| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Department of Molecular Medicine (K.I., H.N., N.M., S.Y.), Tissue and Histopathology Section (M.N.), Division of Scientific Data Registry, Department of Molecular Pathology, Atomic Bomb Disease Institute (T.N.), Departments of Pathology (T.H.) and Surgery II (K.I., S.M., T.K.), Nagasaki University School of Medicine, Nagasaki 852-8523, Japan; and Department of Nutrition and Health Sciences (M.I.), Siebold University of Nagasaki, Nagayo 851-2195, Japan
Address all correspondence and requests for reprints to: A/Prof. Hiroyuki Namba, M.D., Department of Molecular Medicine, Atomic Bomb Disease Institute, Nagasaki University School of Medicine, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan. E-mail: . namba{at}net.nagasaki-u.ac.jp
Abstract
Alterations of the Wnt/ß-catenin signaling pathway are known to occur in mutations of the component genes such as APC, Axin, and ß-catenin, and play a pathogenetic role in tumorigenesis. Activated Wnt signaling stabilizes ß-catenin, which associates with T cell factor, resulting in transactivation of the downstream target genes including c-myc and cyclin D1. To investigate the involvement of Wnt/ß-catenin signaling pathway in thyroid tumorigenesis, we analyzed its activation and localization in 5 human thyroid cancer cell lines and 132 thyroid tumor tissue samples. Dislocalization of ß-catenin was observed in all cell lines. Constitutive activation of T cell factor in two of four thyroid cancer cell lines was observed using reporter gene assay. Furthermore, high expression levels of c-Myc and cyclin D1 were observed in cell lines that showed cytoplasmic or nuclear accumulation of ß-catenin. In 132 paraffin-embedded thyroid carcinoma tissue samples, cytoplasmic ß-catenin was immunohistochemically observed in 52 out of 78 (67%) papillary thyroid cancers, but only in 3 of 34 (9%) follicular adenomas and 5 of 20 (25%) follicular cancers. Cytoplasmic localization of ß-catenin significantly correlated with overexpression of cyclin D1 in papillary carcinomas. Our results suggest that aberrant activation of Wnt/ß-catenin signaling is strongly involved in thyroid tumorigenesis.
THE Wnt SIGNALING pathway plays a critical role in development and organogenesis (1, 2, 3). Recent studies have described in detail the role of Wnt/ß-catenin signaling cascade in normal and cancer cells (4).
Three molecules, a constitutively active serine kinase, called glycogen synthase kinase-3 (GSK3), adenomatous polyposis coli (APC), and the scaffolding protein Axin, are associated with ß-catenin in the cytoplasm. ß-catenin is usually phosphorylated by GSK3 and is subsequently targeted by ubiquitination for rapid proteasomal degradation. During fetal development, Wnt ligands activate Frizzled receptor in the membrane, leading to inactivation of GSK3 through intermediary molecules including Dishevelled and GSK3-binding protein. This results in accumulation of ß-catenin in the cytoplasm and its subsequent translocation to the nucleus, where it forms a complex with the nuclear transcriptional regulator T cell factor (TCF), finally resulting in the binding of downstream genes and promotion of transcriptional activation. Cell cycle modulatory genes, c-myc and cyclin D1, have been identified as TCF downstream genes (5, 6).
In this regard, previous studies have shown that signal dysregulation by gene mutation of molecules involved in the formation of the ß-catenin cytoplasmic complex in Wnt pathway results in accumulation of ß-catenin in the cytoplasm or nucleus because ß-catenin becomes resistant to degradation (7, 8). Moreover, aberrant Wnt/ß-catenin signaling pathway is often observed in various cancers. Mutations of APC gene are found in all hereditary colon cancers associated with familial polyposis coli (FAP) and more than 80% of sporadic colorectal cancers. Mutations of ß-catenin gene have been identified in APC-wild-type colon tumors and at varying frequencies in other types of tumors, including hair-follicle tumors and hepatocellular carcinomas (HCC) (9, 10, 11). Recent studies have demonstrated the mutations of Axin 1 and Axin 2 genes in HCCs without mutations of ß-catenin gene and in colorectal cancers with defective DNA mismatch repair, respectively (12, 13). Furthermore, involvement of activated Wnt/ß-catenin signaling in tumorigenesis has been demonstrated in vivo using APC gene targeting mouse (14).
A high incidence of papillary thyroid carcinoma has been reported in patients with FAP (15, 16), and frequent mutations of ß-catenin are observed in anaplastic thyroid cancer (17). In addition, high expression levels of c-Myc and/or cyclin D1 are often observed in sporadic differentiated thyroid cancers (18, 19). Taking into consideration the above findings, we hypothesized that aberrant activation of Wnt/ß-catenin signaling pathway might be involved in thyroid tumorigenesis. To test our hypothesis, we analyzed the Wnt/ß-catenin signaling pathway in human thyroid cancer cell lines and thyroid tumor tissues. Our results showed aberrant localization of ß-catenin in the cytoplasm and nuclei and increased transactivation of TCF in human thyroid cancer cell lines. We also observed cytoplasmic accumulation of ß-catenin, which significantly correlated with cyclin D1 overexpression, in papillary thyroid cancer tissues.
Materials and Methods
Cell culture and materials
Human thyroid cells in primary culture were isolated from thyroid tissues during subtotal thyroidectomy in patients with Graves disease and cultured as described previously (20). Four human thyroid cancer cell lines, ARO, FRO, NPA, and WRO, were kindly provided by Dr. G. Juillard (UCLA, Los Angeles, CA). FRO and ARO cell lines were originally established from human anaplastic thyroid cancer, NPA cell line was from human papillary thyroid cancer and WRO cell line was from human follicular thyroid cancer. Another papillary thyroid cancer cell line, TPC-1 cell was kindly provided by Dr. Sato (Cancer Institute, Kanazawa University, Japan). All cell lines were cultured in Roswell Park Memorial Institute 1640 medium supplemented with 10% fetal bovine serum and grown at 37 C in 5% CO2-95% air environment.
Thyroid tissue tumors were selected from 132 paraffin blocks (78 papillary carcinomas, 20 follicular carcinomas, and 34 follicular adenomas) filed at the Department of Pathology, Nagasaki University School of Medicine and Ishigaki Thyroid Clinic (Hamamatsu, Japan). All thyroid tumors were independently reclassified by two experienced pathologists according to histological typing of the WHO as papillary carcinoma, follicular carcinoma, or follicular adenoma.
Correlations between ß-catenin immunoreactivity and various clinicopathological parameters were examined. For this purpose, the medical records of patients from whom tissue samples were obtained for analysis were examined and various clinicopathological parameters were reported. Recurrence was examined at a median postoperative follow-up period of 2.5 yr. The study protocol was approved by the Human Ethics Review Committees of the participating institutions.
TCF4 reporter-gene assays
Firefly luciferase reporter plasmids, in which four copies of TCF4-specific DNA-binding sequence (TBE2) or its mutant sequence (TBE2m) were inserted into pGL3-basic vector (Promega Corp., Madison, WI), were kindly provided by Prof. Y. Nakamura (The University of Tokyo, Tokyo, Japan) (12). The reporter plasmids were transfected into cells using lipofectin reagent (Invitrogen Life Technologies, Carlsbad, CA) using the protocol provided by the manufacturer. A Renilla luciferase plasmid vector, pRL-TK (Promega Corp.), was cotransfected with each pGL3 reporter construct into the cells to normalize for transfection efficiency. Twenty-four hours after transfection, cells were harvested and assayed using a Dual-Luciferase Reporter Assay System (Promega Corp.).
Immunoblot analysis
Whole cell lysates were separated by electrophoresis in 10% SDS-PAGE, then blotted onto nitrocellulose membrane (Amersham Pharmacia Biotech, Buckinghamshire, UK). To determine the levels of ß-catenin, cyclin D1, and c-Myc, the blots were incubated for 60 min with the respective antibody against human ß-catenin (BD Transduction Laboratories, Franklin Lakes, NJ), cyclin D1 (H-295; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and c-Myc (9E10; BIOMOL Research Laboratories, Inc., Plymouth Meeting, PA). The antigen-antibody complexes were visualized with horseradish peroxidase-conjugated antimouse IgG antibody and the electrochemiluminescence system (Amersham Pharmacia Biotech).
Immunocytochemistry and immunohistochemistry
Cultured cells replated on chamber slides were fixed with 4% paraformaldehyde for 10 min and then treated with 100% ethanol for 2 min. After incubation with 10% heat-inactivated goat serum for 60 min at room temperature, the cells were incubated with a mouse anti-ß-catenin antibody (diluted 1:250) in blocking solution. Antibodies were stained with an antimouse secondary antibody conjugated to rhodamine (Santa Cruz Biotechnology, Inc.), and viewed on a Carl Zeiss (Heidelberg, Germany) Axiphot microscope.
Paraffin-embedded tissues of thyroid tumors were deparaffinized in xylene and rehydrated in PBS. Antigen unmasking was accomplished by heating three times in 200 ml PBS in a microwave oven at 50% power for 4 min each, and then the slides were washed with 0.01 M PBS for 10 min. Endogenous peroxidase activity was blocked with 0.3% H2O2-methanol for 10 min. After washing three times with 0.01 M PBS for 5 min each, sections were blocked with 1% BSA for 15 min. After rinsing with phosphate buffer, primary mouse monoclonal antibody, anti-ß-catenin antibody (diluted 1:100) or anticyclin D1 antibody (diluted 1:50, Zymed Laboratories, Inc., South San Francisco, CA) was then applied overnight to the sections at 4 C. The second immunohistochemical reaction for ß-catenin was visualized using biotinylated horse antimouse IgG antibody with avidin-peroxidase and diaminobenzidine. The reaction for cyclin D1 was visualized using alkaline phosphatase-conjugated antimouse IgG antibody with a mixture of 5-bromo-4-chloro-indolyl phosphate and nitroblue tetrazolium chloride color development. Under x200 magnification, the staining frequencies of cyclin D1 in each component were evaluated semiquantitatively by three observers, as follows: 2+ = >30%, + = 530%, - = <5%.
Sequencing
Genomic DNA extracted from cell lines was amplified for analysis of mutations in exon 3 of ß-catenin gene and exon 7 of Axin 2 gene by PCR using primers specific for the third coding exon of ß-catenin (sense: GCTGATTTGATGGAGTTGGA; antisense: GCTACTTGTTCTTGAGTGA) and the seventh coding exon of Axin 2 (sense: AACCCAGTTTCTTTCCTTCT; antisense: ATCCCTGCCTCAACCTA). Total RNAs were extracted from five cell lines using Isogen Reagent (Wako, Osaka, Japan) according to the protocol recommended by the manufacturer. We amplified Axin 1 cDNA by RT-PCR using four sets of primers specific for Axin 1 entire coding region (sense 1: GGAAGCAGAGAAAGTACTGG; antisense 1: TCCTTTTCCCCCTCAATGAT; sense 2: GAGGAAAACACCTATCCCTCCT; antisense 2: TCCTCACCTTCCTCCTCCAT; sense 3: GCGGGACAGATTGATTCAC; antisense 3: TCCATAGTGGCCTGGATTTC; sense 4: GAAATGCCAAGAAGGCTGAG, antisense 4: GCCGATGATCTTCTCCTCAA). APC cDNA (codon 131-1614) was also amplified using 10 sets of specific primers. The amplified products were sequenced using SQ-5500 DNA Sequencer (Hitachi Corp., Tokyo, Japan) with a Thermo Sequenase Sequencing Kit (Amersham Pharmacia Biotech).
Statistical analysis
Data were expressed as mean ± SD. Differences between groups were examined for statistical significance using one-way ANOVA followed by Fisher test. Data shown (see Tables 35![]()
![]()
) were analyzed using the Mann-Whitneys U test. A P value less than 0.05 denoted the presence of a significant difference.
|
|
|
Localization of ß-catenin in human thyroid cancer cell lines
To examine the distribution of ß-catenin in thyroid cancer cells, we performed immunocytochemical analysis using primary cultures of Graves thyroid cells and five human thyroid cell lines. ß-catenin staining was identified mainly in the plasma membrane in primary culture cells, indicating the lack of ß-catenin accumulation in the cytoplasm (Fig. 1A
). In contrast, aberrant localization of ß-catenin was noted in all thyroid cancer cell lines. Nuclear accumulation of ß-catenin was observed in papillary cancer cell line, TPC-1 (Fig. 1B
), and a strong cytoplasmic staining pattern was observed in another papillary cancer cell line, NPA (Fig. 1C
). Furthermore, ß-catenin staining was noted in the cell membrane and cytoplasm of anaplastic cancer cell line, ARO, which were characterized by round shape cells and scanty cytoplasm (Fig. 1D
). A faint cytoplasmic staining was observed in another anaplastic cancer cell line, FRO (Fig. 1E
). Diffuse and weak staining in the cytoplasm and obvious staining at cell-cell junction were observed in follicular cancer cell line, WRO (Fig. 1F
). Table 1
summarizes the results of ß-catenin immunostaining of the cells used in the present study.
|
|
Activation of Wnt/ß-catenin signaling pathway is associated with translocation of ß-catenin into nucleus, where it forms a complex with transcription factor TCF4. The ß-catenin/TCF4 complex binds to various target-genes through the responsive element, known as TCF4-binding motif (TBE2), and subsequently transactivates the genes. To investigate whether Wnt/ß-catenin signaling is aberrantly activated in thyroid cancer cell lines, we performed TCF reporter gene assay. Plasmids containing four consensus TBE2 or mutant TCF-binding motif (TBE2m) upstream of a luciferase reporter gene were transfected into thyroid cancer cell lines. Transfection of plasmids containing TBE2 in ARO and NPA cells resulted in 3.0 ± 0.5- and 3.6 ± 0.4-fold increase of transcriptional activity, respectively (control vs. TBE2; P < 0.05). No such change in transcriptional activity was noted in these cells when plasmids containing TBE2m were transfected (Fig. 2
). Furthermore, no increase in transcriptional activity was observed by transfection of plasmids containing TBE2 in FRO and WRO cells. The transcriptional activity could not be determined for TCF in TPC-1 cell line because of the extremely low transfection efficiency.
|
To examine whether Wnt/ß-catenin signaling pathway is functionally activated in thyroid cancer cells, we examined the expression of ß-catenin and TCF downstream molecules, c-Myc and cyclin D1 by immunoblotting (Fig. 3
). Strong ß-catenin immunoreactive bands were detected in NPA and TPC-1 cells. Consistent with the high ß-catenin protein level, increased expression of c-Myc and cyclin D1 was observed in NPA and TPC-1 cells. Although immunoblotting showed weak expression of ß-catenin in ARO cell line, high expression levels of c-Myc and cyclin D1 were noted. This discrepancy needs to be examined in more detail in future studies because the results of immunoblot analysis in ARO cell line were not consistent with other experiments. Considered together with the results of cytoplasmic accumulation of ß-catenin and increased transcriptional activity, however, the increased expression of c-Myc and cyclin D1 is probably due to Wnt/ß-catenin signaling activation in ARO cells. These results indicate that accumulation of ß-catenin protein correlated with increased expression levels of c-Myc and cyclin D1 in cell lines.
|
Zeki et al. (21) reported that thyroid cancer cell lines, NPA, WRO, and FRO had no mutations in exons 14 and 15 of APC gene, whereas ARO cells showed a single adenine insertion at codon 1556, although it was a heterozygous mutation. Because the insert mutation resulted in APC truncated protein, it might contribute to the increased TCF transcriptional activation in ARO cells. To further investigate the cause of aberrant Wnt/ß-catenin activation in thyroid cancer cell lines, mutation analyses of ß-catenin, APC, Axin 1, and Axin 2 genes were performed in all cell lines. We analyzed exon 3 of ß-catenin gene that contains the phosphorylation site for ubiquitination, the APC cDNA (codon 135-1614), entire coding region of Axin 1 gene and exon 7 of Axin 2 gene by sequencing because all gene mutations are found in these regions (9, 10, 11, 12, 13, 22). While heterozygous mutation at codon 1556 in APC gene was confirmed in ARO cells in this study, there was no mutation or deletion of ß-catenin, APC, Axin 1, and Axin 2 genes in the other four thyroid cancer cell lines (Table 2
).
|
To verify the activation of Wnt/ß-catenin signaling pathway in thyroid cancers in vivo, we examined the expression and distribution of ß-catenin in 132 thyroid tumor tissues (34 follicular adenomas, 20 follicular cancers, and 78 papillary cancers) by using immunohistochemistry. ß-catenin immunoreactivity was mainly localized in the plasma membrane in 31 of 34 (91%) follicular adenomas (Fig. 4A
). On the other hand, cytoplasmic staining of ß-catenin was observed in 3 of 34 (9%) follicular adenomas, 5 of 20 (25%) follicular cancers and in 52 of 78 (67%) papillary cancers (Fig. 4B
and Table 3
). We also examined cyclin D1 immunoreactivity in 78 papillary thyroid cancers. Overexpression of cyclin D1 was identified in the nuclei of 64/78 (82%) papillary cancer cells, which correlated significantly with cytoplasmic ß-catenin immunoreactivity (cytoplasm vs. membrane: 46/52 (88%) vs. 18/26 (69%), respectively; P < 0.01, Fig. 4
, C and D, and Table 4
). Interestingly, foci exhibiting both cytoplasmic and membranous expression of ß-catenin were detected in some papillary thyroid cancers. In sections double-stained with ß-catenin and cyclin D1 antibodies, overexpression of cyclin D1 was only observed in cancer cells with cytoplasmic ß-catenin (Fig. 4E
).
|
Discussion
The major findings of the present were: 1) aberrant activation of- Wnt/ß-catenin signaling in human thyroid cancer cell lines, and 2) dislocalization of ß-catenin correlated significantly with overexpression of cyclin D1 in papillary thyroid cancer tissues. Our results suggest that aberrant activation of Wnt/ß-catenin signaling promotes the cell cycle via downstream molecules in thyroid papillary cancer in vivo.
Among the component molecules constituting the Wnt/ß-catenin signaling, somatic mutations in ß-catenin, APC, Axin 1, and Axin 2 genes have been detected in a variety of cancer tissues, e.g. colon cancer and HCC (23). In addition to these three related genes, Wnt-1, Wnt-3, or Wnt-10b of Wnt ligands, which form at least 16 members in vertebrates, can promote neoplastic transformation in mice (24, 25). Transformation of wnt genes or overexpression of FzE3 gene, a member of Wnt receptor gene, results in accumulation of ß-catenin in cultured mammalian cells (26, 27). Moreover, frequent mutations in tcf-4 gene that can change TCF-4 transactivating properties have been detected in a subset of colorectal tumors (28). The expression of a chimeric protein consisting of the TCF DNA binding sequence fused to the transcriptional activation domain of either VP16 or the estrogen receptor results in their neoplastic transformation in fibroblasts of the chick embryo (29). Thus, dysregulation of any molecule constituting the Wnt/ß-catenin signaling system seems to promote tumorigenesis.
A few studies have indicated a link between Wnt/ß-catenin signaling and thyroid tumors. APC gene mutations are quite rare in thyroid tumors (21), and ß-catenin gene mutations are limited to anaplastic thyroid cancer (17). Previous immunochemical studies revealed a reduction of ß-catenin bound to the cell surface in both follicular and papillary thyroid cancers lacking mutations of ß-catenin gene (30, 31, 32). However, we observed cytoplasmic ß-catenin staining in papillary thyroid cancers rather than follicular type thyroid tumors.
ß-catenin acts as an integral component of adherens junctions in addition to being a component of the Wnt signaling. ß-catenin links to E-cadherin, a major cell-cell adhesion molecule, with two other catenin members (
and
) at pericellular membrane (33). E-cadherin is located in adherens junctions of the basolateral domain and is responsible for cell-cell adhesion (34). The interaction between E-cadherin and catenins is crucial for anchoring the actin cytoskeleton to the intercellular adherent junctions, and plays an important role in the regulation of cell polarity (35). Thyroid epithelial cells are highly polarized cells with a restricted distribution of plasma membrane protein that are segregated into two structurally and functionally distinct domains (apical and basolateral).
Previous studies have shown reduced or no expression of E-cadherin in thyroid cancers compared with normal thyroid tissues (36, 37, 38, 39). Because E-cadherin is under the control of the TSH-cAMP-dependent pathway (40), unresponsiveness of TSH in thyroid cancer (41) may cause dysregulation of E-cadherin expression and loss of interaction with ß-catenin. Once the interaction between E-cadherin and ß-catenin is lost in normal thyroid epithelial cells, the regular polarity disappears and cells do not form the follicular structure or they transform into a papillary phenotype. Thereafter, ß-catenin liberated from the E-cadherin-ß-catenin complex may activate Wnt signaling pathway, resulting in cell proliferation.
Furthermore, a high ratio of ret/PTC rearrangement has been observed in thyroid cancers associated with FAP (42). Although only the TPC-1 cell line exhibited ret/PTC1 rearrangement among five cell lines used in this study (data not shown), it is conceivable that aberrant Wnt/ß-catenin signaling activation may cooperate with the activated tyrosine kinase pathway to promote thyroid tumorigenesis. The latter conclusion is made based on the multistep theory of carcinogenesis (43).
With regard to clinical relevance, we did not find any correlation between cytoplasmic ß-catenin staining pattern and various clinicopathological parameters. Previous studies have demonstrated that cyclin D1 expression has a prognostic value in papillary cancers (44, 45). Because cyclin D1 overexpression was observed in 18 of 26 (69%) papillary thyroid cancers showing membranous ß-catenin expression, not only activated Wnt/ß-catenin signaling pathway but also activated non-Wnt/ß-catenin signals including ras-MAPK pathway induce the expression of cyclin D1. Therefore, cytoplasmic staining for ß-catenin is less significant as a prognostic factor than cyclin D1 overexpression in papillary thyroid cancers. However, most thyroid cancers are diagnosed at early stages because of the anatomical location of the gland in the anterior aspect of the neck and are often excised surgically when they are relatively small in size. Nevertheless, the proportions of large tumor (>40 mm) and those with extrathyroidal invasion and cytoplasmic expression of ß-catenin exceed those of tumors exhibiting membranous ß-catenin (Table 5
). Further studies are necessary to evaluate the prognostic value of cytoplasmic expression of ß-catenin in thyroid cancer.
In conclusion, our study provided experimental evidence for dysregulation of Wnt/ß-catenin signaling that correlates with overexpression of cell cycle regulating molecules in thyroid papillary cancers. The aberrant activation of Wnt/ß-catenin signaling by epigenetic events or genetic mutations may be closely linked to papillary thyroid carcinogenesis.
Acknowledgments
We thank Dr. Jitsuhiro Ishigaki (Ishigaki Thyroid Clinic, Hamamatsu, Japan) for collecting paraffin-embedded tissue blocks, and Tomoko Kamiya for the excellent technical assistance.
Footnotes
Abbreviations: APC, Adenomatous polyposis coli; FAP, familial polyposis coli; GSK3, glycogen synthase kinase-3; HCC, hepatocellular carcinomas; TBE2 or TBE2m, TCF4-specific DNA-binding sequence or its mutant sequence; TCF, T cell factor.
Received July 13, 2001.
Accepted March 23, 2002.
References
-catenin expression in thyroid carcinomas. J Pathol 185:267272[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. S. Rao, N. Kremenevskaja, R. von Wasielewski, V. Jakubcakova, S. Kant, J. Resch, and G. Brabant Wnt/{beta}-Catenin Signaling Mediates Antineoplastic Effects of Imatinib Mesylate (Gleevec) in Anaplastic Thyroid Cancer J. Clin. Endocrinol. Metab., January 1, 2006; 91(1): 159 - 168. [Abstract] [Full Text] [PDF] |
||||
![]() |
A S Rao, N Kremenevskaja, J Resch, and G Brabant Lithium stimulates proliferation in cultured thyrocytes by activating Wnt/{beta}-catenin signalling Eur. J. Endocrinol., December 1, 2005; 153(6): 929 - 938. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liu, S. L. Asa, and S. Ezzat 1{alpha},25-Dihydroxyvitamin D3 Targets PTEN-Dependent Fibronectin Expression to Restore Thyroid Cancer Cell Adhesiveness Mol. Endocrinol., September 1, 2005; 19(9): 2349 - 2357. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ying, H. Suzuki, H. Furumoto, R. Walker, P. Meltzer, M. C. Willingham, and S.-Y. Cheng Alterations in genomic profiles during tumor progression in a mouse model of follicular thyroid carcinoma Carcinogenesis, September 1, 2003; 24(9): 1467 - 1479. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |