This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Horikawa, Y. Articles by Takeda, J. Search for Related Content PubMed PubMed Citation Articles by Horikawa, Y. Articles by Takeda, J.

Genetic Variations in Calpain-10 Gene Are Not a Major Factor in the Occurrence of Type 2 Diabetes in Japanese

Laboratory of Molecular Genetics (Y.H., L.Y., J.T.), Department of Cell Biology, Institute for Molecular and Cellular Regulation, Gunma University, Gunma 371-8512; Department of Internal Medicine (N.O., S.I., K.F., M.M., M.I.), Fujita Health University School of Medicine, Aichi 470-1192; and Department of Metabolism and Clinical Nutrition (L.Y., Y.S.), Graduate School of Medicine, Kyoto University, Kyoto 606-8501, Japan

Address all correspondence and requests for reprints to: Yukio Horikawa, M.D., Institute for Molecular and Cellular Regulation, Gunma University, 3-39-15 Showa-machi, Maebashi, Gunma 371-8512, Japan. E-mail: yhorikaw{at}showa.gunma-u.ac.jp.

	Abstract

Top Abstract Introduction Subjects and Methods Results Discussion References

 
The 112/121 haplotype combination defined by the UCSNP-43, -19, and -63 alleles in the calpain-10 gene is associated with type 2 diabetes in Mexican Americans. To determine whether this genetic variation constitutes risk of type 2 diabetes in Japanese, we investigated its frequency in 177 patients with type 2 diabetes and 172 controls. Though this variation occurs in Japanese more frequently than in Mexican Americans, there is no significant difference in frequency between diabetic (29.9%) and control (31.9%) subjects. We also screened all exons and the putative promoter of the calpain-10 gene for mutations in 96 of the genotyped patients, resulting in the identification of 7 coding variants, including 3 missense mutations and 5 nucleotide alterations in the promoter. However, their frequencies all are similar in patients and controls, suggesting that these genetic variations are not a major factor in the occurrence of type 2 diabetes in Japanese, although they could yet be associated with various phenotypes of the disease.

	Introduction

Top Abstract Introduction Subjects and Methods Results Discussion References

 
TYPE 2 DIABETES MELLITUS is a consequence of the action and interaction of many genetic and nongenetic factors. It has been reported that genetic variation in the gene encoding calpain-10 (CAPN10) affects susceptibility to type 2 diabetes mellitus in Mexican Americans and at least two Northern European populations (1). Assignment to the 112/121 haplotype combination defined by the three polymorphic alleles designated UCSNP-43, -19, and -63 indicates 3-fold increased risk in Mexican Americans; allele 1 refers to the common allele and allele 2 to the rare allele for each single-nucleotide polymorphism (SNP). Significantly increased transmission of the less common C allele at UCSNP-44 in CAPN10 to affected offspring in parent-offspring trios has been found by the transmission disequilibrium test, and the 111/111 combination also was associated with increased risk of type 2 diabetes in whites of British/Irish ancestry (2). In addition, UCSNP-43 is associated with impaired insulin action in Pima Indians and other races, suggesting that the genetic variation in CAPN10 increases susceptibility to type 2 diabetes with insulin resistance (3, 4, 5). Recently, it has been reported that genetic variation in the CAPN10 gene influences blood glucose levels in nondiabetic British subjects, attributable partly to the effects of calpain 10 on early insulin secretory response (6).

Type 2 diabetes in Japanese is characterized primarily by pancreatic ß-cell dysfunction rather than by insulin resistance (7), suggesting heterogeneity of genetic susceptibility among populations. In the present study, we compared the occurrence of the CAPN10 variation associated with type 2 diabetes in Mexican Americans and other populations with that in Japanese.

	Subjects and Methods

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Subjects

A total of 177 patients with type 2 diabetes (males/females, 114/63; age, 62.0 ± 11.0 yr; age at diagnosis, 49.8 ± 11.4 yr; postprandial glucose, 167.5 ± 68.9 mg/dl; hemoglobin A_1C (HbA_1C), 6.7 ± 1.0%; body mass index (BMI), 23.9 ± 3.3 kg/m²; therapy: diet for 46 patients, oral hypoglycemic agent for 70, and insulin for 61) and a total of 172 nondiabetic subjects (males/females, 82/90; age, 68.0 ± 5.7 yr; HbA_1C, 5.0 ± 0.4%; BMI, 22.8 ± 2.9 kg/m²) were examined. The patients were diagnosed with type 2 diabetes, by medical records or by 75-g oral glucose tolerance test according to the criteria of the Japan Diabetes Society (8). The control subjects were recruited on the following criteria: 60 or more years of age, no past history of diagnosis of diabetes, HbA_1c less than 5.6%, and no diabetes in family members or third-degree relatives. All exons and the putative promoter of CAPN10 were screened with 96 of the 177 patients (age at diagnosis, 51.3 ± 11.2 yr; HbA_1C, 6.6 ± 0.8%; BMI, 23.5 ± 3.1 kg/m²). Genetic analysis of human subjects was approved by the ethics committee. Appropriate informed consent was obtained from all participants.

Haplotype analysis of CAPN10

We genotyped four polymorphisms in CAPN10: UCSNP-44 (g.4841T/C), UCSNP-43 (g.4852G/A), UCSNP-19 (g.7920in/del32bp), and UCSNP-63 (g.16378C/T) for haplotype analyses, and we estimated the odds ratio (OR) of the candidate haplotypes.

UCSNP-44 and -43. The fragment was amplified with primers: forward, 5'-GCTGGCTGGTGACATCAGTG-3'; reverse, 5'-TCAGGTTCCATCTTTCTGCCAG-3'. PCR was carried out using Taq DNA polymerase, 5% dimethylsulfoxide, and 1 mM MgCl₂, with denaturation at 94 C for 5 min, followed by 35 cycles of denaturation at 94 C for 30 sec, annealing at 60 C for 30 sec, and extension at 72 C for 30 sec, with final extension at 72 C for 10 min and sequencing with internal primer 5'-GTGAGCCTCTGGCATTGAGC-3'.

UCSNP-19. The fragment was amplified with primers: forward, 5'-GTTTGGTTCTCTTCAGCGTGGAG-3'; reverse, 5'-CATGAACCCTGGCAGGGTCTAAG-3' (product size was 155 or 187 bp). PCR was carried out under the conditions described above. Electrophoresis was performed with 3% agarose gel.

UCSNP-63. The fragment was amplified with primers: forward, 5'-GAACCAGTGCTTGGCAGCTCAC-3'; reverse, 5'-GCAGTGCGTGGTGCCTGAAGG-3'. PCR was carried out using eLONGase DNA polymerase (Life Technologies, Inc., Gaithersburg, MD), 5% dimethylsulfoxide, and 1.8 mM MgCl₂, with denaturation at 94 C for 1 min, followed by 35 cycles of denaturation at 94 C for 30 sec, annealing at 58 C for 30 sec and extension at 68 C for 1 min, and final extension at 68 C for 10 min, and the products were sequenced with the reverse primer. The sequencing was carried out by automatic DNA sequencers (models 377 and 3700; Applied Biosystems, Foster City, CA).

Mutation screening of CAPN10

Exons 1–15 of CAPN10 (GenBank accession no. AF158748), their flanking introns, and an about 1-kb upstream region of the putative exon 1, including a CpG island (g.-706508) detected by RUMMAGE Software (http://gen100.imb-jena.de/rummage/) were sequenced. In the previous study, only exons for calpain-10a, the major isoform of calpain-10, were sequenced, but there are eight different isoforms for calpain-10 (1, 2). In this study, we sequenced all of the exons and the putative promoter of CAPN10 by direct sequencing of the amplified PCR products, using specific primer pairs and an ABI PRISM Big Dye Terminator Cycle Sequencing FS ready Reaction Kit (Applied Biosystems). Primer pairs for upstream of the putative exons 1, 8, 14, and 15 are as follows: forward, CAGCTTCAATGTGACCATCC, reverse, CCCAGCCCTCCAAGCCCGAG (product size 1,251 bp); forward, GGATATGCCGGCTGCTCGCTCA, reverse, GGTGGACCTCCCGGTCGTATGC (product size, 531 bp); forward, GGTTCTTAGTTGGCAGCTTCCT, reverse, TTCAGGAGGGAATTGCATGAC (product size 363 bp); and forward, TCCTCAGGCCAGCTGCCCATTG, reverse, TTCGGGCTCTGCCAAACTGGGTC (product size, 401 bp), respectively. The primers for PCR and the sequencing of the other exons of CAPN10 have been previously described (2). The sequencing reactions were analyzed by the automatic DNA sequencers.

Glucose-clamp study

Twenty-eight subjects, with and without the 112/121 combination, were examined by glucose clamp study. Insulin and C-peptide were measured using an ELISA kit (DAINABOT, Tokyo, Japan) and an RIA kit (Shionogi, Osaka, Japan), respectively. The hyperglycemic-euglycemic clamp study was performed as follows. The hyperglycemic clamp was first performed with the baseline and the target glucose levels at 118.68 ± 23.10 (mg/dl) and 246.04 ± 9.95 (mg/dl), respectively, for 60 min, to determine the capacity of early glucose-induced insulin secretion. After lowering the plasma glucose level to the clamped level, by insulin infusion (5 mU/kg·min), the euglycemic-hyperinsulinemic clamp was then performed for an additional 90 min with the mean glucose level and the insulin infusion rate at 94.54 ± 6.45 (mg/dl) and 1.12 mU/kg·min, respectively. Insulin and free fatty acid (FFA) were measured at 0, 15, 30, and 60 min and at the end of the clamp, and glucose infusion rate (M-value) at the end (9).

Statistical analyses

The haplotype was inferred by the expectation-maximization method with Arlequin Software (http://anthro.unige.ch/arlequin). Statistical differences in allelic frequencies between type 2 diabetes and control groups were assessed by ² test. The OR and 95% confidence interval were calculated by logistic regression analysis. All clinical data are expressed as means ± SD. Comparison of variables between groups of genotypes was performed using the two-tailed Student’s t test and/or the Mann-Whitney nonparametric test. The effects of the haplotype combinations on the clinical parameters during glucose clamp study were estimated by analysis of covariance using genotype as a factor, with age, sex, and BMI as covariates. Statistical analysis was performed using StatView 5.0 software (SAS Institute, Inc., Cary, NC).

	Results

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Haplotype analysis of CAPN10

We first genotyped the four polymorphisms indicating the highest risk for type 2 diabetes in the previous study of Mexican Americans, UCSNP-44, -43, -19, and -63, in Japanese type 2 diabetic patients and controls. The allelic frequencies of these polymorphisms all were similar in patients and controls: UCSNP-43, ² = 0.040, P = 0.84; UCSNP-19, ² = 0.23, P = 0.63; UCSNP-63, ² = 0.34, P = 0.56; and UCSNP-44, ² = 2.32, P = 0.13 (Table 1). We then evaluated the frequency of the haplotype combinations comprising these alleles. All the major haplotypes previously identified (111, 121, 112, and 221) are also found in Japanese; the frequencies are similar in patients and controls, however (Table 2). Because the major at-risk 112/121 haplotype combination appears somewhat more frequently in Japanese patients (29.9%) than in Mexican American patients (19.4%), we compared the two groups with and without 112/121, but there were no significant differences in age, BMI, fasting and postprandial glucose, or HbA_1C (data not shown). In addition, none of the other haplotype combinations suggested increased risk of type 2 diabetes in Japanese (Table 3). However, the 111/111 and 111/221 combinations were found only in six (Fisher’s P = 0.03, ² = 5.93) and two (Fisher’s P = 0.50, ² = 1.96) of the diabetic patients, respectively.

We examined all exons and the putative promoter of CAPN10 in 96 of the genotyped patients, and we identified 5 nucleotide alterations in the putative promoter. We examined these SNPs in relation to the known cis elements by TFSEARCH (http://www.cbrc.jp/research/db/TFSEARCH.html), but none of them were located in the consensus recognition sequences for nuclear factors. Seven coding variants, including 3 missense mutations [P200T, R202G, and T504A (Table 4)] were also identified, but the frequencies are similar in patients and controls, except for P200T (Fisher’s P = 0.028, ² = 5.4).

The 112/121 haplotype combination might well otherwise influence physiological functions such as insulin secretion or action. Of the patients examined, 2 groups of 12 and 16 with and without the combination, respectively, in which age, gender, BMI, HbA_1c, and duration of the disease were similar, were appropriate for glucose clamp study. Although no significant difference was observed in the fasting, 15-, and 30-min serum insulin and FFA levels, M-value, or insulin sensitivity index between the 2 groups (data not shown), we found higher levels of glucose-induced serum insulin at 60 min under hyperglycemic clamp and serum FFA at the end point under euglycemic clamp (168.90 ± 132.28 vs. 81.60 ± 49.93 pM, P = 0.022; 0.093 ± 0.034 vs. 0.054 ± 0.015 mM, P = 0.0085, respectively) in patients with the 112/121 combination. These differences, P = 0.0259 and P = 0.0150, both were statistically significant by Mann-Whitney nonparametric analysis, respectively. After adjusting the insulin and FFA levels for parameters, including age and BMI, by analysis of covariance, there still were differences of P = 0.044 and P = 0.016, respectively. A higher level of insulin area under the curve (insulin-AUC_0–60) also was found (30583.00 ± 28796.39 vs. 14602.15 ± 9949.97 pmol/liter·min; P = 0.039) by Mann-Whitney nonparametric analysis, though it did not reach statistical significance by the two-tailed Student’s t test.

	Discussion

Top Abstract Introduction Subjects and Methods Results Discussion References

 
It has been demonstrated that the haplotypes comprising the UCSNP-43, -19, and -63 polymorphisms define risk of type 2 diabetes better than the individual SNPs do; for example, the haplotype combinations 112/121 and 112/221 are associated with increased and reduced risks, respectively, in Mexican Americans (1). We evaluated the frequency of the combinations comprising these alleles in this study, and we showed that the 112/121 haplotype combination does not represent increased risk of type 2 diabetes in the Japanese population (Table 3).

A similar study of Samoans also revealed no significant association between the 112/121 haplotype combination and type 2 diabetes. However, the haplotype combinations with the lowest and the highest risks in Mexican Americans also were the lowest and the second highest risk combinations in Samoans, respectively (10). Studies of Utah Caucasians revealed that the 111/221 genotype showed the highest increased risk of type 2 diabetes in this population (4). We evaluated the other haplotype combinations, but none reflected significantly increased risk of type 2 diabetes in Japanese, although the 112/221 genotype, related to reduced risk in Mexican Americans, reflected some tendency to increased susceptibility for type 2 diabetes in Japanese. These apparently contradictory results may be attributable to heterogeneity of the genetic background of type 2 diabetes among populations.

We also identified seven coding variants, including three missense mutations. T504A is located in domain T of calpain-10, a region of unknown function (11); Thr-504 is Ser in the corresponding portion of mouse and rat calpain-10. It has been shown previously that UCSNP-44 is in nearly perfect linkage disequilibrium with the T504A mutation in British subjects (2). In fact, T504A is in statistically significant linkage disequilibrium with the 111 haplotype in Japanese (Horikawa, Y., unpublished data), and the 111/111 combination was found only in the diabetic patients in this study. Accordingly, we reestimated the frequency of the haplotype combinations, including UCSNP-44 and the ORs in Japanese, but found no difference in risk between the two groups (data not shown). The P200T and R202G mutations are located in domain II, a region of cysteine protease activity. The Pro-200 residue is conserved among human, mouse, and rat, whereas Arg-202 is Gly in mouse and rat calpain-10. The relevance of these amino acid changes in the pathogenesis of type 2 diabetes remains to be clarified. Functional studies are required to elucidate the roles of T504A, R202G, and P200T in calpain-10 activity. Considering these findings together, the genetic variations in CAPN10 are not a major contributor in the development of type 2 diabetes in Japanese.

A biological effect of the calpain-10 variants has been demonstrated in Pima Indians and Utah Caucasians, despite neither positive linkage nor association with the occurrence of type 2 diabetes (3, 4). The influence of such genetic variations on the phenotype of the disease could well be difficult to detect in some conditions by only genetic studies rather than clinical metabolic studies. Accordingly, we performed a glucose clamp study on the patients. The mechanism of FFA-induced insulin resistance in type 2 diabetes has been described previously (12, 13). It also has been reported that the degree of suppression of the plasma FFA concentration by insulin differs in diabetic patients and normal subjects (14). We found higher levels of glucose-induced insulin secretion at 60 min, insulin-AUC under hyperglycemic clamp, and FFA at the end point under euglycemic clamp, all of which might be attributable to insufficient suppression by insulin in patients with the 112/121 combination. However, these results might not be conclusive because of the small number of patients examined. To determine the contribution of the variations in CAPN10 to the phenotypes of the disease in Japanese, further recruitment and characterization of patients with the various haplotype combinations is required. In addition, the epistatic effects from other loci, such as the putative gene on chromosome 15 that increases susceptibility to diabetes in conjunction with CAPN10 in Mexican Americans (15), must also be considered.

Although we found no association between these genetic variations in CAPN10 and the occurrence of type 2 diabetes in Japanese, they yet may be associated with various phenotypes of the disease.

	Acknowledgments

 

	Footnotes

 
This study was supported by Grants-in-Aid for Creative Scientific Research, for Scientific Research A-C, and for Scientific Research on Priority Areas C from the Japanese Ministry of Science, Education, Sports, Culture and Technology, Comprehensive Research on Aging and Health, and Research on Human Genome, Tissue Engineering and Food Biotechnology from the Japanese Ministry of Health, Labor and Welfare, the Yamanouchi Foundation for Research on Metabolic Disorders, the Uehara Memorial Foundation, Suzuken Memorial Foundation, and the Japan Diabetes Foundation.

Abbreviations: BMI, Body mass index; CAPN10, calpain-10 gene; FFA, free fatty acid; HbA_1C, hemoglobin A_1C; OR, odds ratio; SNP, single-nucleotide polymorphism.

Received May 31, 2002.

Accepted September 25, 2002.

	References

Top Abstract Introduction Subjects and Methods Results Discussion References

 

1. Horikawa Y, Oda N, Cox NJ, Li X, Orho-Melander M, Hara M, Hinokio Y, Lindner TH, Mashima H, Schwarz PEH, del Bosque-Plata L, Horikawa Y, Oda Y, Yoshiuchi I, Colilla S, Polonsky KS, Wei S, Concannon P, Iwasaki N, Schulze J, Baier LJ, Bogardus C, Groop L, Boerwinkle E, Hanis CL, Bell GI 2000 Genetic variation in the gene encoding calpain-10 is associated with type 2 diabetes mellitus. Nat Genet 26:163–175[CrossRef][Medline]
2. Evans JC, Frayling TM, Cassell PG, Saker PJ, Hitman GA, Walker M, Levy JC, O’Rahilly S, Subba Rao PV, Bennett AJ, Jones EC, Menzel S, Prestwich P, Simecek N, Wishart M, Dhillon R, Fletcher C, Millward A, Demaine A, Wilkin T, Horikawa Y, Cox NJ, Bell GI, Ellard S, McCarthy MI, Hattersley AT 2001 Association studies of the calpain-10 gene with type 2 diabetes mellitus in the United Kingdom. Am J Hum Genet 69:544–552[CrossRef][Medline]
3. Baier LJ, Permana PA, Yang X, Pratley RE, Hanson RL, Shen GQ, Mott D, Knowler WC, Cox NJ, Horikawa Y, Oda N, Bell GI, Bogardus C 2000 A calpain-10 gene polymorphism is associated with reduced muscle mRNA levels and insulin resistance. J Clin Invest 106:R69–R73
4. Elbein SC, Chu W, Ren Q, Hemphill C, Schay J, Cox NJ, Hanis CL, Hasstedt SJ 2002 Role of calpain-10 gene variants in familial type 2 diabetes in Caucasians. J Clin Endocrinol Metab 87:650–654[Abstract/Free Full Text]
5. Ehrmann DA, Schwarz PEH, Hara M, Tang Xu, Horikawa Y, Imperial J, Bell GI, Cox, NJ 2002 Relationship of calpain-10 genotype to phenotypic features of polycystic ovary syndrome. J Clin Endocrinol Metab 87:1669–1673[Abstract/Free Full Text]
6. Lynn S, Evans JC, White C, Frayling TM, Hattersley AT, Turnbull DM, Horikawa Y, Cox NJ, Bell GI, Walker M2002 Variation in the calpain-10 gene affects blood glucose levels in the British population. Diabetes 51:247–250
7. Kosaka K, Hagure R, Kuzuya T 1977 Insulin responses in equivocal and definite diabetes, with special reference to subjects who had mild glucose tolerance but later developed definite diabetes. Diabetes 26:944–952[Medline]
8. Kuzuya T, Nakagawa S, Satoh, J, Kanazawa Y, Iwamoto Y, Kobayashi M, Nanjo K, Sasaki A, Seino Y, Ito C, Shima K, Nonaka K, Kadowaki T 2002 Report of the committee of the Japan Diabetes Society on the classification and diagnostic criteria of diabetes mellitus. Diabetes Res Clin Pract 55:65–85[CrossRef][Medline]
9. DeFronzo RA, Iordan DT, Reubin A 1979 Glucose clamp technique: a method for quantifying insulin secretion and resistance. Am J Physiol 237:E214–E223
10. Tsai HJ, Sun G, Weeks DE, Kaushal R, Wolujewicz M, McGarvey ST, Tufa J, Viali S, Deka R 2001 Type 2 diabetes and three calpain-10 gene polymorphisms in Samoans: no evidence of association. Am J Hum Genet 69:1236–1244[CrossRef][Medline]
11. Saido TC, Sorimachi H, Suzuki K 1994 Calpain: new perspectives in molecular diversity and physiological-pathological involvement. FASEB J 8:814–822[Abstract]
12. Reaven GM, Hollenbeck C, Jeng CY, Wu MS, Chen Y-DI 1988 Measurement of plasma glucose, fatty acid, lactate, and insulin for 24 h in patients with NIDDM. Diabetes 37:1020–1024[Abstract]
13. Roden M, Price TB, Perseghin G, Petersen KF, Rothman DL, Cline GW, Shulman GI 1996 Mechanism of free fatty acid-induced insulin resistance in human. J Clin Invest 97:2859–2865[Medline]
14. Chen YD, Golay A, Swislocki AL, Reaven GM 1987 Resistance to insulin suppression of plasma free fatty acid concentrations and insulin stimulation of glucose uptake in non-insulin dependent diabetes mellitus. J Clin Endocrinol Metab 64:17–21[Abstract/Free Full Text]
15. Cox NJ, Frigge M, Nicolae DL, Concannon P, Hanis CL, Bell GI, Kong A 1999 Loci on chromosome 2 (NIDDM1) and 15 interact to increase susceptibility to diabetes in Mexican Americans. Nat Genet 21:213–215[CrossRef][Medline]

This article has been cited by other articles:

				E J Parra, C J Hoggart, C Bonilla, S Dios, J M Norris, J A Marshall, R F Hamman, R E Ferrell, P M McKeigue, and M D Shriver Relation of type 2 diabetes to individual admixture and candidate gene polymorphisms in the Hispanic American population of San Luis Valley, Colorado J. Med. Genet., November 1, 2004; 41(11): e116 - e116. [Full Text] [PDF]

				N. J. Cox, M. G. Hayes, C. A. Roe, T. Tsuchiya, and G. I. Bell Linkage of Calpain 10 to Type 2 Diabetes: The Biological Rationale Diabetes, February 1, 2004; 53(90001): S19 - 25. [Abstract] [Full Text]

This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Horikawa, Y. Articles by Takeda, J. Search for Related Content PubMed PubMed Citation Articles by Horikawa, Y. Articles by Takeda, J.