP, Watari H, Stocco DM, Strauss 3rd JF 1997 Phosphorylation of steroidogenic acute regulatory protein (StAR) modulates its steroidogenic activity. J Biol Chem 272:32656–32662[Abstract/Free Full Text]
  27. Snowden JA, Bradbury K, Thornton JG, Wells M 1989 Effect of pituitary gonadotrophins on proliferation of primary cultures of human ovarian stroma. J Pathol 159:59–65[CrossRef][Medline]
  28. Czernobilsky B, Moll R, Levy R, Franke WW 1985 Co-expression of cytokeratin and vimentin filaments in mesothelial, granulosa and rete ovarii cells of the human ovary. Eur J Cell Biol 37:175–190[Medline]
  29. Benjamin E, Law S, Bobrow LG 1987 Intermediate filaments cytokeratin and vimentin in ovarian sex cord-stromal tumours with correlative studies in adult and fetal ovaries. J Pathol 152:253–263[CrossRef][Medline]
  30. Nelson VL, Qin Kn KN, Rosenfield RL, Wood JR, Penning TM, Legro RS, Strauss 3rd JF, McAllister JM 2001 The biochemical basis for increased testosterone production in theca cells propagated from patients with polycystic ovary syndrome. J Clin Endocrinol Metab 86:5925–5933[Abstract/Free Full Text]
  31. Kiriakidou M, McAllister JM, Sugawara T, Strauss 3rd JF 1996 Expression of steroidogenic acute regulatory protein (StAR) in the human ovary. J Clin Endocrinol Metab 81:4122–4128[Abstract/Free Full Text]
  32. Bjorkhem I 1992 Mechanism of degradation of the steroid side chain in the formation of bile acids. J Lipid Res 33:455–471[Medline]
  33. Andersson S, Davis DL, Dahlback H, Jornvall H, Russell DW 1989 Cloning, structure, and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme. J Biol Chem 264:8222–8229[Abstract/Free Full Text]
  34. Lund E, Andersson O, Zhang J, Babiker A, Ahlborg G, Diczfalusy U, Einarsson K, Sjovall J, Bjorkhem I 1996 Importance of a novel oxidative mechanism for elimination of intracellular cholesterol in humans. Arterioscler Thromb Vasc Biol 16:208–212[Abstract/Free Full Text]
  35. Duane WC, Javitt NB 1999 27-hydroxycholesterol: production rates in normal human subjects. J Lipid Res 40:1194–1199[Abstract/Free Full Text]
  36. Edwards PA, Kast HR, Anisfeld AM 2002 BAREing it all: the adoption of LXR and FXR and their roles in lipid homeostasis. J Lipid Res 43:2–12[Abstract/Free Full Text]
  37. Meir K, Kitsberg D, Alkalay I, Szafer F, Rosen H, Shpitzen S, Ben Avi L, Staels B, Fievet C, Meiner V, Bjorkhem I, Leitersdorf E 2002 Human sterol 27-hydroxylase (Cyp27) overexpressor transgenic mouse model. Evidence against 27-hydroxycholesterol as a critical regulator of cholesterol homeostasis. J Biol Chem 277:34036–34041[Abstract/Free Full Text]
  38. Pikuleva IA, Cao C, Waterman MR 1999 An additional electrostatic interaction between adrenodoxin and P450c27 (CYP27A1) results in tighter binding than between adrenodoxin and P450scc (CYP11A1). J Biol Chem 274:2045–2052[Abstract/Free Full Text]
  39. Ohyama A, Saito F, Ohuchi H, Noji S 2001 Differential expression of two BMP antagonists, gremlin and Follistatin, during development of the chick feather bud. Mech Dev 100:331–333[CrossRef][Medline]
  40. Pereira RC, Economides AN, Canalis E 2000 Bone morphogenetic proteins induce gremlin, a protein that limits their activity in osteoblasts. Endocrinology 141:4558–4563[Abstract/Free Full Text]
  41. Yan C, Wang P, DeMayo J, DeMayo FJ, Elvin JA, Carino C, Prasad SV, Skinner SS, Dunbar BS, Dube JL, Celeste AJ, Matzuk MM 2001 Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function. Mol Endocrinol 15:854–866[Abstract/Free Full Text]
  42. Elvin JA, Clark AT, Wang P, Wolfman NM, Matzuk MM 1999 Paracrine actions of growth differentiation factor-9 in the mammalian ovary. Mol Endocrinol 13:1035–1048[Abstract/Free Full Text]
  43. Erickson GF, Shimasaki S 2001 The physiology of folliculogenesis: the role of novel growth factors. Fertil Steril 76:943–949[CrossRef][Medline]
  44. Yap OW, van Dessel HJ, Chandrasekher YA, Fauser BC, Giudice LC 1997 Insulin-like growth factors and insulin-like growth factor binding proteins in androgen-dominant ovarian follicles from testosterone-treated female-to-male trans-sexuals. Fertil Steril 68:252–258[CrossRef][Medline]
  45. Rattner A, Hsieh JC, Smallwood PM, Gilbert DJ, Copeland NG, Jenkins NA, Nathans J 1997 A family of secreted proteins contains homology to the cysteine-rich ligand-binding domain of frizzled receptors. Proc Natl Acad Sci USA 94:2859–2863[Abstract/Free Full Text]
  46. Richards JS, Russell DL, Ochsner S, Hsieh M, Doyle KH, Falender AE, Lo YK, Sharma SC 2002 Novel signaling pathways that control ovarian follicular development, ovulation, and luteinization. Recent Prog Horm Res 57:195–220[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
R. S. Viger, S. M. Guittot, M. Anttonen, D. B. Wilson, and M. Heikinheimo
Role of the GATA Family of Transcription Factors in Endocrine Development, Function, and Disease
Mol. Endocrinol., April 1, 2008; 22(4): 781 - 798.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
R. H. Fogle, F. Z. Stanczyk, X. Zhang, and R. J. Paulson
Ovarian Androgen Production in Postmenopausal Women
J. Clin. Endocrinol. Metab., August 1, 2007; 92(8): 3040 - 3043.
[Abstract] [Full Text] [PDF]

Home page
 Hum ReprodHome page
M. Lindeberg, K. Carlstrom, O. Ritvos, and O. Hovatta
Gonadotrophin stimulation of non-luteinized granulosa cells increases steroid production and the expression of enzymes involved in estrogen and progesterone synthesis
Hum. Reprod., February 1, 2007; 22(2): 401 - 406.
[Abstract] [Full Text] [PDF]

Home page
 Vet PatholHome page
M. Bielinska, S. Kiiveri, H. Parviainen, S. Mannisto, M. Heikinheimo, and D. B. Wilson
Gonadectomy-induced Adrenocortical Neoplasia in the Domestic Ferret (Mustela putorius furo) and Laboratory Mouse.
Vet. Pathol., February 1, 2006; 43(2): 97 - 117.
[Abstract] [Full Text] [PDF]

Home page
 Hum ReprodHome page
J. C. Havelock, W. E. Rainey, K. D. Bradshaw, and B. R. Carr
The post-menopausal ovary displays a unique pattern of steroidogenic enzyme expression
Hum. Reprod., January 1, 2006; 21(1): 309 - 317.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. Bielinska, E. Genova, I. Boime, H. Parviainen, S. Kiiveri, J. Leppaluoto, N. Rahman, M. Heikinheimo, and D. B. Wilson
Gonadotropin-Induced Adrenocortical Neoplasia in NU/J Nude Mice
Endocrinology, September 1, 2005; 146(9): 3975 - 3984.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
A. Bachelot, G. Meduri, N. Massin, M. Misrahi, F. Kuttenn, and P. Touraine
Ovarian Steroidogenesis and Serum Androgen Levels in Patients with Premature Ovarian Failure
J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2391 - 2396.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
V. L. Nelson-DeGrave, J. K. Wickenheisser, J. E. Cockrell, J. R. Wood, R. S. Legro, J. F. Strauss III, and J. M. McAllister
Valproate Potentiates Androgen Biosynthesis in Human Ovarian Theca Cells
Endocrinology, February 1, 2004; 145(2): 799 - 808.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jabara, S.
Right arrow Articles by Strauss, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jabara, S.