This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lim, P. O. Articles by Connell, J. M. C. Search for Related Content PubMed PubMed Citation Articles by Lim, P. O. Articles by Connell, J. M. C.

Variation at the Aldosterone Synthase (CYP11B2) Locus Contributes to Hypertension in Subjects with a Raised Aldosterone-to-Renin Ratio

Hypertension Research Centre (P.O.L., T.M.M.), Directorate of Biochemical Medicine (E.Do.), Department of Endocrinology (R.T.J.), Ninewells Hospital and Medical School, Dundee DD1 9SY, United Kingdom; Medical Research Council Blood Pressure Group (C.H., E.F., N.H.A., E.Da., R.F., J.M.C.C.), Western Infirmary, Glasgow, G11 6NT, United Kingdom; and Department of Cardiology (P.O.L.), Wales Heart Research Institute, University of Wales College of Medicine, Heath Park, Cardiff, CF14 4XN, United Kingdom

Abstract

The aldosterone-to-renin ratio (ARR) is a marker of aldosterone activity in hypertension. We examined the relationship of the ARR to the distribution of two biallelic polymorphisms at the CYP11B2 gene locus. One polymorphism affects a putative steroidogenic factor-1 binding site (-344 T/C) in the 5'-regulatory region, whereas the other marker reflects replacement of the intron-2 from CYP11B2 with that from the neighboring gene encoding 11ß-hydroxylase (CYP11B1; wild-type/conversion). We studied consecutive referrals to the Tayside hypertension clinic in 1998. Because the specificity of ARR (pmol/liter/ng/ml/h) for hyperaldosteronism increases with its threshold, ARRs of at least 750 and 1000 were used. A total of 375 patients were assessed; 86.9% had complete data. There were significant excesses of steroidogenic factor-1 (T) (ARR 750, 0.62 vs. 0.51, P = 0.014; ARR 1000, 0.63 vs. 0.51, P = 0.039) and intron-2 (conversion) (ARR 750, 0.49 vs. 0.41, P = 0.205; ARR 1000, 0.54 vs. 0.41, P = 0.029) alleles in patients with a raised ARR. The odds ratio for a raised ARR was 2.27 [95% confidence interval, 1.01, 5.09; P < 0.05] comparing patients with a homozygous haplotype for these alleles with those without any such alleles, and this risk increased with age. This study supports the notion that there is a genetic component that regulates aldosterone production and that hyperaldosteronism might develop over time in susceptible individuals.

THE ROLE OF the renin-angiotensin-aldosterone system in the pathogenesis of essential hypertension is still unclear. However, recent studies indicate that more than 10% of hypertensives in hypertension clinics (1) or primary care (2) have higher than normal ratios of aldosterone-to-renin (ARR) in plasma. Whether this suggests a high prevalence of primary aldosteronism among hypertensives is controversial (3, 4). Nonetheless, these patients often have poorly controlled blood pressure (BP) despite multiple drug therapy, and it has been suggested that they might respond better to aldosterone receptor blockade (5). Inappropriate aldosterone production for the prevailing renin level may be due to increased activity of aldosterone synthase (6), which is the key rate-limiting enzyme in the final steps of aldosterone biosynthesis. Recent reports suggest that variation at the gene (CYP11B2) that encodes this enzyme is associated with essential hypertension and may influence aldosterone secretion (7, 8, 9). This raises the possibility that a raised ARR might be an intermediate phenotypic expression of genetic variation at this locus. We selected an ARR value of at least 750 (pmol/liter per ng/ml/h) to define an abnormally raised ratio, having previously shown that more than 90% of hypertensives falling above this cut-off did not suppress plasma aldosterone with salt loading and fludrocortisone (1).

We studied the distribution of two linked biallelic polymorphic loci at the CYP11B2 gene in relation to ARR in hypertension. The first involves a putative binding site for the steroidogenic factor-1 (SF-1) in the 5' transcriptional regulatory region (-344 cytosine/thymidine; Ref. 10). The second involves intron-2 (I2) of the gene; in some individuals (conversion allele; I2C), this is converted to the I2 sequence found in the immediately adjacent and highly homologous gene (CYP11B1) that encodes 11ß-hydroxylase, the enzyme involved in the terminal step of cortisol biosynthesis (7, 11).

Patients and Methods

Patients

We studied unselected, consecutive patients referred to our specialist hypertension clinic for assessment. None of these patients was known to have primary aldosteronism. All had raised office BP readings (systolic BP 160 mm Hg and/or diastolic BP 90 mm Hg) confirmed over a period of at least 3 months before their referral by primary-care physicians. Hence, this study included a wide spectrum of hypertensives, including those with white coat hypertension. Antihypertensive medication was stopped for 7–10 d when possible to allow the influence of medication on endocrine function to be minimized. Importantly, none of our patients was on spironolactone treatment that could substantially affect the ARR. The study was approved by the Tayside Medical Ethics Committee.

Hormonal assays

Blood samples were taken for plasma renin activity (PRA; nanograms per milliliter per hour) and aldosterone (picomoles per liter) after the patients had been seated for 10 min. ARR was derived by dividing plasma aldosterone by PRA. We have previously demonstrated that such ambulant ARR of at least 750 is highly predictive of primary aldosteronism (1).

PRA was measured by the Biodata Renin MAIA (Serono Diagnostics Ltd., Woking, Surrey, UK) with an intra-assay coefficient of variation of less than 10% between 0.3 and 18 ng/ml·h and a least detectable concentration of 0.3 ng/ml·h. The interassay batch variation over 1 yr was 11% (QC mean values, 2.3 and 6.1 ng/ml·h).

Plasma aldosterone was measured by a solid-phase (coated tube) RIA technique, DPC Coat-a-Count assay (DPC, Llanberis, Caernarfon, Gwynedd, UK) with an intra-assay coefficient of variation of less than 10% between 200 and 3300 pmol/liter and a least detectable concentration of 70 pmol/liter. The interassay variation as calculated from QC pools run in each assay over 1 yr was 10% [quality control (QC) mean values, 400 and 1050 pmol/liter].

Genotyping

Blood for genotyping was taken into EDTA; DNA was extracted by a standard phenol-chloroform method and stored at -20 C until batch genotyping. The region of DNA containing the HaeIII/SF-1 polymorphism was amplified by PCR by use of conditions similar to those previously described (7). The primers used are as follows: SF-1 sense, 5'GTGTCAGGGCAGGGGGTA3'; SF-1 antisense, 5'AGGCGTGGGGTCTGGACT3'; wild-type (WT) I2 sense, 5'TGGAGAAAAGCCCTACCCTGT3'; WT I2 antisense, 5'AGGAACCTCTGCACGGCC3'; conversion sense, 5'CAGAAAATCCCTCCCCCCTA3'; and conversion antisense, 5'CAGAAAATCCCTCCCCCCTA3'. A PCR product of 228 bp was amplified. This was digested with HaeIII and subjected to electrophoresis in 3% MetaPhor agarose. The 228-bp amplicon contains two HaeIII restriction enzyme sites (GG CC). The presence of a C to T transition at position -344 (GG CT) removes one of these sites. After digestion, individuals homozygous for the transition (TT) produce two bands of 175 and 53 bp; individuals homozygous for the WT (CC) produce three bands of 104, 71, and 53 bp; and heterozygous individuals (TC) produce four bands. The I2 was genotyped by use of two separate PCRs, one that amplifies the normal gene (wild-type) and one that amplifies the conversion. The size of the amplicon in each reaction is approximately 418 bp.

Statistical analysis

Summary measures quoted for demographic characteristics are means and SD values. Comparisons of genotype distributions in different groups were made using ² tests, initially using an ARR threshold of 750. Because the specificity of ARR in identifying aldosterone excess increases with higher ARR thresholds (12, 13), we also used an ARR threshold of 1000 to examine the robustness of any significant findings. Tests for trends in proportions of individuals with high ARR were performed using Mann-Whitney U tests, allowing for the substantial number of tied ranks. Odds ratios and associated confidence intervals (CIs) were calculated in the standard way, with log transformations and a normal approximation being used for the CIs. A two-tailed P value of 0.05 was taken to signify statistical significance. All statistical analyses were performed using the S-Plus 2000 Professional statistical program (MathSoft Inc., Cambridge, MA).

Results

General characteristics

A total of 375 patients with ages ranging from 18–88 yr, who were referred to the Tayside hypertension clinic in 1998, were assessed. All but one patient was of Caucasian descent, and about two thirds were assessed without antihypertensive drug therapy. Of the total group, 86.9% (326 patients) had both ARR and genetic data, and 98.2% (320) of these subjects had complete genetic data (Table 1). Of the 326 subjects, 28% (91) and 17% (57) had an ARR of at least 750 and 1000, respectively. There were no significant relationships between ARR and drug therapy, or between ARR and the presence of cardiovascular, cerebrovascular, and peripheral vascular diseases, renal impairment, or diabetes. The prevalence of diabetes in patients with a raised ARR of at least 750 was 2.2% [vs. 3.0% (ARR < 750); P = 0.71].

Table 2 summarizes the CYP11B2 genotype distributions within the study population. As previously described, the SF-1 and I2 polymorphisms were in linkage disequilibrium, x₄² = 279.153 (P < 0.001), although individually each was in Hardy-Weinberg equilibrium. Table 3 summarizes the SF-1 and I2 distributions with respect to ARR. Using an ARR threshold of 750, patients with a raised ratio had a statistically significant excess of the T allele at the SF-1 site. This relationship persisted when a higher ARR threshold of 1000 was used. With regard to the I2 polymorphism, an excess of the conversion allele was only confirmed in patients with ARR greater than 1000, although a similar (but not significant) pattern of genotype distribution was observed with an ARR threshold of 750.

In view of the previous findings, we tested whether there was a relationship between ARR and the number of particular alleles (SF-1 T and I2 conversion alleles) associated individually with a raised ratio. This proved to be the case, with a significant association between ARR of at least 750 and the number of these alleles (Fig. 1). This relationship was also present when a higher ARR threshold ( 1000) was used (z = 2.4; P = 0.016). The odds ratio (OR) of having an ARR of at least 750 was 2.27 (95% CI, 1.01, 5.09; P < 0.05) when patients homozygous for the SF-1 T/I2 conversion haplotype (who accounted for 16.9% of the study population) were compared with those homozygous for the contrasting haplotype (20% of the study population). Furthermore, although there was no significant relationship between gender and ARR, patients with a raised ARR were significantly older by a mean of 3 yr (95% CI, 0.1, 6.3; P = 0.04). Analyzing the effect of age on ARR in relation to the two groups that were homozygous for the two extreme haplotypes defined above, the OR for a raised ARR appeared to be greater in older patients (age 55 yr, OR 2.8; 95% CI, 0.91, 8.51) compared with younger patients (age < 55 yr, OR 1.8; 95% CI, 0.54, 5.72).

View larger version (31K): [in this window] [in a new window]   Figure 1. The relationship between the number of deleterious alleles and a raised ARR. Numbers in bars indicate the number of subjects in each genotype grouping.

General

If variation in the aldosterone synthase gene contributed to hypertension, this will be more obvious in subjects with relative aldosterone excess. At most, between one fourth and one third of the hypertensive population with low renin levels might have aldosterone excess as defined by an abnormally raised ARR (14). Hypertensive patients with a raised ARR show a good BP response to spironolactone, suggesting that aldosterone is, indeed, of pathophysiological importance in this circumstance (2). In the present study, we found that subjects with a raised ARR had significant excesses of SF-1 T and I2 conversion (I2C) alleles when compared with subjects with a low ratio. Importantly, we have demonstrated a relationship between the number of these alleles and a raised ARR. Intriguingly, there appeared to be an interaction between age, aldosterone synthase genetic polymorphisms, and the ARR, raising a possibility that hyperaldosteronism might become more prevalent with time in genetically predisposed individuals.

SF-1 binding site aldosterone synthase genetic polymorphism

We have previously reported that subjects with the SF-1 T allele have a higher urinary aldosterone excretion rate than those lacking this allele, raising the possibility of increased aldosterone synthase activity (7). We also reported that the T allele was more common in hypertensives, replicating the study of Brand et al. (15). However, in neither study was the relationship between the ARR, BP, and genotype explored. Since then, several studies have examined the distribution of this polymorphism in hypertensive subjects stratified by aldosterone status.

In contrast with our findings, Tamaki et al. (16) reported that the SF-1 C allele was associated with a higher ARR in the Japanese population. However, this study may have been subject to selection bias; the SF-1 TT homozygote rate was more than twice that observed in our population (57% vs. 26%), and the T allele frequency was about 40% (0.74 vs. 0.53) higher than that found in our and other study populations (0.54–0.56; Refs. 8 and 17). This might reflect a true genetic difference between the populations, and/or a sampling difference because a subsequent Japanese study reported lower but still relatively high T allele frequencies of 0.66 and 0.63 in hypertensive and normotensive subjects, respectively (14). Additionally, the small sample size necessitated that statistical analyses were performed by combining patients with SF-1 TC and CC genotypes. A further Japanese study that stratified patients by ARR (using a threshold of 830) found an excess of the T allele in hypertensives with a raised ARR compared with those with a low/normal ARR (n = 73; 0.78 vs. 0.59; P = 0.033; Ref. 14).

Mulatero et al. (18) reported that patients with idiopathic hyperaldosteronism had an excess of the C allele compared with a hypertensive group with normal aldosterone levels. However, although the allele frequencies in the idiopathic hyperaldosteronism group were similar to our hypertensive population, their hypertensive group had an unusually low frequency of the C allele for a Western population (0.38 vs. 0.44–0.47; Refs. 15 and 17), again raising the possibility of sampling bias (14, 16). In contrast, Regolisti et al. (19), who also used the ARR to identify patients with inappropriate aldosterone activity, concurred with our findings. This group reported that patients with a raised ARR who failed to suppress plasma aldosterone on salt loading (n = 78) had an excess of T allele with a frequency of 0.63, whereas the T allele frequency in the unselected hypertensive population (n = 104) was 0.51, data similar to ours. Finally, Schunkert et al. (17) studied 2007 German subjects but failed to find any significant associations between SF-1 polymorphism and BP or plasma aldosterone. Hypertension is likely to be a disease with heterogeneous pathophysiology, and abnormality of the renin-angiotensin-aldosterone system may only be involved in a minority of subjects. If the hypertensive population is considered as a whole, association between specific genotypes and phenotypes may be obscured. In contrast, we assessed the influence of an aldosterone-specific genotype on an aldosterone-related phenotype in a homogeneous group of hypertensive patients.

I2 aldosterone synthase genetic polymorphism

We found a trend for an excess of I2C allele in hypertensive patients with inappropriate aldosterone activity (ARR 750), and when a higher ARR threshold was used, this relationship became statistically significant. We have previously reported that this allele was associated with increased urinary aldosterone excretion rate (7). Brand et al. (15), however, did not find an excess of this allele in their hypertensive population. Nonetheless, because the SF-1 T and I2C alleles are in linkage, our findings are internally consistent and suggest a true association between this locus and raised aldosterone production. This is further strengthened by our haplotype analysis, which demonstrates that the highest OR for a raised ARR was in subjects homozygous for SF-1 T and I2C alleles.

Mechanism for increased aldosterone activity

Although it is unclear how the polymorphisms at this locus lead to increased aldosterone secretion, a plausible mechanism has been put forward (9, 15). The T allele in the CYP11B2 promoter region binds to the SF-1 four times less avidly than that of the C allele (20). Because this particular binding site has no known function (10), it is possible that increased transcription factor (SF-1) availability at other functional sites (e.g. position -71, -64) might result in altered expression of aldosterone synthase. However, other mechanisms, including linkage of these polymorphisms with a quantitative trait locus elsewhere in the regulatory region, need to be explored.

Limitations and implications

We did not perform any dynamic tests in this cohort of patients and relied on a single ARR to identify inappropriate aldosterone production. It is possible that we have overestimated the true prevalence of abnormal regulation of aldosterone, although we have previously shown that a single ARR of at least 750 accurately identifies subjects with loss of normal suppressibility of aldosterone secretion. In our experience, drug treatment does not appear to influence the interpretation of ARR. The first group who used the ratio to detect primary aldosteronism, Hiramatsu et al. (12), found that antihypertensive agents did not affect their results. Subsequently, Gordon et al. (21) in Australia used the ARR in a cross-section of hypertensives irrespective of drug treatment. More recently, Gallay et al. (22) performed a prospective study looking at the diagnostic value of ARR in the presence of multiple antihypertensive drugs in subjects with hypertension and managed to diagnose that within this group of 90 patients, 17% had primary aldosteronism.

We found an apparent interaction among age, genotype, and intermediate phenotype. We did not attempt to adjust our statistics to age because we believe that excess aldosterone activity does not occur de novo spontaneously, but rather increases with age. One possible explanation for this is that abnormal adrenal production of aldosterone represents a chronic development that eventually results in (relative) autonomy of aldosterone secretion in subjects with a genetic predisposition, characterized by the SF-1 T and I2C alleles (23). However, this is speculative and will require prospective longitudinal studies to elucidate. Such studies would also help to clarify the relationship between the aging kidney, ARR, and hypertension, although in the present cross- sectional study, we did not find any significant relationship between age, ARR, and plasma creatinine.

Finally, the finding that hypertensive subjects homozygous for haplotype SF-1 T/I2C were more likely to have a raised ARR might be used to guide patient management. For example, hypertensive individuals homozygous for this haplotype with an ARR less than 750 may develop aldosterone excess and resistant hypertension over time. It is interesting to speculate whether the process can be modified by dietary (e.g. sodium restriction) or other intervention (e.g. aldosterone receptor blockade). Such speculation needs to be addressed by longitudinal studies.

Acknowledgments

P.O. Lim, T.M. MacDonald, E. Dow, R.T. Jung, and J.M.C. Connell planned, designed, and initiated the research. C. Holloway and E. Friel processed the genetic data, and N.H. Anderson analyzed the data. All authors contributed to the study and writing the report.

Footnotes

Address all correspondence and requests for reprints to: Dr. Pitt O. Lim, British Heart Foundation Clinical Lecturer in Cardiology, Department of Cardiology, Wales Heart Research Institute, University of Wales College of Medicine, Heath Park, Cardiff, CF14 4XN, United Kingdom. E-mail: or .

This work was supported by a Medical Research Council program grant (to J.M.C.C., R.F., and E.D.).

Abbreviations: ARR, Aldosterone-to-renin ratio; BP, blood pressure; CI, confidence interval; I2, intron-2; I2C, I2 conversion allele; OR, odds ratio; PRA, plasma renin activity; QC, quality control; SF-1, steroidogenic factor-1; WT, wild-type.

Received December 27, 2001.

Accepted May 10, 2002.

References

1. Lim PO, Dow E, Brennan G, Jung RT, MacDonald TM 2000 High prevalence of primary aldosteronism in the Tayside hypertensive clinic population. J Hum Hypertens 14:311–315[CrossRef][Medline]
2. Lim PO, Rodgers P, Cardale K, Watson AD, MacDonald TM 1999 Potentially high prevalence of primary aldosteronism in a primary-care population. Lancet 353:40[Medline]
3. Kaplan NM 2001 Cautions over the current epidemic of primary aldosteronism. Lancet 357:953–954[CrossRef][Medline]
4. Lim PO, Jung RT, MacDonald TM 2002 Is aldosterone the missing link in refractory hypertension? Aldosterone-to-renin ratio as a marker of inappropriate aldosterone activity. J Hum Hypertens 16:153–158[CrossRef][Medline]
5. Lim PO, Jung RT, MacDonald TM 1999 Raised aldosterone to renin ratio predicts anti-hypertensive efficacy of spironolactone. A prospective cohort follow-up study. Br J Clin Pharmacol 48:756–760[CrossRef][Medline]
6. Takeda Y, Furukawa K, Inaba S, Miyamori I, Mabuchi H 1999 Genetic analysis of aldosterone synthase in patients with idiopathic hyperaldosteronism. J Clin Endocrinol Metab 84:1633–1637[Abstract/Free Full Text]
7. Davies E, Holloway CD, Ingram MC, Inglis GC, Friel EC, Morrison C, Anderson NH, Fraser R, Connell JM 1999 Aldosterone excretion rate and blood pressure in essential hypertension are related to polymorphic differences in the aldosterone synthase gene CYP11B2. Hypertension 33:703–707[Abstract/Free Full Text]
8. Pojoga L, Gautier S, Blanc H, Guyene TT, Poirier O, Cambien F, Benetos A 1998 Genetic determination of plasma aldosterone levels in essential hypertension. Am J Hypertens 11:856–860[CrossRef][Medline]
9. Paillard F, Chansel D, Brand E, Benetos A, Thomas F, Czekalski S, Ardaillou R, Soubrier F 1999 Genotype-phenotype relationships for the renin-angiotensin-aldosterone system in a normal population. Hypertension 34:423–429[Abstract/Free Full Text]
10. Clyne CD, Zhang Y, Slutsker L, Mathis JM, White PC, Rainey WE 1997 Angiotensin II and potassium regulate human CYP11B2 transcription through common cis-elements. Mol Endocrinol 11:638–649[Abstract/Free Full Text]
11. Kupari M, Hautanen A, Lankinen L, Koskinen P, Virolainen J, Nikkila H, White PC 1998 Associations between human aldosterone synthase (CYP11B2) gene polymorphisms and left ventricular size, mass, and function. Circulation 97:569–575[Abstract/Free Full Text]
12. Hiramatsu K, Yamada T, Yukimura Y, Komiya I, Ichikawa K, Ishihara M, Nagata H, Izumiyama T 1981 A screening test to identify aldosterone- producing adenoma by measuring plasma renin activity. Results in hypertensive patients. Arch Intern Med 141:1589–1593[Abstract/Free Full Text]
13. Rossi GP, Rossi E, Pavan E, Rosati N, Zecchel R, Semplicini A, Perazzoli F, Pessina AC 1998 Screening for primary aldosteronism with a logistic multivariate discriminant analysis. Clin Endocrinol (Oxf) 49:713–723[CrossRef][Medline]
14. Komiya I, Yamada T, Takara M, Asawa T, Shimabukuro M, Nishimori T, Takasu N 2000 Lys(173)Arg and -344T/C variants of CYP11B2 in Japanese patients with low-renin hypertension. Hypertension 35:699–703[Abstract/Free Full Text]
15. Brand E, Chatelain N, Mulatero P, Fery I, Curnow K, Jeunemaitre X, Corvol P, Pascoe L, Soubrier F 1998 Structural analysis and evaluation of the aldosterone synthase gene in hypertension. Hypertension 32:198–204[Abstract/Free Full Text]
16. Tamaki S, Iwai N, Tsujita Y, Kinoshita M 1999 Genetic polymorphism of CYP11B2 gene and hypertension in Japanese. Hypertension 33:266–270[Abstract/Free Full Text]
17. Schunkert H, Hengstenberg C, Holmer SR, Broeckel U, Luchner A, Muscholl MW, Kurzinger S, Doring A, Hense HW, Riegger GA 1999 Lack of association between a polymorphism of the aldosterone synthase gene and left ventricular structure. Circulation 99:2255–2260[Abstract/Free Full Text]
18. Mulatero P, Schiavone D, Fallo F, Rabbia F, Pilon C, Chiandussi L, Pascoe L, Veglio F 2000 CYP11B2 gene polymorphisms in idiopathic hyperaldosteronism. Hypertension 35:694–698[Abstract/Free Full Text]
19. Regolisti G, Giacchetti G, Lucarelli G, Ronconi V, Arnaldi G, Perazzoli F, Casali A, Negro A, Rossi E, Mantero F 2000 Aldosterone synthase gene polymorphism in idiopathic hyperaldosteronism. J Hypertens 18(Suppl 2):S144
20. White PC, Slutsker L 1995 Haplotype analysis of CYP11B2. Endocr Res 21:437–442[Medline]
21. Gordon RD, Stowasser M, Tunny TJ, Klemm SA, Rutherford JC 1994 High incidence of primary aldosteronism in 199 patients referred with hypertension. Clin Exp Pharmacol Physiol 21:315–318[Medline]
22. Gallay BJ, Ahmad S, Xu L, Toivola B, Davidson RC 2001 Screening for primary aldosteronism without discontinuing hypertensive medications: plasma aldosterone-renin ratio. Am J Kidney Dis 37:699–705[Medline]
23. Lim PO, Struthers AD, MacDonald TM 2002 The neurohormonal natural history of essential hypertension: toward primary or tertiary aldosteronism? J Hypertens 20:11–15[CrossRef][Medline]

This article has been cited by other articles:

				G. Escher, M. Cristiano, M. Causevic, M. Baumann, F. J. Frey, D. Surbek, and M. G. Mohaupt High aldosterone-to-renin variants of CYP11B2 and pregnancy outcome Nephrol. Dial. Transplant., June 1, 2009; 24(6): 1870 - 1875. [Abstract] [Full Text] [PDF]

				J. M. C. Connell, S. M. MacKenzie, E. M. Freel, R. Fraser, and E. Davies A Lifetime of Aldosterone Excess: Long-Term Consequences of Altered Regulation of Aldosterone Production for Cardiovascular Function Endocr. Rev., April 1, 2008; 29(2): 133 - 154. [Abstract] [Full Text] [PDF]

				D. A. Calhoun and N. M. Kaplan Is There an Unrecognized Epidemic of Primary Aldosteronism? (Pro) Hypertension, September 1, 2007; 50(3): 447 - 453. [Full Text] [PDF]

				N. Iwai, K. Kajimoto, H. Tomoike, and N. Takashima Polymorphism of CYP11B2 Determines Salt Sensitivity in Japanese Hypertension, April 1, 2007; 49(4): 825 - 831. [Abstract] [Full Text] [PDF]

				M. Barr, S. M. MacKenzie, E. C. Friel, C. D. Holloway, D. M. Wilkinson, N. J.R. Brain, M. C. Ingram, R. Fraser, M. Brown, N. J. Samani, et al. Polymorphic Variation in the 11{beta}-Hydroxylase Gene Associates With Reduced 11-Hydroxylase Efficiency Hypertension, January 1, 2007; 49(1): 113 - 119. [Abstract] [Full Text] [PDF]

				D. M. McNamara, S. W. Tam, M. L. Sabolinski, P. Tobelmann, K. Janosko, A. L. Taylor, J. N. Cohn, A. M. Feldman, and M. Worcel Aldosterone Synthase Promoter Polymorphism Predicts Outcome in African Americans With Heart Failure: Results From the A-HeFT Trial J. Am. Coll. Cardiol., September 19, 2006; 48(6): 1277 - 1282. [Abstract] [Full Text] [PDF]

				A. J Casal, V. J P Sinclair, A. M Capponi, J. Nicod, U. Huynh-Do, and P. Ferrari A novel mutation in the steroidogenic acute regulatory protein gene promoter leading to reduced promoter activity. J. Mol. Endocrinol., August 1, 2006; 37(1): 71 - 80. [Abstract] [Full Text] [PDF]

				D. Gu, S. Su, D. Ge, S. Chen, J. Huang, B. Li, R. Chen, and B. Qiang Association Study With 33 Single-Nucleotide Polymorphisms in 11 Candidate Genes for Hypertension in Chinese Hypertension, June 1, 2006; 47(6): 1147 - 1154. [Abstract] [Full Text] [PDF]

				S. Ganapathipillai, G. Laval, I. S. Hoffmann, A. M. Castejon, J. Nicod, B. Dick, F. J. Frey, B. M. Frey, L. X. Cubeddu, and P. Ferrari CYP11B2-CYP11B1 Haplotypes Associated with Decreased 11{beta}-Hydroxylase Activity J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1220 - 1225. [Abstract] [Full Text] [PDF]

				B. Keavney, B. Mayosi, N. Gaukrodger, H. Imrie, M. Baker, R. Fraser, M. Ingram, H. Watkins, M. Farrall, E. Davies, et al. Genetic Variation at the Locus Encompassing 11-{beta} Hydroxylase and Aldosterone Synthase Accounts for Heritability in Cortisol Precursor (11-Deoxycortisol) Urinary Metabolite Excretion J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1072 - 1077. [Abstract] [Full Text] [PDF]

				O. Olivieri, A. Ciacciarelli, D. Signorelli, F. Pizzolo, P. Guarini, C. Pavan, A. Corgnati, S. Falcone, R. Corrocher, A. Micchi, et al. Aldosterone to Renin Ratio in a Primary Care Setting: The Bussolengo Study J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4221 - 4226. [Abstract] [Full Text] [PDF]

				E. M. Freel and J. M.C. Connell Mechanisms of Hypertension: The Expanding Role of Aldosterone J. Am. Soc. Nephrol., August 1, 2004; 15(8): 1993 - 2001. [Abstract] [Full Text] [PDF]

				P. C. White Aldosterone: Direct Effects on and Production by the Heart J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2376 - 2383. [Full Text] [PDF]

				J. Nicod, D. Bruhin, L. Auer, B. Vogt, F. J. Frey, and P. Ferrari A Biallelic Gene Polymorphism of CYP11B2 Predicts Increased Aldosterone to Renin Ratio in Selected Hypertensive Patients J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2495 - 2500. [Abstract] [Full Text] [PDF]

				J. M.C. Connell, R. Fraser, S. MacKenzie, and E. Davies Is Altered Adrenal Steroid Biosynthesis a Key Intermediate Phenotype in Hypertension? Hypertension, May 1, 2003; 41(5): 993 - 999. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lim, P. O. Articles by Connell, J. M. C. Search for Related Content PubMed PubMed Citation Articles by Lim, P. O. Articles by Connell, J. M. C.