help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ishigaki, K.
Right arrow Articles by Yamashita, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ishigaki, K.
Right arrow Articles by Yamashita, S.
The Journal of Clinical Endocrinology & Metabolism Vol. 87, No. 7 3433-3440
Copyright © 2002 by The Endocrine Society

Other Original Articles

Aberrant Localization of ß-Catenin Correlates with Overexpression of Its Target Gene in Human Papillary Thyroid Cancer

Katsu Ishigaki, Hiroyuki Namba, Masahiro Nakashima, Toshiyuki Nakayama, Norisato Mitsutake, Tomayoshi Hayashi, Shigeto Maeda, Makoto Ichinose, Takashi Kanematsu and Shunichi Yamashita

Department of Molecular Medicine (K.I., H.N., N.M., S.Y.), Tissue and Histopathology Section (M.N.), Division of Scientific Data Registry, Department of Molecular Pathology, Atomic Bomb Disease Institute (T.N.), Departments of Pathology (T.H.) and Surgery II (K.I., S.M., T.K.), Nagasaki University School of Medicine, Nagasaki 852-8523, Japan; and Department of Nutrition and Health Sciences (M.I.), Siebold University of Nagasaki, Nagayo 851-2195, Japan

Address all correspondence and requests for reprints to: A/Prof. Hiroyuki Namba, M.D., Department of Molecular Medicine, Atomic Bomb Disease Institute, Nagasaki University School of Medicine, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan. E-mail: . namba{at}net.nagasaki-u.ac.jp

Abstract

Alterations of the Wnt/ß-catenin signaling pathway are known to occur in mutations of the component genes such as APC, Axin, and ß-catenin, and play a pathogenetic role in tumorigenesis. Activated Wnt signaling stabilizes ß-catenin, which associates with T cell factor, resulting in transactivation of the downstream target genes including c-myc and cyclin D1. To investigate the involvement of Wnt/ß-catenin signaling pathway in thyroid tumorigenesis, we analyzed its activation and localization in 5 human thyroid cancer cell lines and 132 thyroid tumor tissue samples. Dislocalization of ß-catenin was observed in all cell lines. Constitutive activation of T cell factor in two of four thyroid cancer cell lines was observed using reporter gene assay. Furthermore, high expression levels of c-Myc and cyclin D1 were observed in cell lines that showed cytoplasmic or nuclear accumulation of ß-catenin. In 132 paraffin-embedded thyroid carcinoma tissue samples, cytoplasmic ß-catenin was immunohistochemically observed in 52 out of 78 (67%) papillary thyroid cancers, but only in 3 of 34 (9%) follicular adenomas and 5 of 20 (25%) follicular cancers. Cytoplasmic localization of ß-catenin significantly correlated with overexpression of cyclin D1 in papillary carcinomas. Our results suggest that aberrant activation of Wnt/ß-catenin signaling is strongly involved in thyroid tumorigenesis.

THE Wnt SIGNALING pathway plays a critical role in development and organogenesis (1, 2, 3). Recent studies have described in detail the role of Wnt/ß-catenin signaling cascade in normal and cancer cells (4).

Three molecules, a constitutively active serine kinase, called glycogen synthase kinase-3 (GSK3), adenomatous polyposis coli (APC), and the scaffolding protein Axin, are associated with ß-catenin in the cytoplasm. ß-catenin is usually phosphorylated by GSK3 and is subsequently targeted by ubiquitination for rapid proteasomal degradation. During fetal development, Wnt ligands activate Frizzled receptor in the membrane, leading to inactivation of GSK3 through intermediary molecules including Dishevelled and GSK3-binding protein. This results in accumulation of ß-catenin in the cytoplasm and its subsequent translocation to the nucleus, where it forms a complex with the nuclear transcriptional regulator T cell factor (TCF), finally resulting in the binding of downstream genes and promotion of transcriptional activation. Cell cycle modulatory genes, c-myc and cyclin D1, have been identified as TCF downstream genes (5, 6).

In this regard, previous studies have shown that signal dysregulation by gene mutation of molecules involved in the formation of the ß-catenin cytoplasmic complex in Wnt pathway results in accumulation of ß-catenin in the cytoplasm or nucleus because ß-catenin becomes resistant to degradation (7, 8). Moreover, aberrant Wnt/ß-catenin signaling pathway is often observed in various cancers. Mutations of APC gene are found in all hereditary colon cancers associated with familial polyposis coli (FAP) and more than 80% of sporadic colorectal cancers. Mutations of ß-catenin gene have been identified in APC-wild-type colon tumors and at varying frequencies in other types of tumors, including hair-follicle tumors and hepatocellular carcinomas (HCC) (9, 10, 11). Recent studies have demonstrated the mutations of Axin 1 and Axin 2 genes in HCCs without mutations of ß-catenin gene and in colorectal cancers with defective DNA mismatch repair, respectively (12, 13). Furthermore, involvement of activated Wnt/ß-catenin signaling in tumorigenesis has been demonstrated in vivo using APC gene targeting mouse (14).

A high incidence of papillary thyroid carcinoma has been reported in patients with FAP (15, 16), and frequent mutations of ß-catenin are observed in anaplastic thyroid cancer (17). In addition, high expression levels of c-Myc and/or cyclin D1 are often observed in sporadic differentiated thyroid cancers (18, 19). Taking into consideration the above findings, we hypothesized that aberrant activation of Wnt/ß-catenin signaling pathway might be involved in thyroid tumorigenesis. To test our hypothesis, we analyzed the Wnt/ß-catenin signaling pathway in human thyroid cancer cell lines and thyroid tumor tissues. Our results showed aberrant localization of ß-catenin in the cytoplasm and nuclei and increased transactivation of TCF in human thyroid cancer cell lines. We also observed cytoplasmic accumulation of ß-catenin, which significantly correlated with cyclin D1 overexpression, in papillary thyroid cancer tissues.

Materials and Methods

Cell culture and materials

Human thyroid cells in primary culture were isolated from thyroid tissues during subtotal thyroidectomy in patients with Graves’ disease and cultured as described previously (20). Four human thyroid cancer cell lines, ARO, FRO, NPA, and WRO, were kindly provided by Dr. G. Juillard (UCLA, Los Angeles, CA). FRO and ARO cell lines were originally established from human anaplastic thyroid cancer, NPA cell line was from human papillary thyroid cancer and WRO cell line was from human follicular thyroid cancer. Another papillary thyroid cancer cell line, TPC-1 cell was kindly provided by Dr. Sato (Cancer Institute, Kanazawa University, Japan). All cell lines were cultured in Roswell Park Memorial Institute 1640 medium supplemented with 10% fetal bovine serum and grown at 37 C in 5% CO2-95% air environment.

Thyroid tissue tumors were selected from 132 paraffin blocks (78 papillary carcinomas, 20 follicular carcinomas, and 34 follicular adenomas) filed at the Department of Pathology, Nagasaki University School of Medicine and Ishigaki Thyroid Clinic (Hamamatsu, Japan). All thyroid tumors were independently reclassified by two experienced pathologists according to histological typing of the WHO as papillary carcinoma, follicular carcinoma, or follicular adenoma.

Correlations between ß-catenin immunoreactivity and various clinicopathological parameters were examined. For this purpose, the medical records of patients from whom tissue samples were obtained for analysis were examined and various clinicopathological parameters were reported. Recurrence was examined at a median postoperative follow-up period of 2.5 yr. The study protocol was approved by the Human Ethics Review Committees of the participating institutions.

TCF4 reporter-gene assays

Firefly luciferase reporter plasmids, in which four copies of TCF4-specific DNA-binding sequence (TBE2) or its mutant sequence (TBE2m) were inserted into pGL3-basic vector (Promega Corp., Madison, WI), were kindly provided by Prof. Y. Nakamura (The University of Tokyo, Tokyo, Japan) (12). The reporter plasmids were transfected into cells using lipofectin reagent (Invitrogen Life Technologies, Carlsbad, CA) using the protocol provided by the manufacturer. A Renilla luciferase plasmid vector, pRL-TK (Promega Corp.), was cotransfected with each pGL3 reporter construct into the cells to normalize for transfection efficiency. Twenty-four hours after transfection, cells were harvested and assayed using a Dual-Luciferase Reporter Assay System (Promega Corp.).

Immunoblot analysis

Whole cell lysates were separated by electrophoresis in 10% SDS-PAGE, then blotted onto nitrocellulose membrane (Amersham Pharmacia Biotech, Buckinghamshire, UK). To determine the levels of ß-catenin, cyclin D1, and c-Myc, the blots were incubated for 60 min with the respective antibody against human ß-catenin (BD Transduction Laboratories, Franklin Lakes, NJ), cyclin D1 (H-295; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and c-Myc (9E10; BIOMOL Research Laboratories, Inc., Plymouth Meeting, PA). The antigen-antibody complexes were visualized with horseradish peroxidase-conjugated antimouse IgG antibody and the electrochemiluminescence system (Amersham Pharmacia Biotech).

Immunocytochemistry and immunohistochemistry

Cultured cells replated on chamber slides were fixed with 4% paraformaldehyde for 10 min and then treated with 100% ethanol for 2 min. After incubation with 10% heat-inactivated goat serum for 60 min at room temperature, the cells were incubated with a mouse anti-ß-catenin antibody (diluted 1:250) in blocking solution. Antibodies were stained with an antimouse secondary antibody conjugated to rhodamine (Santa Cruz Biotechnology, Inc.), and viewed on a Carl Zeiss (Heidelberg, Germany) Axiphot microscope.

Paraffin-embedded tissues of thyroid tumors were deparaffinized in xylene and rehydrated in PBS. Antigen unmasking was accomplished by heating three times in 200 ml PBS in a microwave oven at 50% power for 4 min each, and then the slides were washed with 0.01 M PBS for 10 min. Endogenous peroxidase activity was blocked with 0.3% H2O2-methanol for 10 min. After washing three times with 0.01 M PBS for 5 min each, sections were blocked with 1% BSA for 15 min. After rinsing with phosphate buffer, primary mouse monoclonal antibody, anti-ß-catenin antibody (diluted 1:100) or anticyclin D1 antibody (diluted 1:50, Zymed Laboratories, Inc., South San Francisco, CA) was then applied overnight to the sections at 4 C. The second immunohistochemical reaction for ß-catenin was visualized using biotinylated horse antimouse IgG antibody with avidin-peroxidase and diaminobenzidine. The reaction for cyclin D1 was visualized using alkaline phosphatase-conjugated antimouse IgG antibody with a mixture of 5-bromo-4-chloro-indolyl phosphate and nitroblue tetrazolium chloride color development. Under x200 magnification, the staining frequencies of cyclin D1 in each component were evaluated semiquantitatively by three observers, as follows: 2+ = >30%, + = 5–30%, - = <5%.

Sequencing

Genomic DNA extracted from cell lines was amplified for analysis of mutations in exon 3 of ß-catenin gene and exon 7 of Axin 2 gene by PCR using primers specific for the third coding exon of ß-catenin (sense: GCTGATTTGATGGAGTTGGA; antisense: GCTACTTGTTCTTGAGTGA) and the seventh coding exon of Axin 2 (sense: AACCCAGTTTCTTTCCTTCT; antisense: ATCCCTGCCTCAACCTA). Total RNAs were extracted from five cell lines using Isogen Reagent (Wako, Osaka, Japan) according to the protocol recommended by the manufacturer. We amplified Axin 1 cDNA by RT-PCR using four sets of primers specific for Axin 1 entire coding region (sense 1: GGAAGCAGAGAAAGTACTGG; antisense 1: TCCTTTTCCCCCTCAATGAT; sense 2: GAGGAAAACACCTATCCCTCCT; antisense 2: TCCTCACCTTCCTCCTCCAT; sense 3: GCGGGACAGATTGATTCAC; antisense 3: TCCATAGTGGCCTGGATTTC; sense 4: GAAATGCCAAGAAGGCTGAG, antisense 4: GCCGATGATCTTCTCCTCAA). APC cDNA (codon 131-1614) was also amplified using 10 sets of specific primers. The amplified products were sequenced using SQ-5500 DNA Sequencer (Hitachi Corp., Tokyo, Japan) with a Thermo Sequenase Sequencing Kit (Amersham Pharmacia Biotech).

Statistical analysis

Data were expressed as mean ± SD. Differences between groups were examined for statistical significance using one-way ANOVA followed by Fisher test. Data shown (see Tables 3–5GoGoGo) were analyzed using the Mann-Whitney’s U test. A P value less than 0.05 denoted the presence of a significant difference.


View this table:
[in this window]
[in a new window]
  		Table 3. Localization of ß-catenin in 132 thyroid tumors

 

View this table:
[in this window]
[in a new window]
  		Table 4. Correlation between localization of ß-catenin and overexpression of cyclin D1 in 78 papillary thyroid cancers

 

View this table:
[in this window]
[in a new window]
  		Table 5. Correlation between ß-catenin staining and various clinicopathological factors in papillary thyroid cancers

 
Results

Localization of ß-catenin in human thyroid cancer cell lines

To examine the distribution of ß-catenin in thyroid cancer cells, we performed immunocytochemical analysis using primary cultures of Graves’ thyroid cells and five human thyroid cell lines. ß-catenin staining was identified mainly in the plasma membrane in primary culture cells, indicating the lack of ß-catenin accumulation in the cytoplasm (Fig. 1AGo). In contrast, aberrant localization of ß-catenin was noted in all thyroid cancer cell lines. Nuclear accumulation of ß-catenin was observed in papillary cancer cell line, TPC-1 (Fig. 1BGo), and a strong cytoplasmic staining pattern was observed in another papillary cancer cell line, NPA (Fig. 1CGo). Furthermore, ß-catenin staining was noted in the cell membrane and cytoplasm of anaplastic cancer cell line, ARO, which were characterized by round shape cells and scanty cytoplasm (Fig. 1DGo). A faint cytoplasmic staining was observed in another anaplastic cancer cell line, FRO (Fig. 1EGo). Diffuse and weak staining in the cytoplasm and obvious staining at cell-cell junction were observed in follicular cancer cell line, WRO (Fig. 1FGo). Table 1Go summarizes the results of ß-catenin immunostaining of the cells used in the present study.



View larger version (73K):
[in this window]
[in a new window]
  		Figure 1. ß-catenin localization in thyroid cancer cell lines and primary cultures of thyroid cells. Fluorescent immunocytochemical staining of ß-catenin in primary cultures of Graves’ thyroid cells (A) and five thyroid cancer cell lines, TPC-1 (B), NPA (C), ARO (D), FRO (E), and WRO (F). Original magnification, x400.

 

View this table:
[in this window]
[in a new window]
  		Table 1. Localization and staining of ß-catenin in cultured human thyroid cells

 
TCF4-specific transcriptional activation in human thyroid cancer cell lines

Activation of Wnt/ß-catenin signaling pathway is associated with translocation of ß-catenin into nucleus, where it forms a complex with transcription factor TCF4. The ß-catenin/TCF4 complex binds to various target-genes through the responsive element, known as TCF4-binding motif (TBE2), and subsequently transactivates the genes. To investigate whether Wnt/ß-catenin signaling is aberrantly activated in thyroid cancer cell lines, we performed TCF reporter gene assay. Plasmids containing four consensus TBE2 or mutant TCF-binding motif (TBE2m) upstream of a luciferase reporter gene were transfected into thyroid cancer cell lines. Transfection of plasmids containing TBE2 in ARO and NPA cells resulted in 3.0 ± 0.5- and 3.6 ± 0.4-fold increase of transcriptional activity, respectively (control vs. TBE2; P < 0.05). No such change in transcriptional activity was noted in these cells when plasmids containing TBE2m were transfected (Fig. 2Go). Furthermore, no increase in transcriptional activity was observed by transfection of plasmids containing TBE2 in FRO and WRO cells. The transcriptional activity could not be determined for TCF in TPC-1 cell line because of the extremely low transfection efficiency.



View larger version (25K):
[in this window]
[in a new window]
  		Figure 2. TCF4-specific transcriptional activation in human thyroid cancer cell lines. TCF4 receptor gene assay was performed. Reporter plasmids, which contained four copies of TBE2, TBE2m, and a control plasmid, were transfected into five thyroid cancer cell lines using lipofectin method. Cells were harvested 24 h after transfection and luciferase activity was measured. Luciferase activity is shown for four cell lines, ARO, FRO, NPA, and WRO. Data are mean ± SD (n = 3) of fold activation relative to control values.

 
Correlation of protein levels between ß-catenin and its downstream molecules

To examine whether Wnt/ß-catenin signaling pathway is functionally activated in thyroid cancer cells, we examined the expression of ß-catenin and TCF downstream molecules, c-Myc and cyclin D1 by immunoblotting (Fig. 3Go). Strong ß-catenin immunoreactive bands were detected in NPA and TPC-1 cells. Consistent with the high ß-catenin protein level, increased expression of c-Myc and cyclin D1 was observed in NPA and TPC-1 cells. Although immunoblotting showed weak expression of ß-catenin in ARO cell line, high expression levels of c-Myc and cyclin D1 were noted. This discrepancy needs to be examined in more detail in future studies because the results of immunoblot analysis in ARO cell line were not consistent with other experiments. Considered together with the results of cytoplasmic accumulation of ß-catenin and increased transcriptional activity, however, the increased expression of c-Myc and cyclin D1 is probably due to Wnt/ß-catenin signaling activation in ARO cells. These results indicate that accumulation of ß-catenin protein correlated with increased expression levels of c-Myc and cyclin D1 in cell lines.



View larger version (31K):
[in this window]
[in a new window]
  		Figure 3. ß-catenin, cyclin D1 and c-Myc protein levels in thyroid cancer cell lines and primary cultures of thyroid cells. ß-catenin (top), c-Myc (middle) and cyclin D1 (bottom) protein levels in primary cultures of Graves’ thyroid cells, and five thyroid cancer cell lines were determined by immunoblotting with anti-ß-catenin, anti-c-Myc and anti-cyclin D1 antibodies, respectively.

 
Mutation analysis of APC, ß-catenin, Axin 1, and Axin 2 genes in thyroid cancer cell lines

Zeki et al. (21) reported that thyroid cancer cell lines, NPA, WRO, and FRO had no mutations in exons 14 and 15 of APC gene, whereas ARO cells showed a single adenine insertion at codon 1556, although it was a heterozygous mutation. Because the insert mutation resulted in APC truncated protein, it might contribute to the increased TCF transcriptional activation in ARO cells. To further investigate the cause of aberrant Wnt/ß-catenin activation in thyroid cancer cell lines, mutation analyses of ß-catenin, APC, Axin 1, and Axin 2 genes were performed in all cell lines. We analyzed exon 3 of ß-catenin gene that contains the phosphorylation site for ubiquitination, the APC cDNA (codon 135-1614), entire coding region of Axin 1 gene and exon 7 of Axin 2 gene by sequencing because all gene mutations are found in these regions (9, 10, 11, 12, 13, 22). While heterozygous mutation at codon 1556 in APC gene was confirmed in ARO cells in this study, there was no mutation or deletion of ß-catenin, APC, Axin 1, and Axin 2 genes in the other four thyroid cancer cell lines (Table 2Go).


View this table:
[in this window]
[in a new window]
  		Table 2. Results of mutation analysis of APC, ß-catenin, Axin1 and Axin2 genes in human thyroid cancer cell lines

 
Immunohistochemical analyses of ß-catenin and cyclin D1 in thyroid tumors

To verify the activation of Wnt/ß-catenin signaling pathway in thyroid cancers in vivo, we examined the expression and distribution of ß-catenin in 132 thyroid tumor tissues (34 follicular adenomas, 20 follicular cancers, and 78 papillary cancers) by using immunohistochemistry. ß-catenin immunoreactivity was mainly localized in the plasma membrane in 31 of 34 (91%) follicular adenomas (Fig. 4AGo). On the other hand, cytoplasmic staining of ß-catenin was observed in 3 of 34 (9%) follicular adenomas, 5 of 20 (25%) follicular cancers and in 52 of 78 (67%) papillary cancers (Fig. 4BGo and Table 3Go). We also examined cyclin D1 immunoreactivity in 78 papillary thyroid cancers. Overexpression of cyclin D1 was identified in the nuclei of 64/78 (82%) papillary cancer cells, which correlated significantly with cytoplasmic ß-catenin immunoreactivity (cytoplasm vs. membrane: 46/52 (88%) vs. 18/26 (69%), respectively; P < 0.01, Fig. 4Go, C and D, and Table 4Go). Interestingly, foci exhibiting both cytoplasmic and membranous expression of ß-catenin were detected in some papillary thyroid cancers. In sections double-stained with ß-catenin and cyclin D1 antibodies, overexpression of cyclin D1 was only observed in cancer cells with cytoplasmic ß-catenin (Fig. 4EGo).



View larger version (114K):
[in this window]
[in a new window]
  		Figure 4. Localization of ß-catenin and cyclin D1 in human thyroid tissues. A, Follicular thyroid adenoma showing staining for ß-catenin in the cell membranes. B, Papillary thyroid cancer tissue showing staining for ß-catenin in the cytoplasm. C, A representative case of negative cyclin D1 immunoreactivity in a follicular cancer. D, Papillary cancer showing overexpression of cyclin D1 in cell nuclei. E, Double immunostaining with ß-catenin and cyclin D1 antibodies in a representative papillary thyroid cancer tissue. Original magnification: A, B, and F, x200; C and D, x400.

 
Finally, we examined the correlation between aberrant ß-catenin immunoreactivity and various clinicopathological parameters of patients with thyroid carcinoma. There was no significant correlation between cytoplasmic ß-catenin expression and age, sex, tumor size, metastasis, clinical stage, or recurrence at a median period of postoperative follow-up of 2.5 yr (Table 5Go).

Discussion

The major findings of the present were: 1) aberrant activation of- Wnt/ß-catenin signaling in human thyroid cancer cell lines, and 2) dislocalization of ß-catenin correlated significantly with overexpression of cyclin D1 in papillary thyroid cancer tissues. Our results suggest that aberrant activation of Wnt/ß-catenin signaling promotes the cell cycle via downstream molecules in thyroid papillary cancer in vivo.

Among the component molecules constituting the Wnt/ß-catenin signaling, somatic mutations in ß-catenin, APC, Axin 1, and Axin 2 genes have been detected in a variety of cancer tissues, e.g. colon cancer and HCC (23). In addition to these three related genes, Wnt-1, Wnt-3, or Wnt-10b of Wnt ligands, which form at least 16 members in vertebrates, can promote neoplastic transformation in mice (24, 25). Transformation of wnt genes or overexpression of FzE3 gene, a member of Wnt receptor gene, results in accumulation of ß-catenin in cultured mammalian cells (26, 27). Moreover, frequent mutations in tcf-4 gene that can change TCF-4 transactivating properties have been detected in a subset of colorectal tumors (28). The expression of a chimeric protein consisting of the TCF DNA binding sequence fused to the transcriptional activation domain of either VP16 or the estrogen receptor results in their neoplastic transformation in fibroblasts of the chick embryo (29). Thus, dysregulation of any molecule constituting the Wnt/ß-catenin signaling system seems to promote tumorigenesis.

A few studies have indicated a link between Wnt/ß-catenin signaling and thyroid tumors. APC gene mutations are quite rare in thyroid tumors (21), and ß-catenin gene mutations are limited to anaplastic thyroid cancer (17). Previous immunochemical studies revealed a reduction of ß-catenin bound to the cell surface in both follicular and papillary thyroid cancers lacking mutations of ß-catenin gene (30, 31, 32). However, we observed cytoplasmic ß-catenin staining in papillary thyroid cancers rather than follicular type thyroid tumors.

ß-catenin acts as an integral component of adherens junctions in addition to being a component of the Wnt signaling. ß-catenin links to E-cadherin, a major cell-cell adhesion molecule, with two other catenin members ({alpha} and {gamma}) at pericellular membrane (33). E-cadherin is located in adherens junctions of the basolateral domain and is responsible for cell-cell adhesion (34). The interaction between E-cadherin and catenins is crucial for anchoring the actin cytoskeleton to the intercellular adherent junctions, and plays an important role in the regulation of cell polarity (35). Thyroid epithelial cells are highly polarized cells with a restricted distribution of plasma membrane protein that are segregated into two structurally and functionally distinct domains (apical and basolateral).

Previous studies have shown reduced or no expression of E-cadherin in thyroid cancers compared with normal thyroid tissues (36, 37, 38, 39). Because E-cadherin is under the control of the TSH-cAMP-dependent pathway (40), unresponsiveness of TSH in thyroid cancer (41) may cause dysregulation of E-cadherin expression and loss of interaction with ß-catenin. Once the interaction between E-cadherin and ß-catenin is lost in normal thyroid epithelial cells, the regular polarity disappears and cells do not form the follicular structure or they transform into a papillary phenotype. Thereafter, ß-catenin liberated from the E-cadherin-ß-catenin complex may activate Wnt signaling pathway, resulting in cell proliferation.

Furthermore, a high ratio of ret/PTC rearrangement has been observed in thyroid cancers associated with FAP (42). Although only the TPC-1 cell line exhibited ret/PTC1 rearrangement among five cell lines used in this study (data not shown), it is conceivable that aberrant Wnt/ß-catenin signaling activation may cooperate with the activated tyrosine kinase pathway to promote thyroid tumorigenesis. The latter conclusion is made based on the multistep theory of carcinogenesis (43).

With regard to clinical relevance, we did not find any correlation between cytoplasmic ß-catenin staining pattern and various clinicopathological parameters. Previous studies have demonstrated that cyclin D1 expression has a prognostic value in papillary cancers (44, 45). Because cyclin D1 overexpression was observed in 18 of 26 (69%) papillary thyroid cancers showing membranous ß-catenin expression, not only activated Wnt/ß-catenin signaling pathway but also activated non-Wnt/ß-catenin signals including ras-MAPK pathway induce the expression of cyclin D1. Therefore, cytoplasmic staining for ß-catenin is less significant as a prognostic factor than cyclin D1 overexpression in papillary thyroid cancers. However, most thyroid cancers are diagnosed at early stages because of the anatomical location of the gland in the anterior aspect of the neck and are often excised surgically when they are relatively small in size. Nevertheless, the proportions of large tumor (>40 mm) and those with extrathyroidal invasion and cytoplasmic expression of ß-catenin exceed those of tumors exhibiting membranous ß-catenin (Table 5Go). Further studies are necessary to evaluate the prognostic value of cytoplasmic expression of ß-catenin in thyroid cancer.

In conclusion, our study provided experimental evidence for dysregulation of Wnt/ß-catenin signaling that correlates with overexpression of cell cycle regulating molecules in thyroid papillary cancers. The aberrant activation of Wnt/ß-catenin signaling by epigenetic events or genetic mutations may be closely linked to papillary thyroid carcinogenesis.

Acknowledgments

We thank Dr. Jitsuhiro Ishigaki (Ishigaki Thyroid Clinic, Hamamatsu, Japan) for collecting paraffin-embedded tissue blocks, and Tomoko Kamiya for the excellent technical assistance.

Footnotes

Abbreviations: APC, Adenomatous polyposis coli; FAP, familial polyposis coli; GSK3, glycogen synthase kinase-3; HCC, hepatocellular carcinomas; TBE2 or TBE2m, TCF4-specific DNA-binding sequence or its mutant sequence; TCF, T cell factor.

Received July 13, 2001.

Accepted March 23, 2002.

References

  1. Tsuda M, Kamimura K, Nakato H, Archer M, Staatz W, Fox B, Humphrey M, Olson S, Futch T, Kaluza V, Siegfried E, Stam L, Selleck SB 1999 The cell-surface proteoglycan Dally regulates Wingless signalling in Drosophila. Nature 400:276–280[CrossRef][Medline]
  2. Itoh K, Krupnik VE, Sokol SY 1998 Axis determination in Xenopus involves biochemical interactions of axin, glycogen synthase kinase 3 and ß-catenin. Curr Biol 8:591–594[CrossRef][Medline]
  3. Lee JS, Ishimoto A, Yanagawa S 1999 Characterization of mouse dishevelled (Dvl) proteins in Wnt/Wingless signaling pathway. J Biol Chem 274:21464–21470[Abstract/Free Full Text]
  4. Barker N, Clevers H 2000 Catenins, Wnt signaling and cancer. Bioessays 22:961–965[CrossRef][Medline]
  5. He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa LT, Morin PJ, Vogelstein B, Kinzler KW 1998 Identification of c-MYC as a target of the APC pathway. Science 281:1509–1512[Abstract/Free Full Text]
  6. Tetsu O, McCormick F 1999 ß-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398:422–426[CrossRef][Medline]
  7. Behrens J 2000 Control of ß-catenin signaling in tumor development. Ann NY Acad Sci 910:21–33; discussion 33–35[Medline]
  8. Roose J, Huls G, van Beest M, Moerer P, van der Horn K, Goldschmeding R, Logtenberg T, Clevers H 1999 Synergy between tumor suppressor APC and the ß-catenin-Tcf4 target Tcf1. Science 285:1923–1926[Abstract/Free Full Text]
  9. Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B, Kinzler KW 1997 Activation of ß-catenin-Tcf signaling in colon cancer by mutations in ß-catenin or APC. Science 275:1787–1790[Abstract/Free Full Text]
  10. Chan EF, Gat U, McNiff JM, Fuchs E 1999 A common human skin tumour is caused by activating mutations in ß-catenin. Nat Genet 21:410–413[CrossRef][Medline]
  11. de La Coste A, Romagnolo B, Billuart P, Renard CA, Buendia MA, Soubrane O, Fabre M, Chelly J, Beldjord C, Kahn A, Perret C 1998 Somatic mutations of the ß-catenin gene are frequent in mouse and human hepatocellular carcinomas. Proc Natl Acad Sci USA 95:8847–8851[Abstract/Free Full Text]
  12. Satoh S, Daigo Y, Furukawa Y, Kato T, Miwa N, Nishiwaki T, Kawasoe T, Ishiguro H, Fujita M, Tokino T, Sasaki Y, Imaoka S, Murata M, Shimano T, Yamaoka Y, Nakamura Y 2000 AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXIN1. Nat Genet 24:245–250[CrossRef][Medline]
  13. Liu W, Dong X, Mai M, Seelan RS, Taniguchi K, Krishnadath KK, Halling KC, Cunningham JM, Boardman LA, Qian C, Christensen E, Schmidt SS, Roche PC, Smith DI, Thibodeau SN 2000 Mutations in AXIN2 cause colorectal cancer with defective mismatch repair by activating ß-catenin/TCF signalling. Nat Genet 26:146–147[CrossRef][Medline]
  14. Oshima H, Oshima M, Kobayashi M, Tsutsumi M, Taketo MM 1997 Morphological and molecular processes of polyp formation in Apc(delta716) knockout mice. Cancer Res 57:1644–1649[Abstract/Free Full Text]
  15. Plail RO, Bussey HJ, Glazer G, Thomson JP 1987 Adenomatous polyposis: an association with carcinoma of the thyroid. Br J Surg 74:377–380[Medline]
  16. Bulow S, Holm NV, Mellemgaard A 1988 Papillary thyroid carcinoma in Danish patients with familial adenomatous polyposis. Int J Colorectal Dis 3:29–31[CrossRef][Medline]
  17. Garcia-Rostan G, Tallini G, Herrero A, D’Aquila TG, Carcangiu ML, Rimm DL 1999 Frequent mutation and nuclear localization of beta-catenin in anaplastic thyroid carcinoma. Cancer Res 59:1811–1815[Abstract/Free Full Text]
  18. Yamashita S, Ong J, Fagin JA, Melmed S 1986 Expression of the myc cellular proto-oncogene in human thyroid tissue. J Clin Endocrinol Metab 63:1170–1173[Abstract/Free Full Text]
  19. Lazzereschi D, Sambuco L, Carnovale Scalzo C, Ranieri A, Mincione G, Nardi F, Colletta G 1998 Cyclin D1 and cyclin E expression in malignant thyroid cells and in human thyroid carcinomas. Int J Cancer 76:806–811[CrossRef][Medline]
  20. Kawabe Y, Eguchi K, Shimomura C, Mine M, Otsubo T, Ueki Y, Tezuka H, Nakao H, Kawakami A, Migita K 1989 Interleukin-1 production and action in thyroid tissue. J Clin Endocrinol Metab 68:1174–1183[Abstract/Free Full Text]
  21. Zeki K, Spambalg D, Sharifi N, Gonsky R, Fagin JA 1994 Mutations of the adenomatous polyposis coli gene in sporadic thyroid neoplasms. J Clin Endocrinol Metab 79:1317–1321[Abstract]
  22. Cetta F, Montalto G, Gori M, Curia MC, Cama A, Olschwang S 2000 Germline mutations of the APC gene in patients with familial adenomatous polyposis-associated thyroid carcinoma: results from a European cooperative study. J Clin Endocrinol Metab 85:286–292[Abstract/Free Full Text]
  23. Polakis P 2000 Wnt signaling and cancer. Genes Dev 14:1837–1851[Free Full Text]
  24. Lee FS, Lane TF, Kuo A, Shackleford GM, Leder P 1995 Insertional mutagenesis identifies a member of the Wnt gene family as a candidate oncogene in the mammary epithelium of int-2/Fgf-3 transgenic mice. Proc Natl Acad Sci USA 92:2268–2272[Abstract/Free Full Text]
  25. Roelink H, Wagenaar E, Lopes da Silva S, Nusse R 1990 Wnt-3, a gene activated by proviral insertion in mouse mammary tumors, is homologous to int-1/Wnt-1 and is normally expressed in mouse embryos and adult brain. Proc Natl Acad Sci USA 87:4519–4523[Abstract/Free Full Text]
  26. Shimizu H, Julius MA, Giarre M, Zheng Z, Brown AM, Kitajewski J 1997 Transformation by Wnt family proteins correlates with regulation of beta-catenin. Cell Growth Differ 8:1349–1358[Abstract]
  27. Tanaka S, Akiyoshi T, Mori M, Wands JR, Sugimachi K 1998 A novel frizzled gene identified in human esophageal carcinoma mediates APC/beta-catenin signals. Proc Natl Acad Sci USA 95:10164–10169[Abstract/Free Full Text]
  28. Duval A, Gayet J, Zhou XP, Iacopetta B, Thomas G, Hamelin R 1999 Frequent frameshift mutations of the TCF-4 gene in colorectal cancers with microsatellite instability. Cancer Res 59:4213–4215[Abstract/Free Full Text]
  29. Aoki M, Hecht A, Kruse U, Kemler R, Vogt PK 1999 Nuclear endpoint of Wnt signaling: neoplastic transformation induced by transactivating lymphoid-enhancing factor 1. Proc Natl Acad Sci USA 96:139–144[Abstract/Free Full Text]
  30. Cerrato A, Fulciniti F, Avallone A, Benincasa G, Palombini L, Grieco M 1998 ß- and {gamma}-catenin expression in thyroid carcinomas. J Pathol 185:267–272[CrossRef][Medline]
  31. Huang SH, Wu JC, Chang KJ, Liaw KY, Wang SM 1999 Expression of the cadherin-catenin complex in well-differentiated human thyroid neoplastic tissue. Thyroid 9:1095–1103[Medline]
  32. Garcia-Rostan G, Camp RL, Herrero A, Carcangiu ML, Rimm DL, Tallini G 2001 ß-catenin dysregulation in thyroid neoplasms: down-regulation, aberrant nuclear expression, and ctnnb1 exon 3 mutations are markers for aggressive tumor phenotypes and poor prognosis. Am J Pathol 158:987–996[Abstract/Free Full Text]
  33. Ozawa M, Baribault H, Kemler R 1989 The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J 8:1711–1717[Medline]
  34. Yap AS, Stevenson BR, Keast JR, Manley SW 1995 Cadherin-mediated adhesion and apical membrane assembly define distinct steps during thyroid epithelial polarization and lumen formation. Endocrinology 136:4672–4680[Abstract]
  35. Wollner DA, Krzeminski KA, Nelson WJ 1992 Remodeling the cell surface distribution of membrane proteins during the development of epithelial cell polarity. J Cell Biol 116:889–899[Abstract/Free Full Text]
  36. Brabant G, Hoang-Vu C, Cetin Y, Dralle H, Scheumann G, Molne J, Hansson G, Jansson S, Ericson LE, Nilsson M 1993 E-cadherin: a differentiation marker in thyroid malignancies. Cancer Res 53:4987–4993[Abstract/Free Full Text]
  37. Scheumman GF, Hoang-Vu C, Cetin Y, Gimm O, Behrends J, von Wasielewski R, Georgii A, Birchmeier W, von Zur Muhlen A, Dralle H 1995 Clinical significance of E-cadherin as a prognostic marker in thyroid carcinomas. J Clin Endocrinol Metab 80:2168–2172[Abstract]
  38. Serini G, Trusolino L, Saggiorato E, Cremona O, De Rossi M, Angeli A, Orlandi F, Marchisio PC 1996 Changes in integrin and E-cadherin expression in neoplastic versus normal thyroid tissue. J Natl Cancer Inst 88:442–449[Abstract/Free Full Text]
  39. von Wasielewski R, Rhein A, Werner M, Scheumann GF, Dralle H, Potter E, Brabant G, Georgii A 1997 Immunohistochemical detection of E-cadherin in differentiated thyroid carcinomas correlates with clinical outcome. Cancer Res 57:2501–2507[Abstract/Free Full Text]
  40. Brabant G, Hoang-Vu C, Behrends J, Cetin Y, Potter E, Dumont JE, Maenhaut C 1995 Regulation of the cell-cell adhesion protein, E-cadherin, in dog and human thyrocytes in vitro. Endocrinology 136:3113–3119[Abstract]
  41. Namba H, Yamashita S, Usa T, Kimura H, Yokoyama N, Izumi M, Nagataki S 1993 Overexpression of the intact thyrotropin receptor in a human thyroid carcinoma cell line. Endocrinology 132:839–845[Abstract/Free Full Text]
  42. Cetta F, Chiappetta G, Melillo RM, Petracci M, Montalto G, Santoro M, Fusco A 1998 The ret/ptc1 oncogene is activated in familial adenomatous polyposis-associated thyroid papillary carcinomas. J Clin Endocrinol Metab 83:1003–1006[Abstract/Free Full Text]
  43. Vogelstein B, Kinzler KW 1993 The multistep nature of cancer. Trends Genet 9:138–141[CrossRef][Medline]
  44. Muro-Cacho CA, Holt T, Klotch D, Mora L, Livingston S, Futran N 1999 cyclin D1 expression as a prognostic parameter in papillary carcinoma of the thyroid. Otolaryngol Head Neck Surg 120:200–207[CrossRef][Medline]
  45. Erickson LA, Jin L, Goellner JR, Lohse C, Pankratz VS, Zukerberg LR, Thompson GB, van Heerden JA, Grant CS, Lloyd RV 2000 Pathologic features, proliferative activity, and cyclin D1 expression in Hurthle cell neoplasms of the thyroid. Mod Pathol 13:186–192[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
A. S. Rao, N. Kremenevskaja, R. von Wasielewski, V. Jakubcakova, S. Kant, J. Resch, and G. Brabant
Wnt/{beta}-Catenin Signaling Mediates Antineoplastic Effects of Imatinib Mesylate (Gleevec) in Anaplastic Thyroid Cancer
J. Clin. Endocrinol. Metab., January 1, 2006; 91(1): 159 - 168.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
A S Rao, N Kremenevskaja, J Resch, and G Brabant
Lithium stimulates proliferation in cultured thyrocytes by activating Wnt/{beta}-catenin signalling
Eur. J. Endocrinol., December 1, 2005; 153(6): 929 - 938.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
W. Liu, S. L. Asa, and S. Ezzat
1{alpha},25-Dihydroxyvitamin D3 Targets PTEN-Dependent Fibronectin Expression to Restore Thyroid Cancer Cell Adhesiveness
Mol. Endocrinol., September 1, 2005; 19(9): 2349 - 2357.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
H. Ying, H. Suzuki, H. Furumoto, R. Walker, P. Meltzer, M. C. Willingham, and S.-Y. Cheng
Alterations in genomic profiles during tumor progression in a mouse model of follicular thyroid carcinoma
Carcinogenesis, September 1, 2003; 24(9): 1467 - 1479.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ishigaki, K.
Right arrow Articles by Yamashita, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ishigaki, K.
Right arrow Articles by Yamashita, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals