| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Article |
Departments of Medicine (D.A.E., X.T., N.J.C., G.I.B.), Human Genetics (N.J.C., G.I.B.), and Biochemistry and Molecular Biology (I.Y., G.I.B.), and Howard Hughes Medical Institute (G.I.B.), University of Chicago, Chicago, Illinois 60637
Address all correspondence and requests for reprints to: David A. Ehrmann, M.D., Department of Medicine, Section of Endocrinology, University of Chicago, 5841 South Maryland Avenue, MC 1027, Chicago, Illinois 60637. E-mail: . dehrmann{at}medicine.bsd.uchicago.edu
Abstract
Insulin resistance is a key component in the pathogenesis of polycystic ovary syndrome (PCOS) and type 2 diabetes. Polymorphisms in the genes encoding the insulin receptor substrate (IRS) proteins, IRS-1 (Gly972Arg) and IRS-2 (Gly1057Asp), influence susceptibility to type 2 diabetes. This study was undertaken to assess the influence of these polymorphisms on insulin resistance, glucose tolerance, and androgen levels in nondiabetic PCOS women.
We studied 227 PCOS subjects including 126 and 48 nondiabetic white and African-American subjects, respectively. The IRS-1 Gly972Arg allele frequencies were identical in whites and African-Americans [0.95 (Gly) and 0.05 (Arg)]. The IRS-2 Gly1057Asp allele frequencies were 0.85 (Gly) and 0.15 (Asp) in African-Americans and 0.59 (Gly) and 0.41 (Asp) in whites. There was no association of IRS-1 genotype with any clinical or hormonal measure in nondiabetic white or African-American PCOS subjects. However, nondiabetic subjects with the IRS-2 Gly/Gly genotype had significantly higher 2-h oral glucose tolerance test glucose levels compared with those with Gly/Asp and Asp/Asp genotypes in whites or Gly/Asp genotype in African-Americans (there were no Asp/Asp subjects in our modest size African-American sample). These results suggest that the IRS-2 Gly1057Asp polymorphism influences blood glucose levels in nondiabetic white and African-American women with PCOS. Thus, individuals with the common IRS-2 Gly/Gly genotype may be at increased risk of developing type 2 diabetes.
POLYCYSTIC OVARY SYNDROME (PCOS) is a heterogeneous disorder characterized by menstrual irregularity, ovarian androgen overproduction, and insulin resistance (1). Insulin resistance is a key component in the pathogenesis of PCOS and the predisposition to type 2 diabetes (2); however, the mechanisms for defects in insulin signaling in the disorder are complex (3) and have not been fully elucidated.
Insulin receptor substrate (IRS) proteins are critical to signal transduction in insulin target tissues (4). Polymorphisms in the genes encoding the IRS proteins, particularly IRS-1 (Gly972Arg) and IRS-2 (Gly1057Asp), have been shown to influence susceptibility to type 2 diabetes (5). More recently, these polymorphisms have been associated with phenotypic features of PCOS (6, 7) as well as the related disorder of premature pubarche and adolescent hyperandrogenism (8).
The present study was therefore undertaken to determine whether nondiabetic women with PCOS are more likely to have evidence of insulin resistance, glucose intolerance, or hyperandrogenism in the presence of the Gly972Arg IRS-1 and Gly1057Asp IRS-2 polymorphisms.
Subjects and Methods
Subjects
All subjects were recruited from the endocrinology clinics of University of Chicago without regard to personal or family history of glucose intolerance or type 2 diabetes. All subjects were at least 2 yr postmenarche and not more than 40 yr of age. A diagnosis of PCOS required the presence of (9): 1) oligo/amenorrhea; 2) hyperandrogenemia, with a plasma free testosterone level of 34.7 pmol/liter or more; 3) hyperandrogenism, as evidenced by infertility, hirsutism, acne, or androgenetic alopecia; and 4) exclusion of nonclassical 21-hydroxylase deficiency congenital adrenal hyperplasia, Cushings syndrome, hypothyroidism, or significant elevations in serum PRL. In addition to meeting these diagnostic criteria for PCOS, often referred to as the NIH consensus criteria (10), each subject had hormonal evidence of ovarian androgen overproduction documented by an abnormal 17-hydroxyprogesterone response to GnRH agonist administration or a supranormal plasma free testosterone level after administration of dexamethasone (9). For at least 2 months before the study, subjects had not taken steroid preparations (including oral contraceptives) or medications known to alter insulin secretion and/or action. The institutional review board of University of Chicago approved all studies, and written informed consent was obtained from each subject. Previous reports (11, 12) include clinical data for a subset of the subjects reported upon in the present study.
Oral glucose tolerance test (OGTT)
All individuals, with the exception of those known to be diabetic, had an OGTT. After an overnight fast, blood samples were obtained at -15 and 0 min. A glycohemoglobin level was determined at 0 min. Dextrose (75 g) was then administered orally, and blood samples were obtained at 30, 60, 90, and 120 min for measurement of glucose and insulin concentrations. Glucose tolerance status was based upon the plasma glucose concentration at 2 h using criteria of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus of the American Diabetes Association (13). A diagnosis of normal glucose tolerance, impaired glucose tolerance, or diabetes was assigned if the glucose level at 2 h was less than 7.8 mmol/liter, between 7.8 and 11.1 mmol/liter, or 11.1 mmol/liter or more, respectively.
Hormonal measures
Serum was obtained from each subject for measurement of total testosterone, free testosterone, SHBG, and dehydroepiandrosterone sulfate.
Assay methods
Plasma glucose was measured immediately using a glucose analyzer (model 2300 STAT, YSI, Inc., Yellow Springs, OH). The coefficient of variation of this method is less than 2%. Glycohemoglobin was measured by boronate affinity chromatography with an intraassay coefficient of variation of 4% (Bio-Rad Laboratories, Inc., Hercules, CA). Serum insulin was assayed by a double antibody technique (14) with a lower limit of sensitivity of 20 pmol/liter and an average intraassay coefficient of variation of 6%. The cross-reactivity of proinsulin in the RIA for insulin is approximately 40%. Plasma C peptide was measured as previously described (15). The lower limit of sensitivity of the assay is 0.02 pmol/ml, and the intraassay coefficient of variation averaged 6%.
Plasma testosterone was measured using a kit from Diagnostic Products (Los Angeles, CA). The free fraction of plasma testosterone and the concentration of SHBG were measured by a competitive protein binding assay (9). The intra- and interassay coefficients of variation were 3.8% and 8.7%, respectively. Dehydroepiandrosterone sulfate was measured by RIA using a kit from Diagnostics Systems Laboratories (Webster, TX).
Molecular genetic studies
The sequences of the primers and probes used in the TaqMan assay for IRS-1 Gly972Arg were: primers, GGGTCGAGATGGGCAGACT and GGGACAACTCATCTGCATGGT; and probes, CTGCACCTCCCGGGGCTG (FAM probe) and CTGCACCTCCCAGGGCTGCTAG (VIC probe). The approximate melting temperatures of probes and primers were 67 C and 59 C, respectively.
The primers and probes used to type the IRS-2 Gly1057Asp polymorphism were: primers, GGAGCTGTACCGCCTGCC and ACCAAAAGCCATCTCGGTGT; probes, CCGGGCGCCGCCTCAT (FAM probe) and CGGACGCCGCCTCATCGTT (VIC probe). The approximate melting temperatures of probes and primers were 67C and 60C, respectively.
Each 25 µl PCR contained 2050 ng genomic DNA, 900 nM primers, 120 nM probes, and 12.5 µl TaqMan Universal PCR master mix (PE Applied Biosystems, Foster City, CA). PCR was carried out under the following conditions: 50 C for 2 min, 95 C for 10 min, followed by 40 cycles of 95 C for 15 sec and 62 C for 1 min. Then fluorescence in each well was measured after PCR using an ABI PRISM 7700 sequence detector (PE Applied Biosystems). TaqMan results of both single nucleotide polymorphisms were compared with sequence results in 100 samples. There was complete concordance in all instances.
Statistical analysis
All statistical analyses were performed using StatView software (SAS Institute, Inc., Cary, NC). Between-group comparisons were made using either t test or ANOVA with post hoc correction for multiple comparisons. P value less than 0.05 was considered significant. All data are presented as the mean ± SE.
Results
Clinical characteristics of the study population
We enrolled 227 PCOS subjects. Of these, 133 (59%) were white of European ancestry, 60 (26%) were African-American, 13 (6%) were Hispanic, 18 (8%) were South Asian, and 3 (1%) were of Middle Eastern origin. Because of the small number of subjects of Hispanic, South Asian, and Middle Eastern ancestry, we analyzed only white and African-American subjects. Genotype/phenotype relationships were examined only in nondiabetic subjects to avoid the confounding effects of diabetes on measures of insulin secretion and action.
IRS-1 and IRS-2 allele frequencies
IRS-1 and -2 allele frequencies were calculated in both nondiabetic white and African-American subjects. For IRS-1, the Gly972Arg allele frequencies were identical in these two groups [0.95 (Gly) and 0.05 (Arg)]. In contrast, the Gly1057Asp allele frequencies in IRS-2 differed between the two groups. Among whites, the Gly and Asp alleles were present with frequencies of 0.59 and 0.41, respectively. These alleles were present in African-Americans with frequencies of 0.85 and 0.15, respectively.
Allele frequencies were also calculated in the 13 white and 12 African-American subjects with type 2 diabetes. In white diabetics, the IRS-1 allele frequencies were 1.0 (Gly) and 0 (Arg); in African-Americans, the frequencies were 0.96 (Gly) and 0.04 (Arg). Allele frequencies for IRS-2 in white diabetics were 0.85 (Gly) and 0.15 (Asp); in African-Americans the frequencies were 0.88 (Gly) and 0.12 (Asp).
IRS-1 Gly972Arg genotype and PCOS phenotypes
There were no significant differences in any clinical or hormonal measures between subjects on the basis of IRS-1 genotype in nondiabetic white and African-American subjects, analyzed separately or in combination (data not shown).
IRS-2 Gly1057Asp genotype and PCOS phenotypes
White PCOS subjects with the IRS-2 Gly/Gly genotype had higher levels of glucose at 2 h during the OGTT (8.0 ± 0.3 mmol/liter) compared with those with either the Gly/Asp (7.2 ± 0.2 mmol/liter; P < 0.01) or Asp/Asp (6.8 ± 0.2 mmol/liter; P < 0.01) genotype (Table 1
). This was also evident in nondiabetic African-American subjects; those with the Gly/Gly genotype had a mean 2 h glucose concentration of 8.0 ± 0.4 mmol/liter compared with those with the Gly/Asp genotype (6.8 ± 0.4 mmol/liter; P = 0.05; Table 2
). Comparison of nondiabetic white PCOS subjects with the Gly/Gly genotype to the combined group of subjects with the Gly/Asp or Asp/Asp genotype did not reveal any additional between-group differences.
|
|
PCOS affects up to 10% of reproductive age women, nearly half of whom will develop impaired glucose tolerance or type 2 diabetes (16, 17). This predisposition to type 2 diabetes is a consequence of defects in both insulin action (3) and insulin secretion (18, 19). Although there is evidence for heritability of these defects in PCOS families (20, 21), genetic abnormalities that can fully account for this heritability have not been identified.
Recently, several polymorphisms in IRS-1 and IRS-2 have been implicated in PCOS (6, 7) as well as the related disorder of premature pubarche and adolescent hyperandrogenism (8). Evidence for a gene dosage effect of the Gly972Arg IRS-1 variant on fasting insulin and homeostasis model assessment (HOMA) values has been reported among PCOS women (6). The Gly1057Asp variant of IRS-2 also appeared to have a gene dosage effect on 2 h glucose and 2 h insulin on OGTT (6).
In the present study we examined the relationship of the IRS-1 Gly972Arg and IRS-2 Gly1057Asp polymorphisms to phenotypic features of PCOS in nondiabetic white and African-American subjects. We found no evidence for an effect of the IRS-1 Gly972Arg polymorphism on glucose or insulin levels during an OGTT or on androgen levels in either white or African-American women with PCOS. Thus, our results provide no support for the association of this polymorphism with either fasting insulin or HOMA values, as reported previously (6).
However, we found that the IRS2 Gly1057Asp polymorphism was associated with lower glucose concentrations at the 2-h point on OGTT in both white and African-American nondiabetic women with PCOS. Although this finding contrasts with that previously reported in PCOS (6), it is consistent with results of other studies (22, 23), in which there was an association between this polymorphism and type 2 diabetes, with the risk of type 2 diabetes decreasing in relation to the dosage of the Gly allele. Possible causes for the difference in our findings from those previously reported in PCOS (6) include differences in criteria used to define PCOS as well as the fact that we did not stratify subjects on the basis of measures of insulin resistance or hyperinsulinemia. Our findings are also consistent with recent evidence that IRS-2 plays an important role in mediating the compensatory ß-cell response and the maintenance of normoglycemia in animals with progressive insulin resistance (24).
We thus conclude that the common Gly1057Asp polymorphism in IRS-2 appears to influence susceptibility to type 2 diabetes in African-American and white women with PCOS.
Acknowledgments
Footnotes
This work was supported by grants from the USPHS (DK-20595, DK-47486, DK-55889, and RR-00055), a Research Award from the American Diabetes Association (to D.A.E.), and a gift from the Blum-Kovler Foundation.
Abbreviations: HOMA, Homeostasis model assessment; IRS, insulin receptor substrate; OGTT, oral glucose tolerance test; PCOS, polycystic ovary syndrome.
Received February 12, 2002.
Accepted May 28, 2002.
References
gene. J Clin Endocrinol Metab 87:772775This article has been cited by other articles:
![]() |
M. Simoni, C.B. Tempfer, B. Destenaves, and B.C.J.M. Fauser Functional genetic polymorphisms and female reproductive disorders: Part I: polycystic ovary syndrome and ovarian response Hum. Reprod. Update, September 1, 2008; 14(5): 459 - 484. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Li, X. Yin, E. J. Zmuda, C. C. Wolford, X. Dong, M. F. White, and T. Hai The Repression of IRS2 Gene by ATF3, a Stress-Inducible Gene, Contributes to Pancreatic {beta}-Cell Apoptosis Diabetes, March 1, 2008; 57(3): 635 - 644. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sweeney, R. K. Wolff, T. Byers, K. B. Baumgartner, A. R. Giuliano, J. S. Herrick, M. A. Murtaugh, W. S. Samowitz, and M. L. Slattery Genetic Admixture among Hispanics and Candidate Gene Polymorphisms: Potential for Confounding in a Breast Cancer Study? Cancer Epidemiol. Biomarkers Prev., January 1, 2007; 16(1): 142 - 150. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gonzalez, M.E. Saez, M.J. Aragon, J.J. Galan, P. Vettori, L. Molina, C. Rubio, L.M. Real, A. Ruiz, and R. Ramirez-Lorca Specific haplotypes of the CALPAIN-5 gene are associated with polycystic ovary syndrome Hum. Reprod., April 1, 2006; 21(4): 943 - 951. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Diamanti-Kandarakis and C. Piperi Genetics of polycystic ovary syndrome: searching for the way out of the labyrinth Hum. Reprod. Update, November 1, 2005; 11(6): 631 - 643. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Villuendas, J. I. Botella-Carretero, B. Roldan, J. Sancho, H. F. Escobar-Morreale, and J. L. S. Millan Polymorphisms in the insulin receptor substrate-1 (IRS-1) gene and the insulin receptor substrate-2 (IRS-2) gene influence glucose homeostasis and body mass index in women with polycystic ovary syndrome and non-hyperandrogenic controls Hum. Reprod., November 1, 2005; 20(11): 3184 - 3191. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sweeney, M. A. Murtaugh, K. B. Baumgartner, T. Byers, A. R. Giuliano, J. S. Herrick, R. Wolff, B. J. Caan, and M. L. Slattery Insulin-Like Growth Factor Pathway Polymorphisms Associated with Body Size in Hispanic and Non-Hispanic White Women Cancer Epidemiol. Biomarkers Prev., July 1, 2005; 14(7): 1802 - 1809. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ertunc, E.C. Tok, A. Aktas, E.M. Erdal, and S. Dilek The importance of IRS-1 Gly972Arg polymorphism in evaluating the response to metformin treatment in polycystic ovary syndrome Hum. Reprod., May 1, 2005; 20(5): 1207 - 1212. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. F. Escobar-Morreale, M. Luque-Ramirez, and J. L. San Millan The Molecular-Genetic Basis of Functional Hyperandrogenism and the Polycystic Ovary Syndrome Endocr. Rev., April 1, 2005; 26(2): 251 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Ehrmann Polycystic Ovary Syndrome N. Engl. J. Med., March 24, 2005; 352(12): 1223 - 1236. [Full Text] [PDF] |
||||
![]() |
D. A. Ehrmann, K. Kasza, R. Azziz, R. S. Legro, M. N. Ghazzi, and for the PCOS/Troglitazone Study Group Effects of Race and Family History of Type 2 Diabetes on Metabolic Status of Women with Polycystic Ovary Syndrome J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 66 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Slattery, W. Samowitz, K. Curtin, K. N. Ma, M. Hoffman, B. Caan, and S. Neuhausen Associations among IRS1, IRS2, IGF1, and IGFBP3 Genetic Polymorphisms and Colorectal Cancer Cancer Epidemiol. Biomarkers Prev., July 1, 2004; 13(7): 1206 - 1214. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gonzalez, E. Abril, A. Roca, M. J. Aragon, M. J. Figueroa, P. Velarde, R. Ruiz, O. Fayez, J. J. Galan, J. A. Herreros, et al. Specific CAPN10 Gene Haplotypes Influence the Clinical Profile of Polycystic Ovary Patients J. Clin. Endocrinol. Metab., November 1, 2003; 88(11): 5529 - 5536. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Stefan, P. Kovacs, M. Stumvoll, R. L. Hanson, A. Lehn-Stefan, P. A. Permana, L. J. Baier, P. A. Tataranni, K. Silver, and C. Bogardus Metabolic Effects of the Gly1057Asp Polymorphism in IRS-2 and Interactions With Obesity Diabetes, June 1, 2003; 52(6): 1544 - 1550. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |