help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saxena, A.
Right arrow Articles by Hanukoglu, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saxena, A.
Right arrow Articles by Hanukoglu, A.
The Journal of Clinical Endocrinology & Metabolism Vol. 87, No. 7 3344-3350
Copyright © 2002 by The Endocrine Society


Other Original Articles

Novel Mutations Responsible for Autosomal Recessive Multisystem Pseudohypoaldosteronism and Sequence Variants in Epithelial Sodium Channel {alpha}-, ß-, and {gamma}-Subunit Genes

Anjana Saxena, Israel Hanukoglu, Deepak Saxena, Richard J. Thompson, R. Mark Gardiner and Aaron Hanukoglu

Department of Chemical Engineering and Biotechnology, The College of Judea and Samaria, Ariel 44837, Israel; Department of Pediatrics, Royal Free and University College Medical School, The Rayne Institute (R.J.T., R.M.G.), United Kingdom WC1E 6JJ; and Department of Pediatrics, Tel-Aviv University Sackler Medical School, E. Wolfson Hospital (A.H.), Holon, 58100, Israel

Address all correspondence and requests for reprints to: Dr. Aaron Hanukoglu, Department of Pediatrics, E. Wolfson Hospital, Holon, 58100 Israel. E-mail: . aaronh{at}science.co.il

Abstract

Multisystem pseudohypoaldosteronism (PHA), is a syndrome of unresponsiveness to aldosterone with autosomal recessive inheritance. Previously we showed that mutations in the epithelial sodium channel (ENaC) {alpha}-, ß-, and {gamma}-subunits are responsible for PHA. In this study we examined four independent probands with multisystem PHA, three of whom were born to consanguineous parents. In our search for mutations we also determined the complete coding sequences of each of the three genes encoding {alpha}-, ß-, and {gamma}-subunits in individuals representing different ethnic groups. Our analyses revealed the following homozygous mutations in three probands: 1) insertion of a T in exon 8 of the {alpha} ENaC gene that causes a frameshift error at Tyr447 and leads to a premature stop codon at K459 in a Pakistani patient; 2) R508stop mutation in exon 11 of the {alpha} ENaC gene in an Indian patient; and 3) a splice site mutation in intron 12 of the ß ENaC gene (1669 + 1 g->a) in a Scottish patient. The parents were heterozygous for the latter two mutations. The second mutation was previously observed in an Iranian Jewish patient. Our sequencing of the {alpha}-, ß-, and {gamma}-coding sequences revealed some sequence variants, some of which may represent single nucleotide polymorphisms. The {gamma}-subunit protein sequence was completely conserved in the six subjects examined. The homozygous mutations identified in the {alpha} and ß ENaC genes should result in reduced or abolished ENaC activity in PHA patients, explaining the disease symptoms.

THE MINERALOCORTICOID hormone aldosterone regulates blood electrolyte levels by stimulating the reabsorption of sodium in epithelial cells in the renal tubule, respiratory and gastrointestinal tracts, and sweat and salivary glands (1, 2, 3, 4, 5). This effect appears to be mediated mainly via an increase in the activity of amiloride-sensitive epithelial sodium channel (ENaC) subunits (1, 2, 3, 4, 5). ENaC is located on the apical membrane of epithelial cells and transports Na+ from the lumen into the cell (1, 2, 3, 4, 5). The reabsorbed sodium is then extruded from the epithelial cell back into the bloodstream by the Na/K-adenosine triphosphatase located at the opposite basolateral membrane of the cell. The reabsorption of sodium by ENaC is accompanied by an osmotic uptake of water to maintain a constant extracellular Na+ concentration. Thus, ENaC plays important roles in electrolyte homeostasis and blood volume and blood pressure regulation (1, 2).

ENaC represents a special type of ion channel that is composed of a multimeric complex of subunits. In epithelial cells three different subunits, named {alpha}, ß, and {gamma}, have been identified (1, 2, 3, 6). The {alpha}-subunit is encoded on chromosome 12p13.1, whereas the ß- and {gamma}-subunits are encoded on chromosome 16p12.2–13.11 (7, 8). Sequence identity between ß- and {gamma}-subunit protein sequences is 32%, whereas identity between {alpha}- and ß- or {gamma}-subunits is 26–28% (9). The genes of these subunits show nearly identical intron-exon organization (9).

Lack of responsiveness to aldosterone, pseudohypoaldosteronism (PHA), was shown to include two distinct entities with different clinical and genetic characteristics: a mild renal form with autosomal dominant inheritance, and a severe multisystem form with recessive inheritance (10, 11). Almost all of previously described cases of PHA (12, 13, 14, 15, 16, 17, 18) can be classified into one of these two distinct forms (10). The multisystem form was shown by us and others (19, 20, 21, 22, 23, 24) to emanate from loss of function mutations in ENaC subunits. In contrast, mutations that result in enhanced activity of ENaC cause a severe hereditary hypertension called Liddle’s syndrome (25, 26). The involvement of ENaC in this syndrome, led to the suggestion that polymorphisms in ENaC sequence may be associated with hereditary forms of hypertension (27).

In the present study we examined four probands with multisystem PHA and identified novel mutations in the genes encoding the {alpha}- and ß-subunits of ENaC. In our search for mutations we also determined the complete coding sequences of each of the three genes encoding {alpha}-, ß-, and {gamma}-subunits in individuals representing different ethnic groups.

Subjects and Methods

Subjects

Four families with multisystem PHA were examined in this study. In three families the parents were consanguineous (first cousins). Four affected infants (probands) presented in early infancy at 7–8 d of age with signs and symptoms of multisystem PHA (10). In these infants the diagnosis was based on clinical and laboratory characteristics of the disease, including severe dehydration, hyponatremia in the face of urinary salt losing (urinary sodium, >40 mmol/liter), hyperkalemia, and markedly increased serum aldosterone levels (Table 1Go). Their sweat and salivary Na+ concentrations were very high, showing that salt loss is not limited to renal tubules, but is also observed in other epithelial cells responsive to aldosterone (Table 1Go). Initially all patients received iv fluid therapy with large amounts of 0.9% saline and ion exchange resin (Kayexalate, Sanofi-SyntheLabo, New York, NY) to decrease extremely high potassium levels.


View this table:
[in this window]
[in a new window]
 
Table 1. Patients with multisystem PHA examined in this study

 
Patient 11

This patient required 180 mmol/d sodium supplementation (NaCl and sodium bicarbonate) to remain in balance. He did not respond to fludrocortisone therapy. At the age of 15 yr he was still dependent on high amounts of sodium supplementation. His parents are first cousins of Indian Muslim origin.

Patient 13

In this patient long-term follow-up data were not available.

Patient 14

In addition to severe dehydration this patient presented with cardiac dysrhythmia due to hyperkalemia. During the first 6 wk of life he developed several episodes of severe salt-wasting crisis (sodium, <120 mmol/liter; potassium, 8.5–10.5 mmol/liter) despite treatment with iv saline and ion exchange resin. Eventually a percutaneous gastrostomy tube was inserted to administer high amounts of sodium supplementation (30–50 mmol/kg·d) as well as adequate nutrition. Treatment with high doses of fludrocortisone (0.3 mg/d) was ineffective. He had bouts of severe electrolyte imbalance even beyond the neonatal period, necessitating recurrent admissions. The frequency of these episodes decreased with age, and his growth and development were normal (height and weight along the 10th to 25th percentiles). At the age of 6.5 yr he died after cardiac arrest at home. The parents, who are of Scottish origin, had two additional children. The older sibling, a 2-yr-old girl, is affected as well. She had a similar clinical course and is presently thriving on sodium chloride and bicarbonate supplements. The youngest child is unaffected.

Patient 16

This patient also required high doses of sodium supplements during the neonatal period to remain in balance. At the age of 4 yr he still needs 150–180 mmol sodium/d and 15 g Kayexalate/d. On this regimen his condition is stable. The parents of patient 16, Pakistani Muslims in origin, were not known to be consanguineous, and their DNA samples were not available for analysis.

Other subjects

In addition to the above patients we determined the sequences of the subunits in 3 additional subjects: IH (a healthy adult Sephardic Jewish origin), 23 (an infant of English origin), and 103 (Arabic origin).

DNA isolation and marker typing

Genomic DNA was extracted from white blood cells as described by Miller et al. (28). The families were marker typed as previously described (8). Microsatellite markers specific to the chromosome 12p and 16p regions were selected as previously described (8). Genomic DNA was then amplified using these primers by PCR. The PCR reactions were carried out in 30 µl containing 50 mM KCl, 2.0 mM MgCl2, 10 mM Tris-HCl (pH 8.8), 0.08% Nonidet P-40, 200 µM deoxy-GTP, 200 µM deoxy-TTP, 200 µM deoxy-CTP, 150 µM deoxy-ATP, 0.5–1.5 µCi [{alpha}-33P]deoxy-ATP (3000 Ci/mmol or 92.7 TBq/mmol; Amersham Pharmacia Biotech, Arlington Heights, IL); 0.5–0.8 U Taq polymerase (recombinant); 0.25–0.5 µM of each primer; and 100 ng genomic DNA. After an initial denaturation of 94 C for 4 min, PCR was conducted for 30 cycles with denaturation at 94 C for 45 sec, annealing at 47–55 C for 45 sec, and extension at 72 C for 45 sec. For primer set D12S374, "touch down" PCR was performed with annealing at 54 C in the first PCR cycle, decreasing 0.5 C at every subsequent cycle for a total of 11 cycles. After this, 19 additional PCR cycles were performed at a constant annealing temperature of 55 C using the standard protocol described above.

For genotype analysis, PCR products were denatured in 10 µl formamide by heating to 94 C for 5 min and then electrophoresed on standard DNA sequencing gels and autoradiographed. All genotypes were scored independently by two investigators, and homozygosity regions were analyzed carefully.

PCR

The coding regions of {alpha}, ß, and {gamma} ENaC subunits along with partial or complete introns were amplified by PCR using genomic DNA as template. Based on the genomic and mRNA sequences of the subunits (7, 9, 19, 29, 30, 31, 32), PCR primer sequences were selected in introns or in exon/intron junctions. Primer sets are described in Table 2Go. PCR reactions were carried out as previously described (9).


View this table:
[in this window]
[in a new window]
 
Table 2. Primer sets and PCR conditions that were used to amplify exons and introns of the human {alpha}, ß, and {gamma} ENaC genes

 
DNA sequencing

DNA sequences were determined by the dideoxy chain termination method using the ThermoSequenase-radiolabeled Terminator Cycle Sequencing kit and [{alpha}-33P]dideoxy-NTPs (1500 Ci/mmol or 55.5 TBq/mmol; Amersham Pharmacia Biotech), following the standard protocol supplied by the manufacturer. All other conditions were as previously described (9). Some PCR products were also subjected to direct DNA sequence analysis using an ABI 373 automated DNA sequencer employing dye terminators, following a standard protocol by the manufacturer (PE Applied Biosystems, Inc., Foster City, CA).

The complete protein coding sequences of the ENaC subunit genes were determined for the following individuals: subunit {alpha}, 11, 16, and 103; subunit ß, IH, 13, 14, and 23; and subunit {gamma}, IH, 13, 14, 16, 23, and 103 (except {gamma} exon 2).

Results

In this study we determined the complete protein-coding sequences of the {alpha}, ß, and {gamma} ENaC subunit genes, by sequencing genomic DNAs of PHA patients, their relatives, and normal individuals. The {gamma}-subunit gene sequence provides the first complete coding sequence for this gene and is available under accession numbers AF356493 through AF356502. The sequencing results revealed the following mutations in the PHA patients examined (Table 3Go).


View this table:
[in this window]
[in a new window]
 
Table 3. Mutations identified in ENaC subunits in patients with autosomal recessive multisystem PHA

 
PHA patient 16

Sequencing of the genomic DNA of PHA patient 16 showed an insertion of a T in exon 8 of {alpha} ENaC at position 1439 of the mRNA sequence (X76180; Fig. 1Go). This mutation changes the Tyr447 codon sequence from TAC to TTAC, which leads to a premature stop codon at K459.



View larger version (70K):
[in this window]
[in a new window]
 
Figure 1. Sequence of the region of {alpha} ENaC exon 8 that shows a mutation in PHA patient 16. Sequencing was performed using primer A9F. The identified mutation is an insertion of t (marked by arrowhead) at nucleotide1439 in exon 8 leading to a Y447frameshift and K459stop. Normal, AGAACGTGGAGTACTGTGACTACAGAAAGCACAG; PHA 16, AGAACGTGGAGTACTGTGACTtACAGAAAGCACAG (mutation underlined).

 
PHA patient 11

Sequencing of the genomic DNA of patient 11 revealed a homozygous mutation in exon 11 of the {alpha} ENaC gene at a position corresponding to nucleotide 1621 in mRNA sequence X76180 (Fig. 2Go). The observed change of C to T in this position changes the Arg508 codon to a premature stop codon. Parents who are first cousins showed heterozygosity for this mutation (Fig. 2Go). This confirms the hereditary origin of the mutation in patient 11.



View larger version (88K):
[in this window]
[in a new window]
 
Figure 2. Sequence of the region of {alpha} ENaC gene exon 11 that shows a mutation in family 11. Sequencing was performed using primer A12F. M, Mother; F, father; PHA, son. Heterozygosity of the parents can be clearly seen, with a T and a C at the same location, whereas the sequence of their PHA son shows only a T (marked by arrowheads). Sequence shown: normal, GATGCTATCGCGACAGAACAAT; PHA 11, GATGCTATCGtGACAGAACAAT (mutation underlined).

 
PHA patient 13

Linkage analysis for this patient showed evidence of linkage to 16p12.2–13.11 encoding the ß and {gamma} ENaC subunits (8). Yet, sequencing of the protein-coding region of these two genes did not reveal a mutation. Thus, a mutation in a regulatory region or another relevant functional site may be responsible for this case.

PHA patient 14

Sequencing of the genomic DNA of patient 14 revealed a homozygous mutation of G to A in the first nucleotide at the 5'-splice site of intron 12 (Fig. 3Go). The parents were heterozygous for this mutation, confirming the hereditary origin of the mutation in the patient.



View larger version (93K):
[in this window]
[in a new window]
 
Figure 3. Sequence of the ß ENaC gene exon 12/intron 12 junction that shows a mutation in family 14. Sequencing was performed using primer B12F. M, Mother; F, father; PHA, son. Heterozygosity of the parents can be clearly seen, with a G and A at the same location, whereas the sequence of their PHA son shows only an A (marked by arrowheads). Sequence shown: 3' of exon 12; 5'-end of intron 12; normal, GCCAATAAC gtgagttt (encoding AlaAsnAsn); PHA 14, GCCAATAAC atgagttt (mutation underlined).

 
Sequence variants in genes encoding ENaC subunits

Table 4Go presents a list of all of the sequence variants observed in all three genes encoding {alpha}, ß, and {gamma} ENaC subunits. In the {alpha}-subunit gene we identified only one variant that changes an amino acid, Thr663, to Ala. In the ß-subunit gene we observed only two variants: one altering, Gly314 to Ala, and a silent change at the 1174th position in mRNA leaving amino acid sequence unchanged (Table 4Go). The differences observed in the {gamma}-subunit gene are elaborated upon in Discussion.


View this table:
[in this window]
[in a new window]
 
Table 4. Sequence variants observed in the {alpha}, ß, and {gamma} ENaC subunit genes that are not associated with PHA

 
Discussion

In this study we have examined four families with autosomal recessive multisystem PHA. All index cases showed the typical clinical characteristics of multisystem PHA, as described previously (10). In three patients we have identified the following mutations in {alpha}- and ß-subunits of ENaC that explain the molecular basis of their multisystem PHA syndrome.

Insertion of a T in exon 8 of the {alpha} ENaC gene

This novel mutation was detected in Muslim Pakistani PHA patient 16. The mutated gene encodes a truncated {alpha} ENaC subunit and thus would unequivocally explain the observation that the patient suffered from multisystem PHA.

R508stop mutation in exon 11 of the {alpha} ENaC gene

This homozygous mutation was detected in patient 11, at a position corresponding to nucleotide 1621 in mRNA sequence X76180. Parents of the patient, who are first cousins of Indian Muslim origin, showed heterozygosity for this mutation. In our earlier studies we observed this mutation of Arg508stop in two families of Iranian Jewish origin (20). The mutation is located at a CpG dinucleotide (Fig. 2Go) that has been observed as a mutation hot spot in many genes. Thus, it is possible that the same mutation arose independently in an Indian Muslim family as well.

Splice site mutation in intron 12 of the ß ENaC gene (5'ss g->a)

This novel homozygous mutation was detected in the genomic DNA of patient 14, who was of Scottish origin. The mutation of G to A in the first nucleotide at the 5'-splice site of intron 12 changes the conserved GT sequence at the 5'-end of introns, preventing correct splicing of the mRNA. This mutation would thus result in the absence of a functional ß ENaC subunit and explains the molecular basis of the multisystem PHA observed in this patient.

General features of mutations in autosomal recessive multisystem PHA

Examination of all of the known autosomal recessive multisystem PHA patients shows the following features. 1) All cases deciphered show mutations in both alleles encoding one of the subunits of ENaC. The majority show homozygous mutations, with both parents displaying heterozygosity for the mutations, and others are compound heterozygotes. 2) The mutations may be observed in any of the three subunits of ENaC. 3) The mutations observed include single nucleotide changes, deletions, insertions, and splice site junction mutations leading to the production of an inactive protein. 4) With one exception, different mutations are observed in different ethnic groups. 5) Most of the mutations appear in the {alpha}-subunit, consistent with an important role for this subunit in ENaC function (24). 6) The mutations have helped define functional domains of the subunits (for review, see Ref. 24). 7) In contrast to Liddle’s syndrome (24, 25, 26), none of the mutations in multisystem PHA appear in the carboxyl-terminal region.

Sequence variants in genes encoding ENaC subunits

The question of polymorphisms in ENaC subunits has recently received extensive attention because of possible association with some hereditary forms of hypertension (20). In Table 4Go we present the list of all single nucleotide variants observed in all three genes encoding ENaC {alpha}-, ß-, and {gamma}-subunits. Only one variant we observed in the {alpha}-subunit gene changes the Thr663 codon to Ala. This variant has been previously reported in different individuals (29, 32, 33, 34), indicating that it represents a genuine single nucleotide polymorphism (SNP). Yet, its biochemical significance remains unknown. In the {alpha}-subunit gene we have identified additional sequence differences in the untranslated region of exon 2 and in the introns of the gene compared with previous reports. As some of these differences were observed in all of our subjects from different ethnic groups, it is possible that previous sequences based on a single report may contain sequencing errors at some of these bases.

In the ß-subunit gene we observed only two different single nucleotide changes. The functional significance, if any, of the amino acid change remains to be determined. Several previous studies examined partial sequences of ß- and {gamma}-subunits (only selected exons in the carboxyl-terminal region) (35, 36, 37) in hypertensive subjects. Although Persu et al. (35) identified novel rare SNPs, no mutation was found to be definitively associated with hypertension (35, 36, 37). Exons 8 and 12, noted in a previous study (35), are here numbered 9 and 13, as we now know that there are 13 exons in the ß ENaC gene (9), not 12.

We sequenced the complete coding sequence of the {gamma} ENaC gene (GenBank accession no. AF356502) from six individuals from different ethnic origins, to resolve the discrepancies in the previously published {gamma} ENaC complete mRNA sequences (7, 32) and partial genomic sequences (30). In our subjects we observed complete conservation of the coding sequence. The single nucleotide change we observed was located in the 5'-UTR (Table 4Go). Yet, we detected eight single nucleotide differences, five of which also change the amino acid sequence compared with previously published sequences (Table 4Go). Because of the discrepancies among previously published mRNA and genomic sequences themselves, it is likely that some or all of the differences we observed may reflect sequencing errors, rather than genuine SNP. As we sequenced six individuals from different groups, we suggest that the amino acid sequence based on our genomic sequencing be used as the standard {gamma} ENaC sequence rather than the previously published sequences with the differences listed in Table 4Go.

In summary, our sequencing of multisystem PHA patients revealed novel homozygous mutations in the {alpha} and ß ENaC genes that should result in reduced or abolished ENaC activity. Consistent with the autosomal recessive inheritance of the disease, the parents of at least two of the patients were heterozygous for the mutation. The present results revealed only a few sequence variants among individuals from different ethnic groups, indicating that the gene and the coding sequences of the ENaC subunits are very strongly conserved.

Acknowledgments

We are grateful to Drs. Jeremy Allgrove, T. James Beattie, Jeremy Kirk, and Geoffrey Woods for allowing us to study patients under their care.

Footnotes

This work was supported in part by a grant from the Chief Scientist of the Israel Ministry of Health and by the UK-Israel Science and Technology Research Fund under the auspices of the Ministry of Science (Israel), the Medical Research Council (United Kingdom), and Action Research. The sequences of the exons of amiloride-sensitive sodium channel {gamma}-subunit ({gamma}ENaC) have been submitted to GenBank under accession numbers AF356493 through AF356502.

Present address for R.J.T.: Department of Child Health, GKT School of Medicine, King’s College Hospital, London, United Kingdom SE5 9RS.

Abbreviations: ENaC, Amiloride-sensitive epithelial sodium channel; PHA, pseudohypoaldosteronism; SNP, single nucleotide polymorphism.

Received December 10, 2001.

Accepted April 10, 2002.

References

  1. Alvarez de la Rosa D, Canessa CM, Fyfe GK, Zhang P 2000 Structure and regulation of amiloride-sensitive sodium channels. Annu Rev Physiol 62:573–594[CrossRef][Medline]
  2. Barbry P, Hofman P 1997 Molecular biology of Na+ absorption. Am J Physiol 273:G571–G585
  3. Bastl CP, Hayslett JP 1992 The cellular action of aldosterone in target epithelia. Kidney Int 42:250–264[Medline]
  4. Garty H 2000 Regulation of the epithelial Na+ channel by aldosterone: open questions and emerging answers. Kidney Int 57:1270–1276[CrossRef][Medline]
  5. Verrey F, Pearce D, Pfeiffer R, Spindler B, Mastroberardino L, Summa V, Zecevic M 2000 Pleiotropic action of aldosterone in epithelia mediated by transcription and post-transcription mechanisms. Kidney Int 57:1277–1282[CrossRef][Medline]
  6. Canessa CM, Schild L, Buell G, Thorens B, Gautschl I, Horisberger JD, Rossier BC 1994 Amiloride sensitive epithelial Na+ channel is made of three homologous subunits. Nature 367:463–467[CrossRef][Medline]
  7. Voilley N, Bassilana F, Mignon C, Merscher S, Mattei MG, Carle GF, Lazdunski M, Barbry P 1995 Cloning, chromosomal localization, and physical linkage of the ß and {gamma} subunits (SCNN1B and SCNN1G) of the human epithelial amiloride-sensitive sodium channel. Genomics 28:560–565[CrossRef][Medline]
  8. Strautnieks SS, Thompson RJ, Hanukoglu A, Dillon MJ, Hanukoglu I, Kuhnle U, Seckl J, Gardiner RM, Chung E 1996 Localisation of pseudohypoaldosteronism genes to chromosome 16p12.2–13.11 and 12p13.1-pter by homozygosity mapping. Hum Mol Genet 5:293–299[Abstract/Free Full Text]
  9. Saxena A, Hanukoglu I, Strautnieks SS, Thompson RJ, Gardiner RM, Hanukoglu, A 1998 Gene structure of the human amiloride-sensitive epithelial sodium channel ß subunit. Biochem Biophys Res Commun 252:208–213[CrossRef][Medline]
  10. Hanukoglu A 1991 Type I pseudohypoaldosteronism includes two clinically and genetically distinct entities with either renal or multiple target organ defects. J Clin Endocrinol Metab 73:936–944[Abstract/Free Full Text]
  11. Hanukoglu A, Bistritzer T, Rakover, Y, Mandelberg A 1994 Pseudohypoaldosteronism with increased sweat and saliva electrolyte values and frequent lower respiratory tract infections mimicking cystic fibrosis. J Pediatr 125:752–755[CrossRef][Medline]
  12. Cheek DB, Perry JW 1958 A salt wasting syndrome in infancy. Arch Dis Child 33:252–256
  13. Hanukoglu A, Fried D, Gotlieb A 1978 Inheritance of pseudohypoaldosteronism. Lancet 1:1359
  14. Oberfield SE, Levine LS, Carey RM, Bejar R, New MI 1979 Pseudohypoaldosteronism: multiple target organ unresponsiveness to mineralocorticoid hormones. J Clin Endocrinol Metab 48:228–234[Abstract/Free Full Text]
  15. Dillon MJ, Leonard JV, Buckler JM, Ogilvie D, Lillystone D, Honour JW, Shackleton CH 1980 Pseudohypoaldosteronism. Arch Dis Child 55:427–434[Abstract/Free Full Text]
  16. Rosler A 1984 The natural history of salt-wasting disorders of adrenal and renal origin. J Clin Endocrinol Metab 59:689–700[Abstract/Free Full Text]
  17. Speiser PW, Stoner E, New MI 1986 Pseudohypoaldosteronism: a review and report of two new cases. Adv Exp Med Biol 196:173–195[Medline]
  18. Wehling M, Kuhnle U, Daumer C, Armanini D 1989 Inheritance of mineralocorticoid effector abnormalities of human mononuclear leucocytes in families with pseudohypoaldosteronism. Clin Endocrinol (Oxf) 31:597–605[Medline]
  19. Chang SS, Grunder S, Hanukoglu A, Rosler A, Mathew PM, Hanukoglu I, Schild L, Lu Y, Shimkets RA, Nelson-Williams C, Rossier BC, Lifton RP 1996 Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalaemic acidosis, pseudohypoaldosteronism type 1. Nat Genet 12:248–253[CrossRef][Medline]
  20. Kerem E, Bistritzer T, Hanukoglu A, Hofmann T, Zhou Z, Bennett W, MacLaughlin E, Barker P, Nash M, Quittell L, Boucher R, Knowles MR 1999 Pulmonary epithelial sodium-channel dysfunction and excess airway liquid in pseudohypoaldosteronism. N Engl J Med 341:156–162[Abstract/Free Full Text]
  21. Adachi M, Tachibana K, Asakura Y, Abe S, Nakae J, Tajima T, Fujieda K 2000 Compound heterozygous mutations in the {gamma} subunit gene of ENaC (1627delG and 1570–1G->A) in one sporadic Japanese patient with a systemic form of pseudohypoaldosteronism type 1. J Clin Endocrinol Metab 86:9–12[Abstract/Free Full Text]
  22. Schaedel C, Marthinsen L, Kristoffersson AC, Kornfalt R, Nilsson KO, Orlenius B, Holmberg L 1999 Lung symptoms in pseudohypoaldosteronism type 1 are associated with deficiency of the {alpha}-subunit of the epithelial sodium channel. J Pediatr 135:739–745[CrossRef][Medline]
  23. Strautnieks SS, Thompson RJ, Gardiner RM, Chung E 1996 A novel splice-site mutation in the gamma subunit of the epithelial sodium channel gene in three pseudohypoaldosteronism type 1 families. Nat Genet 13:248–250[CrossRef][Medline]
  24. Bonny O, Hummler E 2000 Dysfunction of epithelial sodium transport: from human to mouse. Kidney Int 57:1313–1318[CrossRef][Medline]
  25. Schild L, Lu Y, Gautschi I, Schneeberger E, Lifton RP, Rossier BC 1996 Identification of a PY motif in the epithelial Na channel subunits as a target sequence for mutations causing channel activation found in Liddle syndrome. EMBO J 15:2381–2387[Medline]
  26. Staub O, Dho S, Henry PC, Correa J, Ishikawa T, McGlade J, Rotin D 1996 WW domains of Nedd4 bind to the proline-rich PY motifs in the epithelial Na+ channel deleted in Liddle’s syndrome. EMBO J 15:2371–2380[Medline]
  27. Su YR, Menon AG 2001 Epithelial sodium channels and hypertension. Drug Metab Dispos 29:553–556[Abstract/Free Full Text]
  28. Miller SA, Dykes DD, Polesky HF 1988 A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16:215
  29. Ludwig M, Bolkenius U, Wickert L, Marynen P, Bidlingmaier F 1998 Structural organisation of the gene encoding the {alpha}-subunit of the human amiloride-sensitive epithelial sodium channel. Hum Genet 102:576–581[CrossRef][Medline]
  30. Thomas CP, Doggett NA, Fisher R, Stokes JB 1996 Genomic organization and the 5' flanking region of the gamma subunit of the human amiloride-sensitive epithelial sodium channel. J Biol Chem 271:26062–26066[Abstract/Free Full Text]
  31. Voilley N, Lingueglia E, Champigny G, Mattei MG, Waldmann R, Lazdunski M, Barbry P 1994 The lung amiloride-sensitive Na+ channel: biophysical properties, pharmacology, ontogenesis, and molecular cloning. Proc Natl Acad Sci USA 91:247–251[Abstract/Free Full Text]
  32. McDonald FJ, Snyder PM, Price MP, Welsh MJ 1995 Cloning and expression of the ß and {gamma} subunits of the human epithelial sodium channel. Am J Physiol 268:1157–1163
  33. Ludwig M, Bolkenius U, Wickert L, Bidlingmaier F 1998 Common polymorphisms in genes encoding the human mineralocorticoid receptor and the human amiloride-sensitive sodium channel. J Steroid Biochem Mol Biol 64:227–230[CrossRef][Medline]
  34. Arai K, Zachman K, Shibasaki T, Chrousos, GP 1999 Polymorphisms of amiloride-sensitive sodium channel subunits in five sporadic cases of pseudohypoaldosteronism: do they have pathologic potential? J Clin Endocrinol Metab 84:2434–2437[Abstract/Free Full Text]
  35. Persu A, Barbry P, Bassilana F, Houot AM, Mengual R, Lazdunski M, Corvol P, Jeunemaitre X 1998 Genetic analysis of the ß subunit of the epithelial Na+ channel in essential hypertension. Hypertension 32:129–137[Abstract/Free Full Text]
  36. Chang H, Fujita T 1996 Lack of mutations in epithelial sodium channel ß-subunit gene in human subjects with hypertension. J Hypertens 14:1417–1419[CrossRef][Medline]
  37. Fodinger M, Schedler D, Fritsche-Polanz R, Horl WH, Sunder-Plassmann G 1999 Molecular analysis of the carboxy terminus of the ß and {gamma} subunits of the epithelial sodium channel in patients with end-stage renal disease. Nephron 81:381–386[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
W. Yan, L. Spruce, M. M. Rosenblatt, T. R. Kleyman, and R. C. Rubenstein
Intracellular trafficking of a polymorphism in the COOH terminus of the {alpha}-subunit of the human epithelial sodium channel is modulated by casein kinase 1
Am J Physiol Renal Physiol, September 1, 2007; 293(3): F868 - F876.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
W. Yan, L. Suaud, T. R. Kleyman, and R. C. Rubenstein
Differential modulation of a polymorphism in the COOH terminus of the {alpha}-subunit of the human epithelial sodium channel by protein kinase C{delta}
Am J Physiol Renal Physiol, February 1, 2006; 290(2): F279 - F288.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. F. Samaha, R. C. Rubenstein, W. Yan, M. Ramkumar, D. I. Levy, Y. J. Ahn, S. Sheng, and T. R. Kleyman
Functional Polymorphism in the Carboxyl Terminus of the {alpha}-Subunit of the Human Epithelial Sodium Channel
J. Biol. Chem., June 4, 2004; 279(23): 23900 - 23907.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A.-M. Nystrom, M.-L. Bondeson, N. Skanke, J. Martensson, B. Stromberg, J. Gustafsson, and G. Anneren
A Novel Nonsense Mutation of the Mineralocorticoid Receptor Gene in a Swedish Family with Pseudohypoaldosteronism Type I (PHA1)
J. Clin. Endocrinol. Metab., January 1, 2004; 89(1): 227 - 231.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saxena, A.
Right arrow Articles by Hanukoglu, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saxena, A.
Right arrow Articles by Hanukoglu, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals