help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Groussin, L.
Right arrow Articles by Bertherat, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Groussin, L.
Right arrow Articles by Bertherat, J.
The Journal of Clinical Endocrinology & Metabolism Vol. 87, No. 9 4324-4329
Copyright © 2002 by The Endocrine Society


Other Original Article

Mutations of the PRKAR1A Gene in Cushing’s Syndrome due to Sporadic Primary Pigmented Nodular Adrenocortical Disease

Lionel Groussin, Eric Jullian, Karine Perlemoine, Albert Louvel, Bruno Leheup, Jean Pierre Luton, Xavier Bertagna and Jérôme Bertherat

Service des Maladies Endocriniennes et Métaboliques (L.G., J.P.L., X.B., J.B.), Service Central d’Anatomie Pathologique (A.L.), Centre Hospitalier Universitaire (CHU) Cochin, Paris 75014, France; Service de Médecine Infantile III et Génétique Clinique (B.L.), CHU de Nancy, Nancy 54505, France; and Département d’Endocrinologie (L.G., E.J., K.P., X.B., J.B.), Institut Cochin, Institut National de la Santé et de la Recherche Médicale U567, Centre National de la Recherche Scientifique UMR8104, IFR 116, Université Paris V-René Descartes, Paris 75014, France

Address all correspondence and requests for reprints to: Dr. Jérôme Bertherat, Service des Maladies Endocriniennes et Métaboliques, Hôpital Cochin, 27 rue du Fg-St-Jacques, 75014, Paris, France. E-mail: . jerome.bertherat{at}cch.ap-hop-paris.fr

Abstract

Primary pigmented nodular adrenocortical disease (PPNAD) is a cause of ACTH-independent Cushing’s syndrome. This condition can be difficult to diagnose because hypercortisolism may be periodic and adrenal imaging may not demonstrate an adrenal tumor. PPNAD can be part of the Carney complex (CNC), an autosomal dominant multiple neoplasia syndrome. Germline mutations of the regulatory subunit R1A of PKA (PRKAR1A) have been observed in about 45% of CNC kindreds. To improve our understanding of sporadic PPNAD and develop a potential diagnostic tool, we investigated the genetics of patients with sporadic and isolated PPNAD.

Patients undergoing surgery for bilateral ACTH-independent Cushing’s syndrome in whom pathological examination revealed PPNAD were subjected to endocrinological investigations and a systematic search for other manifestations of CNC. The PRKAR1A gene was sequenced using DNA from frozen adrenal tissues and leukocytes from three patients with sporadic isolated PPNAD and using leukocyte DNA from two additional patients.

Different inactivating germline mutations of the PRKAR1A gene were found in the five patients. For three cases, study of the parents’ DNA demonstrated a de novo mutation. One patient presented with an unusual 2.5-cm macronodule of the right adrenal mimicking an adrenal adenoma. A somatic 16-bp deletion of PRKAR1A gene was also found in this macronodule.

Inactivating germline mutations of PRKAR1A are frequent in sporadic and isolated cases of PPNAD. The wild-type allele can be inactivated by somatic mutations, consistent with the hypothesis of the gene being a tumor suppressor gene. Thus, genetic analysis can be of help to the clinician in the diagnosis of this difficult form of adrenal Cushing’s syndrome.

ADRENAL CUSHING’S SYNDROME (ACS) is a consequence of one or both adrenal glands secreting excess cortisol in an ACTH-independent manner. In most cases, a unilateral tumor, either an adenoma or a carcinoma, allows straightforward diagnosis and an adequate treatment.

In rare cases, ACS is secondary to a primary bilateral adrenal dysfunction and may be difficult to diagnose. However, this is a condition that has recently been elegantly described at the molecular level (1). In the McCune-Albright syndrome, ACS results from autonomous activation of the cAMP pathway in the adrenal nodules due to somatic activating mutations of the Gs{alpha} subunit (2). ACTH-independent macronodular adrenal hyperplasia is another form of ACS in which bilateral macronodules cause large increases in the size and weight of the two glands. Since the original work by Lacroix et al. (3) and Reznik et al. (4), it was shown that most of these cases display illegitimate expression of membrane G protein-coupled receptors (5). Primary pigmented nodular adrenocortical disease (PPNAD) is the last form of ACS for which a molecular description has been reported. However, it was probably the first to be described as a peculiar pathological entity (6); the adrenal weight and size are most often normal, but there are numerous typical pigmented micronodules scattered within both glands (7). Most patients with PPNAD are children or young adults (8).

The diagnosis of Cushing’s syndrome in PPNAD can be difficult; hypercortisolism usually progresses only slowly and in some cases periodically, and the clinical and laboratory features can be normal during nonhypersecretory periods. The typical growth failure observed in children with Cushing’s syndrome is therefore not constant. Plasma ACTH levels are not fully suppressed in all cases in which hypercortisolism is mild or periodic (8). Furthermore, adrenal imaging can be normal or show only minor alterations with minimal adrenal nodularity that cannot always be distinguished from Cushing’s disease or normal glands. In some instances, the diagnosis may be confused with factitious exogenous glucocorticoid excess.

An interesting feature is that PPNAD is frequently part of a wider clinical spectrum, the Carney complex (CNC; Ref. 9). In this autosomal dominant multiple neoplasia syndrome (MIM 160980), affected patients have, in addition to PPNAD, other endocrine tumors (GH-secreting adenomas, thyroid adenomas or carcinomas, ovarian cysts, large-cell calicifying Sertoli cell tumors, etc.), as well as cardiac myxomas and spotty skin pigmentation (10). Thus, diagnosis is facilitated when PPNAD occurs in a patient with full blown CNC. Inactivating germline mutations of the regulatory subunit type I-{alpha} of the protein kinase A (PRKAR1A) have recently been observed in about 40–50% of CNC families (11, 12, 13). PRKAR1A has therefore been proposed to be a tumor suppressor gene (12). According to the Knudson hypothesis (14), somatic mutations of the PRKAR1A gene should be observed in sporadic isolated PPNAD. Alternatively, a clinically apparently isolated and sporadic PPNAD might be the result of a germline PRKAR1A mutation with incomplete clinical expression and low penetrance. In such cases, molecular analysis might help diagnose this difficult form of ACS.

We screened patients with well documented, isolated, and sporadic PPNAD for mutations of the PRKAR1A gene. A somatic mutation was found in a unique PPNAD macronodule, but de novo germline mutations were found consistently. This emphasizes the need for genetic screening in difficult cases of bilateral ACS.

Patients and Methods

Medical records of all the patients who were either followed in the Endocrine Department of Hospital Cochin and had adrenalectomy for PPNAD between 1991 and 2001 or were referred to our laboratory for PRKAR1A gene mutation analysis were reviewed. For PPNAD, 21 patients from 15 kindreds were identified. Seven of these patients had apparently isolated PPNAD with no familial history suggestive of CNC. The familial medical histories of these patients were investigated, and the patients were studied for clinical signs of CNC, including dermatological examination and thyroid palpation. Ovarian or testicular, thyroid, and cardiac ultrasound scans and pituitary magnetic resonance imaging were performed to exclude other features of CNC. Plasma concentrations of GH, PRL, and IGF-I were determined as previously described (15). Informed consent was obtained for genetic analysis of PRKAR1A and adrenal tissue collection as part of a protocol approved by the Institutional Review Board of the Cochin Hospital. If investigations revealed any other manifestation suggestive of CNC (as defined by Stratakis et al., Ref. 10), the patient was excluded. Two of these seven patients were thus excluded after diagnosis of ovarian cyst and pigmented skin lesions.

Three of the five remaining patients (patients 1–3) were investigated before adrenalectomy in our department. Endocrinological investigations were performed as part of the routine standard procedure for Cushing’s syndrome diagnosis as previously reported (16, 17).

Adrenal tissue collection and DNA and total RNA extraction were performed as previously described (18). The cDNA Cycle kit (Invitrogen, Groningen, The Netherlands) was used for RT. For mutation analysis, the 12 exons and the flanking intronic sequences of the PRKAR1A gene were separately amplified by PCR as described by Kirschner et al. (11) and Casey et al. (13). Both strands of the amplified products were directly sequenced on an automated sequencer (ABI 3700; Perkin-Elmer Corp., Wellsley, MA). Nucleotides were numbered in accordance with the reference sequence for PRKAR1A (GenBank accession no. NM_002734) used by Kirschner et al. (11, 12).

Case records

Patient 1. An 18-yr-old woman of African origin was referred for Cushing’s syndrome. She presented with growth failure at age 15, secondary amenorhea at age 17, and central obesity. Investigations (Table 1Go) demonstrated ACTH-independent Cushing’s syndrome. Computed tomography (CT) scan showed a right adrenal mass 2.5 cm across, suggestive of an adrenal adenoma, but the left adrenal appeared nonatrophic (Fig. 1Go). Laparoscopic adrenalectomy was performed. The right adrenal weighed 8.3 g, and pathological examination revealed a 2.5-cm pigmented nodule surrounded by small (0.2 cm) micronodules. The left adrenal weighed 4.2 g and displayed multiple small pigmented nodules (0.2–0.6 cm). Adjacent adrenal was normal or slightly atrophic. At age 18, investigations did not reveal any alteration suggestive of CNC.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical, endocrinological, and radiological investigations in the five patients before adrenalectomy

 


View larger version (51K):
[in this window]
[in a new window]
 
Figure 1. Adrenal CT scan in patients 1, 2, and 3. The dotted arrows show the adrenal glands of the three patients; the large arrow shows the 2.5-cm right adrenal mass in patient 1.

 
Patient 2. An 11-yr-old girl of French origin was referred for Cushing’s syndrome. She had developed pubic and axillary hair (Tanner staging P4A2) without breast growth at age 7 yr, with low estradiol and gonadotropin plasma levels, suggestive of pseudopuberty. Clinical signs of intermittent Cushing’s syndrome were then observed between ages 7 and 11 yr, always associated with concomitant increases in urinary cortisol. At age 11, severe central obesity was observed without growth failure. Hormonal investigations revealed ACTH-independent Cushing’s syndrome (Table 1Go), associated with increased testosterone. Daily salivary cortisol and testosterone measurements over 6 wk showed variable but simultaneous oversecretion of both steroids. Both adrenals appeared normal on CT scan, and iodocholestrol scintigraphy revealed bilateral uptake. Bilateral adrenalectomy was performed, and pathological analysis revealed diffuse pigmented nodules (0.1–0.3 cm) with apparently normal adjacent adrenal cortex. The right adrenal weighed 7 g, and the left adrenal weighed 9 g. Cortisol and testosterone were undetectable in plasma after surgery. At age 20, investigations did not reveal any alteration suggestive of CNC.

Patient 3. A 28-yr-old woman of African origin was referred for Cushing’s syndrome that had apparently started 1 yr before, during the first trimester of a clomiphene-induced pregnancy. She presented with central obesity, hirsutism, psychiatric manifestations, high blood pressure, and glucose intolerance. Spontaneous abortion occurred after 24 wk of gestation. Hormonal investigations were performed 8 d later and indicated ACTH-independent Cushing’s syndrome with high testosterone (Table 1Go). CT scan revealed normal adrenals, and iodocholesterol scintigraphy showed bilateral uptake. Bilateral adrenalectomy was performed, and pathological analysis revealed diffuse pigmented nodules (0.1–0.8 cm). The right adrenal weighed 4.5 g, and the left weighed 5.7 g. Plasma cortisol and testosterone levels were very low after surgery. At age 29 yr, investigations did not reveal any evidence of CNC.

Patient 4. A 33-yr-old man of French origin was referred for follow-up after bilateral adrenalectomy. At age 14, he had developed a central obesity. At age 17, he suffered an osteoporotic vertebral fracture, at which time hormonal investigation showed an ACTH-independent Cushing’s syndrome; adrenals appeared normal on CT scan. 2,2-Bis(2-chlorophenyl, 4'-chlorophenyl)1,1-dichloroethane treatment was administered, and the patient then underwent bilateral adrenalectomy at age 18. The adrenals weighed 10 g. Pathological analysis revealed multiple pigmented micronodules (1–4 mm) suggestive of PPNAD. At age 33, investigations revealed no evidence suggestive of CNC.

Patient 5. A 5-yr-old girl of French origin presented with pubic and axillary hair development (Tanner staging P2A2). Hormonal investigations showed that an absence of circadian variations of cortisol and ACTH was undetectable in plasma. Between ages 5 and 10 yr, clinical and endocrinological investigations showed intermittent features of ACTH-independent Cushing’s syndrome that became more severe at age 10 yr. Adrenals were not enlarged on CT scan, and a right adrenalectomy was performed. Pathological analysis revealed pigmented micronodules. After a transient improvement, the ACTH-independent Cushing’s syndrome recurred, so left adrenalectomy was performed at age 11 yr. Pathological analysis revealed pigmented micronodules (1–5 mm). At age 11 yr, clinical examination (skin, thyroid), abdominal CT scan, abdominopelvic ultrasound, pituitary magnetic resonance imaging, and endocrinological investigations did not reveal any evidence suggestive of CNC. At age 12 yr, cardiac ultrasound was normal, and GH under oral glucose load excluded acromegaly.

Results

Patient 1

Two different mutations of the PRKAR1A gene were identified in the 2.5-cm macronodule of the right adrenal (Table 1Go and Figs. 1Go and 2Go). One, a 16-bp deletion of the acceptor splice site of exon 4B [exon 4B IVS del (-17-> -2)] is predicted to lead to exon skipping and a premature stop codon. This deletion was not detected on the tissue adjacent to this macronodule or in the left adrenal or leukocyte DNA. It was thus a somatic rearrangement.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. Results of PRKAR1A gene analysis in patient 1. A, Pedigree of the family of patient 1. The proband, indicated by the arrow, is the only affected member. She presents an isolated PPNAD with a 2.5-cm right adrenal macronodule. B, Schematic representation of the PRKAR1A gene organization of coding exons with alternate splicing of two different leader exons. Sequencing of the PRKAR1A gene in proband lymphocyte DNA identified a germline mutation in the exon 1B splice donor site (102 G->A). This mutation was found only in the proband. The right adrenal macronodule also harbors a deletion of 16 bp in the acceptor splice site of exon 4B [exon 4B IVS del(-17-> -2)]. C, RT-PCR products from transformed lymphocytes from patient 1 and two normal subjects showing a novel splice product from the proband. For amplification of exon 1B cDNA, the primers used were: sense, GAGCAAAGCGCTGAGGGAGCTC; and antisense, TCTCCTGCGATAAAGGAGACCG. This splice variant cDNA with a 53-bp deletion was the result of a cryptic splice donor site. It was also observed in the RT-PCR products from mRNA extracted from the right and left adrenals as well as from the periadrenal fat of patient 1. Subsequent sequence analysis showed disruption of the MED-1-like element located at position +45 to +50 in exon 1B. D, Migration in a nondenaturing polyacrylamide gel of PCR products of exon 4B from proband lymphocytes, the right adrenal macronodule and the left adrenal gland. The heterozygous 16-bp deletion of the acceptor splice site of exon 4B and the related heteroduplex were present only in the macronodule of the right adrenal gland.

 
The point mutation detected in exon 1B (102 G->A) is a germline mutation of the splice donor site that results in partial exon skipping. This mutation was absent from both parents and is thus a de novo mutation. Study of mRNA from leukocytes and right and left adrenals revealed an abnormally short mRNA. Gel-purified RT-PCR products of exon 1B were sequenced to characterize this mRNA. It appeared to be a splice variant mRNA resulting from the use of a cryptic splice donor site with a deletion of 53 bp in exon 1B (Fig. 2Go). This mRNA was not detected in controls (leukocytes or adrenal tissues).

Patient 2

Sequencing of the PRKAR1A gene in adrenal tissue revealed a single base pair change. An A insertion and thus frameshift in exon 8 (933insA) leads to a premature stop codon. This mutation was also detected in the leukocyte DNA. It was not detected in the parents’ leukocyte DNA. No other mutation was found in micronodules from either adrenal.

Patient 3

The PRKAR1A gene in adrenal tissues had a single base pair mutation (196 C->T) creating a stop codon in exon 2. This mutation was also detected in the leukocyte DNA. No other mutation was found in micronodules from either adrenal.

Patient 4

Analysis of leukocyte DNA revealed a 5-bp deletion in the proximal part of intron 6 [exon 7 IVS del (-7-> -2)] predicted to lead to exon skipping.

Patient 5

Analysis of leukocyte DNA revealed an 11-bp deletion, and consequently frameshift, in exon 2 (172 del 11 bp) that lead to a premature stop codon. This was not observed in the parents’ leukocyte DNA and was thus a de novo mutation.

Discussion

These cases illustrate various problems that can impede the correct diagnosis of bilateral ACS due to PPNAD.

First, the diagnosis of hypercortisolism itself is often difficult. As shown here in cases 2, 4, and 5, the cyclic variations of cortisol oversecretion resulted in a delay of 2–4 yr before diagnosis of Cushing’s syndrome was established. The concomitant oversecretion of testosterone, with normal dehydroepiandrosterone sulfate (cases 2 and 3), was another unusual biological feature and contributed further confusion. Adrenal imaging may be puzzling because CT scan may find no adrenal tumor, or even normal appearing glands, in ACTH-independent Cushing’s syndrome. The diagnostic difficulty was increased when a unilateral mass was found, as in patient 1, who was initially referred to our department for a classical adrenal adenoma. Accurate diagnosis relies on the fine imaging analysis of the contralateral gland, which may not be atrophic, or on adrenal scintigraphy that shows bilateral, if not symmetrical, tracer uptake. Finally, the PPNAD may present as a sporadic and isolated disease without any familial history or clinical evidence of other features of CNC, as reported by Meador et al. (6) and in the five cases presented here.

We hypothesized that all five of our patients were cases of de novo CNC, in an attenuated form, restricted to the adrenals. Were this to be true, diagnosis would be straightforward by germline DNA analysis. Indeed, the five patients with isolated PPNAD all had a germline mutation of the PRKAR1A gene.

These mutations led to gene inactivation by various mechanisms. They are unique mutations, none of which has been previously reported in CNC kindreds. In patients 2–5, a premature stop codon is predicted to create an unstable mRNA, as observed in more typical familial CNC patients (12). The germline mutation observed in patient 2 leads to a frameshift causing a premature stop codon. The germline nonsense mutation observed in patient 3 directly creates a stop codon. The germline mutation observed in patient 4 alters the predicted splicing site and should lead to exon skipping. This abnormal mRNA was not studied in the present case because mutations leading by the same kind of genetic defect to a premature stop codon have been reported already in Carney complex patients (11, 12). Because the abnormal mRNA is degraded by a nonsense mRNA decay mechanism, the abnormally spliced mRNA is not observed in RNA extracted from leukocytes as well as tumor tissues (11).

The de novo germline mutation in exon 1B of patient 1 led to partial exon skipping, generating a shorter mRNA that is not observed in control subjects. This abnormal mRNA is predicted to impede translation into PRKAR1A protein, although the design of the experiments reported here does not allow us to address this issue directly. Nevertheless, a recent report shows that the exon 1B region is involved in positive postranscriptional regulation of PRKAR1A expression in response to cAMP in Sertoli cells (19). This regulation is mediated by a consensus 6 bp, the MED-1-like element (GCTCGG positions + 45 to + 50). The 102 G->A mutation disrupts this conserved element (Fig. 2Go). Furthermore, this consensus 6-bp element has been deleted from the abnormal mRNA observed in the leukocytes and adrenal tissue from this patient.

Thus, germline mutations of the PRKAR1A gene can be found in PPNAD patients who do not fulfill the proposed criteria for CNC (10). In the McCune-Albright syndrome, ACS is due to Gs{alpha} mutations occurring exclusively in cortisol hypersecreting adrenocortical macronodules. Similarly, somatic PRKAR1A mutations may be found in the nodular adrenals of these patients with no familial history or other features of CNC. Indeed, the somatic mutation of PRKAR1A might explain PPNAD in patients without germline mutation. However, a recent study of another manifestation of CNC (sporadic cardiac myxomas) does not favor this hypothesis because no evidence of PRKAR1A mutation was found (20).

Patient 1 had a unusual presentation: in contrast to the other patients, she had a macronodule of the right adrenal. Within this nodule, we found a somatic PRKAR1A gene mutation that appeared restricted to the lesion. This somatic mutation also led to loss of gene function due to a premature stop codon. This is an alternative mechanism of inactivation of the wild-type allele, and in agreement with the model of PRKAR1A as a tumor suppressor gene (12). This model was suggested in the first report of PRKAR1A germline mutation in CNC by Kirschner et al. (12) on the basis of allelic loss at 17q22-24 in tumors from CNC patients. However, allelic loss at 17q22-24 was not always reported in such tumors, and haploinsufficiency has been postulated as a mechanism of tumorigenesis in this case (13). The early occurrence of the somatic mutation in the right adrenal of patient 1 might have contributed to greatly inactivating PRKAR1A function at an early stage of tumor development. In this case, the occurrence of this somatic mutation could be linked to the development of this right macronodule mimicking an adrenal adenoma. It would be tempting from this observation to speculate that somatic mutation of PRKAR1A could also be observed in sporadic unilateral adrenocortical tumors.

The lack of familial history of CNC in our patients suggests a de novo mutation in each case, and this was confirmed by the three younger patients whose parents’ leukocyte DNA was normal. The absence of other features of CNC in our patients is more difficult to explain. The younger patients may have been too young for other manifestations of CNC if they occur later. Possibly, some mutations might have tissue-specific effects. This explanation might apply to patient 1. Indeed it has been shown that the cAMP posttranscriptional regulation of exon 1B 5'UTR is tissue specific (19). Therefore, this mutation might have consequences in only a subset of tissues. It should be noted that mutation in exon 1B has not been reported previously in patients with CNC.

In conclusion, de novo germline mutations of the PRKAR1A gene are frequent in sporadic PPNAD, and somatic mutation of this gene can also be observed. Genetic testing might therefore be of great help in the diagnosis of this difficult form of Cushing’s syndrome. Because the current treatment of choice is total bilateral adrenalectomy, genetic testing might be very helpful in indicating surgical treatment for ACTH-independent Cushing’s syndrome in patients with apparently normal adrenal CT scans. These results also suggest that repeated screening for CNC manifestations, in particular searching for cardiac myxomas that can be life threatening, should be considered in patients presenting with isolated PPNAD.


View this table:
[in this window]
[in a new window]
 
Table 2. Results of PRKARIA gene sequencing in leucocyte and adrenal DNA from the five patients and leucocyte DNA from their parents

 
Acknowledgments

We thank F. René-Corail (Institut Cochin) for excellent technical assistance; the staff of the banque de cellules (Prof. M. Delpech, CHU Cochin) for lymphocyte collection; the surgeons (Profs. Y. Chapuis and B. Dousset) and the medical and paramedical staff at the Surgery and Endocrine Departments of the Hôpital Cochin who managed the patients; Dr. F. Tissier (Hôpital Cochin) for collaboration in the pathological examinations; Dr. A. Dugue and the staff of the Laudat Hormone Laboratory for homone assays; Prof. D. Dewailly (CHU Lille) for the initial management of patient 4; and Dr. B. Lebon-Labich (CHU Nancy) for management of patient 5. We also thank Prof. C. Beldjord (Institut Cochin, CHU Cochin), Dr. C. A. Stratakis (National Institutes of Health, Bethesda, MD), and the members of our laboratory for helpful discussions.

Footnotes

This work was supported in part by the Plan Hospitalier de Recherche Clinique (AOM 95201 to the Comete Network coordinated by Prof. P. F. Plouin and dedicated to the study of adrenal tumors) and the Association pour la Recherche sur le Cancer (ARC 4225). L.G. was the recipient of a fellowship from the Association pour la Recherche sur le Cancer.

Abbreviations: ACS, Adrenal Cushing’s syndrome; CNC, Carney complex; CT, computed tomography; PPNAD, primary pigmented nodular adrenocortical disease.

Received April 16, 2002.

Accepted June 14, 2002.

References

  1. Stratakis CA, Kirschner LS 1998 Clinical and genetic analysis of primary bilateral adrenal diseases (micro- and macronodular disease) leading to Cushing syndrome. Horm Metab Res 30:456–463[Medline]
  2. Weinstein LS, Shenker A, Gejman PV, Merino MJ, Friedman E, Spiegel AM 1991 Activating mutations of the stimulatory G protein in the McCune-Albright syndrome. N Engl J Med 325:1688–1695[Abstract]
  3. Lacroix A, Bolte E, Tremblay J, Dupre J, Poitras P, Fournier H, Garon J, Garrel D, Bayard F, Taillefer R, Flanagan RJ, Hamet P 1992 Gastric inhibitory polypeptide-dependent cortisol hypersecretion–a new cause of Cushing’s syndrome. N Engl J Med 327:974–980[Abstract]
  4. Reznik Y, Allali-Zerah V, Chayvialle JA, Leroyer R, Leymarie P, Travert G, Lebrethon MC, Budi I, Balliere AM, Mahoudeau J 1992 Food-dependent Cushing’s syndrome mediated by aberrant adrenal sensitivity to gastric inhibitory polypeptide. N Engl J Med 327:981–986[Abstract]
  5. Lacroix A, Ndiaye N, Tremblay J, Hamet P 2001 Ectopic and abnormal hormone receptors in adrenal Cushing’s syndrome. Endocr Rev 22:75–110[Abstract/Free Full Text]
  6. Meador CK, Bowdoin B, Owen WC, Farmer TA 1967 Primary adrenocortical nodular dysplasia: a rare cause of Cushing’s syndrome. J Clin Endocrinol Metab 27:1255–1263[Abstract/Free Full Text]
  7. Carney JA, Young WF 1992 Primary pigmented nodular adrenocortical disease and its associated conditions. Endocrinologist 2:6–21
  8. Stratakis CA, Sarlis N, Kirschner LS, Carney JA, Doppman JL, Nieman LK, Chrousos GP, Papanicolaou DA 1999 Paradoxical response to dexamethasone in the diagnosis of primary pigmented nodular adrenocortical disease. Ann Intern Med 131:585–591[Abstract/Free Full Text]
  9. Carney JA, Gordon H, Carpenter PC, Shenoy BV, Go VL 1985 The complex of myxomas, spotty pigmentation, and endocrine overactivity. Medicine (Baltimore) 64:270–283[Medline]
  10. Stratakis CA, Kirschner LS, Carney JA 2001 Clinical and molecular features of the Carney complex: diagnostic criteria and recommendations for patient evaluation. J Clin Endocrinol Metab 86:4041–4046[Abstract/Free Full Text]
  11. Kirschner LS, Sandrini F, Monbo J, Lin JP, Carney JA, Stratakis CA 2000 Genetic heterogeneity and spectrum of mutations of the PRKAR1A gene in patients with the Carney complex. Hum Mol Genet 9:3037–3046[Abstract/Free Full Text]
  12. Kirschner LS, Carney JA, Pack SD, Taymans SE, Giatzakis C, Cho YS, Cho-Chung YS, Stratakis CA 2000 Mutations of the gene encoding the protein kinase A type I-{alpha} regulatory subunit in patients with the Carney complex. Nat Genet 26:89–92[CrossRef][Medline]
  13. Casey M, Vaughan CJ, He J, Hatcher CJ, Winter JM, Weremowicz S, Montgomery K, Kucherlapati R, Morton CC, Basson CT 2000 Mutations in the protein kinase A R1{alpha} regulatory subunit cause familial cardiac myxomas and Carney complex. J Clin Invest 106:R31–R38
  14. Knudson AG 1993 Antioncogenes and human cancer. Proc Natl Acad Sci USA 90:10914–10921[Abstract/Free Full Text]
  15. Barrande G, Pittino-Lungo M, Coste J, Ponvert D, Bertagna X, Luton JP, Bertherat J 2000 Hormonal and metabolic effects of radiotherapy in acromegaly: long-term results in 128 patients followed in a single center. J Clin Endocrinol Metab 85:3779–3785[Abstract/Free Full Text]
  16. Luton JP, Martinez M, Coste J, Bertherat J 2000 Outcome in patients with adrenal incidentaloma selected for surgery: an analysis of 88 cases investigated in a single clinical center. Eur J Endocrinol 143:111–117[Abstract]
  17. Luton JP, Cerdas S, Billaud L, Thomas G, Guilhaume B, Bertagna X, Laudat MH, Louvel A, Chapuis Y, Blondeau P, Bricaire H 1990 Clinical features of adrenocortical carcinoma, prognostic factors, and the effect of mitotane therapy. N Engl J Med 322:1195–1201[Abstract]
  18. Gicquel C, Bertagna X, Gaston V, Coste J, Louvel A, Baudin E, Bertherat J, Chapuis Y, Duclos JM, Schlumberger M, Plouin PF, Luton JP, Le Bouc Y 2001 Molecular markers and long-term recurrences in a large cohort of patients with sporadic adrenocortical tumors. Cancer Res 61:6762–6767[Abstract/Free Full Text]
  19. Dahle MK, Knutsen HK, Tasken KA, Pilz R, Tasken K 2001 Cyclic AMP regulates expression of the RI {alpha} subunit of cAMP-dependent protein kinase through an alternatively spliced 5' UTR. Eur J Biochem 268:5920–5929[Medline]
  20. Fogt F, Zimmerman RL, Hartmann CJ, Brown CA, Narula N 2002 Genetic alterations of Carney complex are not present in sporadic cardiac myxomas. Int J Mol Med 9:59–60[Medline]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
E. I Bimpaki, M. Nesterova, and C. A Stratakis
Abnormalities of cAMP signaling are present in adrenocortical lesions associated with ACTH-independent Cushing syndrome despite the absence of mutations in known genes
Eur. J. Endocrinol., July 1, 2009; 161(1): 153 - 161.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Gaujoux, F. Tissier, L. Groussin, R. Libe, B. Ragazzon, P. Launay, A. Audebourg, B. Dousset, X. Bertagna, and J. Bertherat
Wnt/{beta}-Catenin and 3',5'-Cyclic Adenosine 5'-Monophosphate/Protein Kinase A Signaling Pathways Alterations and Somatic {beta}-Catenin Gene Mutations in the Progression of Adrenocortical Tumors
J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 4135 - 4140.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Libe, A. Fratticci, J. Coste, F. Tissier, A. Horvath, B. Ragazzon, F. Rene-Corail, L. Groussin, X. Bertagna, M. L. Raffin-Sanson, et al.
Phosphodiesterase 11A (PDE11A) and Genetic Predisposition to Adrenocortical Tumors
Clin. Cancer Res., June 15, 2008; 14(12): 4016 - 4024.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
P. de Cremoux, D. Rosenberg, J. Goussard, C. Bremont-Weil, F. Tissier, C. Tran-Perennou, L. Groussin, X. Bertagna, J. Bertherat, and M.-L. Raffin-Sanson
Expression of progesterone and estradiol receptors in normal adrenal cortex, adrenocortical tumors, and primary pigmented nodular adrenocortical disease
Endocr. Relat. Cancer, June 1, 2008; 15(2): 465 - 474.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
C Vincent-Dejean, L Cazabat, L Groussin, K Perlemoine, G Fumey, F Tissier, X Bertagna, and J Bertherat
Identification of a clinically homogenous subgroup of benign cortisol-secreting adrenocortical tumors characterized by alterations of the protein kinase A (PKA) subunits and high PKA activity.
Eur. J. Endocrinol., June 1, 2008; 158(6): 829 - 839.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. S. Nadella, G. N. Jones, A. Trimboli, C. A. Stratakis, G. Leone, and L. S. Kirschner
Targeted Deletion of Prkar1a Reveals a Role for Protein Kinase A in Mesenchymal-to-Epithelial Transition
Cancer Res., April 15, 2008; 68(8): 2671 - 2677.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Nesterova, I. Bossis, F. Wen, A. Horvath, L. Matyakhina, and C. A. Stratakis
An Immortalized Human Cell Line Bearing a PRKAR1A-Inactivating Mutation: Effects of Overexpression of the Wild-Type Allele and Other Protein Kinase A Subunits
J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 565 - 571.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
R. Libe, A. Fratticci, and J. Bertherat
Adrenocortical cancer: pathophysiology and clinical management
Endocr. Relat. Cancer, March 1, 2007; 14(1): 13 - 28.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Horvath, C. Giatzakis, A. Robinson-White, S. Boikos, E. Levine, K. Griffin, E. Stein, V. Kamvissi, P. Soni, I. Bossis, et al.
Adrenal Hyperplasia and Adenomas Are Associated with Inhibition of Phosphodiesterase 11A in Carriers of PDE11A Sequence Variants That Are Frequent in the Population
Cancer Res., December 15, 2006; 66(24): 11571 - 11575.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Bourdeau, L. Matyakhina, S. G. Stergiopoulos, F. Sandrini, S. Boikos, and C. A. Stratakis
17q22-24 Chromosomal Losses and Alterations of Protein Kinase A Subunit Expression and Activity in Adrenocorticotropin-Independent Macronodular Adrenal Hyperplasia
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3626 - 3632.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Robinson-White, E. Meoli, S. Stergiopoulos, A. Horvath, S. Boikos, I. Bossis, and C. A. Stratakis
PRKAR1AMutations and Protein Kinase A Interactions with Other Signaling Pathways in the Adrenal Cortex
J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2380 - 2388.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Groussin, A. Horvath, E. Jullian, S. Boikos, F. Rene-Corail, H. Lefebvre, F.-L. Cephise-Velayoudom, M.-C. Vantyghem, P. Chanson, B. Conte-Devolx, et al.
A PRKAR1A Mutation Associated with Primary Pigmented Nodular Adrenocortical Disease in 12 Kindreds
J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1943 - 1949.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Horvath, L. Mathyakina, Q. Vong, V. Baxendale, A. L. Y. Pang, W.-Y. Chan, and C. A. Stratakis
Serial Analysis of Gene Expression in Adrenocortical Hyperplasia Caused by a Germline PRKAR1A Mutation
J. Clin. Endocrinol. Metab., February 1, 2006; 91(2): 584 - 596.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
R. Libe and J. Bertherat
Molecular genetics of adrenocortical tumours, from familial to sporadic diseases
Eur. J. Endocrinol., October 1, 2005; 153(4): 477 - 487.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. M. Swords, S. Aylwin, L. Perry, J. Arola, A. B. Grossman, J. P. Monson, and A. J. L. Clark
The Aberrant Expression of the Gastric Inhibitory Polypeptide (GIP) Receptor in Adrenal Hyperplasia: Does Chronic Adrenocorticotropin Exposure Stimulate Up-Regulation of GIP Receptors in Cushing's Disease?
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3009 - 3016.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Bertherat, V. Contesse, E. Louiset, G. Barrande, C. Duparc, L. Groussin, P. Emy, X. Bertagna, J.-M. Kuhn, H. Vaudry, et al.
In Vivo and in Vitro Screening for Illegitimate Receptors in Adrenocorticotropin-Independent Macronodular Adrenal Hyperplasia Causing Cushing's Syndrome: Identification of Two Cases of Gonadotropin/Gastric Inhibitory Polypeptide-Dependent Hypercortisolism
J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1302 - 1310.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. J. Griffin, L. S. Kirschner, L. Matyakhina, S. Stergiopoulos, A. Robinson-White, S. Lenherr, F. D. Weinberg, E. Claflin, E. Meoli, Y. S. Cho-Chung, et al.
Down-Regulation of Regulatory Subunit Type 1A of Protein Kinase A Leads to Endocrine and Other Tumors
Cancer Res., December 15, 2004; 64(24): 8811 - 8815.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. G. Lania, G. Mantovani, S. Ferrero, C. Pellegrini, S. Bondioni, E. Peverelli, P. Braidotti, M. Locatelli, M. L. Zavanone, E. Ferrante, et al.
Proliferation of Transformed Somatotroph Cells Related to Low or Absent Expression of Protein Kinase A Regulatory Subunit 1A Protein
Cancer Res., December 15, 2004; 64(24): 9193 - 9198.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
K J Griffin, L S Kirschner, L Matyakhina, S G Stergiopoulos, A Robinson-White, S M Lenherr, F D Weinberg, E S Claflin, D Batista, I Bourdeau, et al.
A transgenic mouse bearing an antisense construct of regulatory subunit type 1A of protein kinase A develops endocrine and other tumours: comparison with Carney complex and other PRKAR1A induced lesions
J. Med. Genet., December 1, 2004; 41(12): 923 - 931.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
I. Bossis and C. A. Stratakis
Minireview: PRKAR1A: Normal and Abnormal Functions
Endocrinology, December 1, 2004; 145(12): 5452 - 5458.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. A. Courcoutsakis, N. J. Patronas, D. Cassarino, K. Griffin, M. Keil, J. L. Ross, J. A. Carney, and C. A. Stratakis
Hypodense Nodularity on Computed Tomography: Novel Imaging and Pathology of Micronodular Adrenocortical Hyperplasia Associated with Myelolipomatous Changes
J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 3737 - 3738.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. F. Gunther, I. Bourdeau, L. Matyakhina, D. Cassarino, D. E. Kleiner, K. Griffin, N. Courkoutsakis, M. Abu-Asab, M. Tsokos, M. Keil, et al.
Cyclical Cushing Syndrome Presenting in Infancy: An Early Form of Primary Pigmented Nodular Adrenocortical Disease, or a New Entity?
J. Clin. Endocrinol. Metab., July 1, 2004; 89(7): 3173 - 3182.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Bertherat, L. Groussin, F. Sandrini, L. Matyakhina, T. Bei, S. Stergiopoulos, T. Papageorgiou, I. Bourdeau, L. S. Kirschner, C. Vincent-Dejean, et al.
Molecular and Functional Analysis of PRKAR1A and its Locus (17q22-24) in Sporadic Adrenocortical Tumors: 17q Losses, Somatic Mutations, and Protein Kinase A Expression and Activity
Cancer Res., September 1, 2003; 63(17): 5308 - 5319.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. Rosenberg, L. Groussin, E. Jullian, K. Perlemoine, S. Medjane, A. Louvel, X. Bertagna, and J. Bertherat
Transcription Factor 3',5'-Cyclic Adenosine 5'-Monophosphate-Responsive Element-Binding Protein (CREB) Is Decreased during Human Adrenal Cortex Tumorigenesis and Fetal Development
J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3958 - 3965.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. C. B. V. Fragoso, S. Domenice, A. C. Latronico, R. M. Martin, M. A. A. Pereira, M. C. N. Zerbini, A. M. Lucon, and B. B. Mendonca
Cushing's Syndrome Secondary to Adrenocorticotropin-Independent Macronodular Adrenocortical Hyperplasia due to Activating Mutations of GNAS1 Gene
J. Clin. Endocrinol. Metab., May 1, 2003; 88(5): 2147 - 2151.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Groussin, L.
Right arrow Articles by Bertherat, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Groussin, L.
Right arrow Articles by Bertherat, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals