| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Article |
Division of Endocrinology, Metabolism, and Molecular Medicine, Northwestern University, The Feinberg School of Medicine (G.O., J.W., J.L.J.), Chicago, Illinois 60611-3008; Institute of Endocrine Sciences, Ospedale Maggiore Istituto Di Ricovero e Cura a Carattere Scientifico (IRCCS) and Istituto Auxologico Italiano IRCCS (G.M., L.P., A.S., P.B.-P.), 20122 Milan, Italy; and Center for Human Growth and Maturation, Department of Medicine and Institute of Child Health, University College London (J.C.A.), London, United Kingdom WC1N 1EH
Address all correspondence and requests for reprints to: J. Larry Jameson, M.D., Ph.D., Department of Medicine, Northwestern University, The Feinberg School of Medicine, Galter Pavilion, Suite 3-150, 251 East Huron Street, Chicago, Illinois 60611-2908. E-mail: ljameson{at}northwestern.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mutations or deletions of DAX1 cause X-linked AHC (AHC OMIM, 300200) (1). AHC is an inherited disorder of adrenal gland development, characterized by lack of the permanent zone of the adrenal cortex. Boys with this condition usually present with severe primary adrenal failure in infancy or childhood. Hypogonadotropic hypogonadism becomes apparent at puberty, and infertility results from gonadotropin deficiency in combination with a primary defect in spermatogenesis (5, 6). Over 80 different mutations in DAX1 have been described (7), most of which are nonsense or frameshift mutations that cause premature truncation of the protein. Deletion of as few as the last nine amino acids of DAX1, which constitute a putative activation function-2 (AF2) domain, is associated with a severe clinical phenotype (8).
Recently, an adult-onset form of AHC has been described in two patients who have missense mutations in the putative LBD of DAX1 (9, 10). These mutations (I439S, Y380D) were shown to have intermediate levels of repressor activity in transient gene expression studies, consistent with the mild phenotype of the affected individuals. Other variant phenotypes include isolated hypogonadotropic hypogonadism in a female homozygous for a DAX1 mutation through gene conversion and extreme pubertal delay in heterozygous female carriers (6, 11). Here we report a novel mechanism of mild AHC; namely, reduced production of a shorter DAX1 isoform resulting from alternate translation downstream to an amino-terminal stop codon. Our observations provide a rare example of the phenotypic rescue of an inherited disease by the circumvention of an otherwise severe mutation at the level of translation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
After obtaining written consent, genomic DNA was extracted from peripheral blood leukocytes using standard procedures. Both exons of DAX1 were amplified by PCR using specific oligonucleotide primer pairs and conditions described previously (12). Direct sequencing of PCR products was performed using a Taq Big Dye Terminator Sequencing Kit and ABI 3100 automated sequencer (PE Applied Biosystems, Foster City, CA).
Construction of human DAX1 expression vectors
DAX1 expression vectors (pCMX) containing the Q37X, W39X, F448X, M83K, and Q37X/M83K mutations were created by overlapping PCR using methods described previously (9, 13). Expression vectors containing cDNA for wild-type (WT) DAX1, the naturally occurring Y399X nonsense mutant (13), and an artificial F448X mutant were used as positive and negative controls for both DAX1 function and in vitro translation.
The construction of the amino-terminally deleted expression vectors lacking the first 40, 80, and 85 amino acids was made by insertion of the PCR-generated fragments (see below) after digestion with EcoRI and SplI(d40), and EcoRI and BspEI (d80, d85), respectively.
The following primer pairs were used to amplify the three fragments, respectively: 1) forward, 5'-GATCGAATTCTGTTCGTGCGGCGATGAG-3'; and reverse, 5'-CCTCTGCGCGAAG TAGGAGC-3'; 2) forward, 5'-GATCGAATTCTACAGCATGCTGACG AGCG-3'; and reverse, 5'-G GACGCCCAGCAGTTGCGCA-3'; and 3) forward, 5'-G ATCGAATTCAGCGCAAAGCAAACG TAC-3'; and reverse, 5'-GGA CGCCCAGCAGTTGCGCA-3'.
To allow antibody-mediated detection of recombinant DAX1 proteins, DAX1 cDNAs for WT and Q37X were cloned into the pcDNA 6/V5-HisA expression vector (Invitrogen, Carlsbad, CA). Briefly, cDNAs were amplified using primers that introduce NheI and EcoRI sites (forward, 5'-GATCGCTAGCCAGTGGGCAGAAC TGGGCTAC-3'; reverse, 5'-GATCGAATTCTATC TTTGTACAGAGCATTTC-3'), and PCR-generated fragments were cloned into the expression vector after digestion with the corresponding endonucleases.
The presence of the desired mutations/deletions and the integrity of the constructs were confirmed by direct sequencing before studies of protein expression and function.
In vitro translation of WT and mutant DAX1
WT and mutant DAX1 cDNAs were in vitro transcribed and translated in the presence of [35S]methionine using a TNT-coupled reticulocyte lysate system (Promega Corp., Madison, WI). A total of 250 ng of each dsDNA template were incubated at 30 C for 90 min in a reaction mixture of 12.5 µl. Denatured protein products were resolved with SDS-PAGE and detected by autoradiography after overnight exposure.
Western blotting
Human embryonic kidney tsa201 cells were transfected with 10 µg pcDNA6/V5-HisA DAX1 WT or Q37X. Equivalent amounts of protein lysates from transfections were resolved with SDS-PAGE and transferred to polyvinylidene difluoride membranes using standard methods. Blots were blocked in Tris-buffered saline containing 0.1% Tween 20 and 5% skim milk powder; incubations with antibodies were performed in the same buffer but without the skim milk powder. Recombinant DAX1 was probed with a 1:5,000 dilution of the primary antibody toward the V5 epitope and a 1:10,000 dilution of the secondary antimouse antibody. Reactive bands were detected using a chemiluminescence kit (NEN Life Science Products, Boston, MA) with Kodak MS x-ray film (Rochester, NY).
Functional analysis of WT and mutant DAX1
Transient gene expression studies were performed using human embryonic kidney tsa201 cells grown in DMEM supplemented with 10% fetal bovine serum and 1% streptomycin/penicillin in a 5% CO2 atmosphere at 37 C. A luciferase reporter construct (500 ng) containing the native rat LHß promoter (-154 to +5) was cotransfected with expression vectors containing full-length human SF1 (NR5A1; 20 ng), full-length rat early growth response-1 (Egr1; 20 ng), and full-length human WT or mutant DAX1 (50 ng), as described previously (10, 14). Luciferase assays were performed 48 h later. The results of triplicate transfections are expressed as the mean ± SEM.
Quantitation of DAX1 mRNA
DAX1 mRNA levels were measured by RT-PCR using real-time fluorescent detection. Enzymes were purchased fromPE Applied Biosystems, and assays were carried out according to the manufacturer’s protocol. Detection was performed on an ABI 7700 sequence detector. Sequences were: 5' primer, CTGCAGCACCATTTGGCAC; 3' primer, GGT ACTGATGTTCAGACTCCAGCAT; probe, FAM-CCTCCCAGGTCCAAGCCATCAAGTG-BlackHoleQuench (Quiagen Operon, Alameda, CA). To permit quantitation of copy number, a 259-bp fragment encompassing the RT-PCR amplicon was subcloned into the pGEM-3z plasmid and transcribed using T7 RNA polymerase. A linear dilution of the transcribed RNA was included in each assay as a standard curve.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A 20-yr-old male presented with a history of fatigue, nausea, and hyperpigmentation. Clinical laboratory investigations revealed hypocortisolemia (25 nmol/liter; normal range, 140–700), hypoaldosteronism, and elevated ACTH (226 pg/ml; normal, 10–60), consistent with primary adrenal failure. He was hypogonadal (4-ml testes bilaterally) and had subnormal testosterone (7.5 nmol/liter; normal, 10–35), normal LH (4.8 IU/liter; normal, 1–5), and elevated FSH (20 IU/liter; normal, 1–5) with low inhibin B levels (43.5 pg/ml; normal, 100–400). The Sertoli cell aromatase bioassay, which evaluates the FSH-dependent aromatase activity (conversion of androgen substrate to estradiol) in cultured Sertoli cells from 7- to 10-d-old rats, revealed a normal bioactive/immunoreactive ratio (0.49; normal, 0.3–1.5), indicating the presence of biologically active FSH in the patient’s serum. Azoospermia was found on semen analysis and did not improve after 6 months of treatment with exogenous gonadotropins. Testicular biopsy revealed disorganization of the normal seminiferous tubular structure, and there was moderate Leydig cell hyperplasia (Fig. 1
), confirming an intrinsic defect in spermatogenesis similar to that found in Ahch (also known as Dax1) knockout mice (15, 16). There was no family history of affected males. The patient’s mother was not available for genetic testing.
|
Direct DNA sequencing revealed a novel nonsense mutation (Q37X, CAG
TAG) in the amino-terminal region of DAX1 (Fig. 2A), which is predicted to result in a severely truncated protein devoid of repressor activity. However, consistent with the mild clinical phenotype, transient gene expression studies unexpectedly showed that this mutation causes only partial loss of DAX1 function (Fig. 2B). Similar results were obtained after the introduction of a W39X mutation into DAX1, a change reported recently in a patient with transient neonatal hypoaldosteronism due to AHC who did not develop significant adrenal dysfunction until adolescence (17).
|
). This 43-kDa band is also faintly visible in the WT lane, suggesting that this protein may be normally expressed as a minor protein variant.
The translation of this smaller protein product in the presence of the Q37X mutation was confirmed by Western blot analysis (Fig. 3A). Levels of mutant protein were lower than WT levels in the experiments. This observation appears to reflect a lower translation efficiency from the alternate start site, as mRNA levels were not different for the two constructs (Fig. 3B).
|
) (19). Serial amino-terminal deletions of DAX1 were made to investigate the putative role of M83 in translation initiation. A loss of function occurred with progressive deletion from codon 80 to codon 85 (Fig. 4B). Further, introduction of an M83K missense mutation (ATGAAG) at the putative translation start site did not affect WT DAX1 repressor activity, but abolished synthesis of the 43-kDa product. As expected, introduction of this M83K missense mutation into the background of the Q37X mutant sequence impaired DAX1 function and prevented translation of the shorter isoform (Fig. 4C). These findings suggest that methionine 83 serves as an alternative internal translation initiation codon.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The amino-terminus of DAX1 is unusual among nuclear receptors because it consists of a repeat domain structure containing three LXXLL-like motifs implicated in protein-protein interactions instead of a characteristic zinc finger DNA-binding domain. The alternatively translated Q37X mutant DAX1 predicted for this patient would lack 82 amino acids at the N terminus, thereby disrupting the first two LXXLL-like motifs. The partial loss of function observed in this amino-terminally truncated protein and the mild phenotype of the patient suggest that the first 82 amino acids are partly dispensable, and that conservation of one motif is sufficient for residual DAX1 function.
As noted previously, the 43-kDa band is also faintly visible when the WT protein is translated, suggesting that the ribosomes can bypass the optimal M1 site and initiate translation at the downstream M83 site. However, these in vitro experiments do not allow us to determine whether translation initiation at this position occurs at low levels in normal subjects or whether this alternate site is preferentially used in the presence of an upstream premature stop codon.
The levels of the alternately translated Q37X and W39X isoforms are less than that of the WT protein. There are at least three possible mechanisms for this: 1) although Kozak sequence flanking the ATG at position 83 suggests that it can be used as an initiator methionine (18), translation from internal methionines may be less efficient; 2) eukaryotic cells employ proofreading systems to identify and degrade mRNAs that harbor a premature stop codon or lack a termination codon (i.e. nonsense-mediated mRNA decay and nonstop mRNA decay, respectively) (20, 21). We did not observe such a decrease in transcript levels in transiently transfected cells, but interpret this finding with caution because mRNA stability may differ in vivo; or 3) the truncated DAX1 protein itself may be unstable.
In humans, milder phenotypes of inherited disorders can arise by various mechanisms. For example, exon skipping has been reported as a mechanism to restore an open reading frame in cases in which an mRNA transcript otherwise contains nonsense or frameshift mutations [Becker muscular dystrophy (OMIM 310200), etc.] (22, 23, 24). Recently, alternative translation using an open reading frame generated by a 5-bp deletion in NBS1 has been suggested to produce a protein that diminishes the severity of the Nijmegen breakage syndrome (OMIM 602667) phenotype in humans (25). This finding provides an explanation for why Nbs1-null mice are not viable, but humans who are homozygous for the 657del5 allele survive, albeit with a predisposition to develop cancer later in life. Of note, an unexpectedly mild (and late-onset) variant of peroxisome biogenesis disorder (OMIM 601539) was identified in a patient compound heterozygous for two seemingly severe mutations in the PEX12 gene. Molecular studies suggest that the transcript of the allele harboring a 2-bp deletion in codon 9 allows translation of a shorter protein from a downstream in-frame methionine (26). It appears that internal ribosome entry is the mechanism underlying this mild phenotype. Finally, although alternative protein isoforms resulting from different translation start sites are recognized to have different biological roles (e.g. glucocorticoid and progesterone receptor A and B isoforms) (27, 28, 29), the importance of these isoforms in human disease has yet to be defined.
There are other rare instances where amino-terminally truncated proteins are generated by downstream initiation after premature termination in the extreme amino terminus. However, in all of these cases the amino-truncated protein does not possess sufficient function to reduce the severity of the clinical phenotype (30, 31, 32). DAX1 is different from these other proteins because it contains a repeat motif structure in the amino terminus with presumed functional redundancy among the motifs. In contrast, loss of the carboxyl terminus of DAX1 (including the AF2 domain) produces a severe clinical phenotype, whereas partial or less severe disease phenotypes have been reported when a premature stop codon leads to a carboxyl truncation of other proteins (33). Obviously, the functional effects of these truncations in various proteins depend on whether deletion of the carboxyl terminus affects domains that are important for protein stability or function. Finally, reduced translational efficiency due to point mutations that alter the consensus context of the authentic ATG initiator represents another mechanism underlying less severe disease phenotypes (34).
The data presented here suggest that internal in-frame translation of a shorter DAX1 protein partially rescues the clinical phenotype of a patient with a nonsense mutation in the extreme amino terminus of DAX1 and delays the onset of adrenal dysfunction. Interestingly, except for the Q37X and W39X variants, other naturally occurring nonsense or frameshift mutations that cause a premature termination codon 5' to the putative alternative start site (codon 83) are associated with the classical AHC phenotype (35, 36, 37). In one of these cases (35), it is possible that the relative proximity of the nonsense mutation (codon 81) interferes with recognition of the juxtaposed alternate start site by ribosomes. Similarly, deletion or insertion of nucleotides (36, 37) may disrupt the sequence required for internal ribosomal entry, thereby impairing alternate translation start.
Of note, all missense mutations in DAX1 reported to date are located within the putative carboxyl-terminal LBD (13). Functional redundancy may exist within the amino-terminal repeat motif structure, which varies in number in different species (19). The presence of at least one repeat in the translated protein appears to be sufficient to preserve partial DAX1 function, particularly in view of the fact that the amount of expressed protein is likely to be reduced.
Here, we show that translation from an internal in-frame start site downstream of a nonsense mutation can reduce the clinical severity of AHC. On the other hand, in the case of DAX1, gene dosage appears to play a critical role in protein function (38). Thus, it is possible that the clinical features reflect reduced expression from a hypomorphic allele in addition to effects on the protein itself. Our findings also demonstrate that residual DAX1 function is sufficient to delay the onset of overt adrenal failure, but is not capable of supporting normal testis development and function.
One might predict from this observation with DAX1 that the physiological impact of polymorphic variants or mutations in other genes might also be modified when functional protein products can be produced from alternative translation initiation sites.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
G.O. and G.M. contributed equally to this work.
Abbreviations: AF2, Activation function-2; AHC, adrenal hypoplasia congenita; LBD, ligand-binding domain; SF1, steroidogenic factor-1; WT, wild type.
Received July 5, 2002.
Accepted October 3, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  A. A. Verrijn Stuart, G. Ozisik, M. A. de Vroede, J. C. Giltay, R. J. Sinke, T. J. Peterson, R. M. Harris, J. Weiss, and J. L. Jameson An Amino-Terminal DAX1 (NROB1) Missense Mutation Associated with Isolated Mineralocorticoid Deficiency J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 755 - 761. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Balsamo, A. Cicognani, M. Gennari, W. G Sippell, S. Menabo, F. Baronio, and F. G Riepe Functional characterization of naturally occurring NR3C2 gene mutations in Italian patients suffering from pseudohypoaldosteronism type 1 Eur. J. Endocrinol., February 1, 2007; 156(2): 249 - 256. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Lin, W.-X. Gu, G. Ozisik, W. S. To, C. J. Owen, J. L. Jameson, and J. C. Achermann Analysis of DAX1 (NR0B1) and Steroidogenic Factor-1 (NR5A1) in Children and Adults with Primary Adrenal Failure: Ten Years' Experience J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3048 - 3054. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Mantovani, E. De Menis, G. Borretta, G. Radetti, S. Bondioni, A. Spada, L. Persani, and P. Beck-Peccoz DAX1 and X-linked adrenal hypoplasia congenita: clinical and molecular analysis in five patients. Eur. J. Endocrinol., May 1, 2006; 154(5): 685 - 689. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Moumne, M. Fellous, and R. A. Veitia Deletions in the polyAlanine-containing transcription factor FOXL2 lead to intranuclear aggregation Hum. Mol. Genet., December 1, 2005; 14(23): 3557 - 3564. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Y. Park, J. J. Meeks, G. Raverot, L. E. Pfaff, J. Weiss, G. D. Hammer, and J. L. Jameson Nuclear receptors Sf1 and Dax1 function cooperatively to mediate somatic cell differentiation during testis development Development, May 15, 2005; 132(10): 2415 - 2423. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Hasegawa, M. Fukami, N. Sato, N. Katsumata, G. Sasaki, K. Fukutani, K.-I. Morohashi, and T. Ogata Testicular Dysgenesis without Adrenal Insufficiency in a 46,XY Patient with a Heterozygous Inactive Mutation of Steroidogenic Factor-1 J. Clin. Endocrinol. Metab., December 1, 2004; 89(12): 5930 - 5935. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M T Howard, N Malik, C B Anderson, J L A Voskuil, J F Atkins, and R J Gibbons Attenuation of an amino-terminal premature stop codon mutation in the ATRX gene by an alternative mode of translational initiation J. Med. Genet., December 1, 2004; 41(12): 951 - 956. [Full Text] [PDF]
|
|
|
|
 |
|
 E. Lalli and P. Sassone-Corsi DAX-1, an Unusual Orphan Receptor at the Crossroads of Steroidogenic Function and Sexual Differentiation Mol. Endocrinol., August 1, 2003; 17(8): 1445 - 1453. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
promoters (data not shown). WT and mutant DAX1 cDNAs were in vitro transcribed and translated using a reticulocyte lysate system in the presence of [35S]methionine. As expected, WT DAX1 cDNA produced a 51-kDa protein. The Q37X cDNA as well as W39X generated a shorter 43-kDa product, which was weakly detectable in the WT lane.
